Mouse mammary tumour virus related sequences are present in human DNA

MuMTV-related sequences have been identified in the DNA of human breast cancer cells using the Southern transfer technique and hybridisation with cloned MuMTV DNA under conditions in which partially mismatched sequences form stable hybrids. Hybridisation with cloned fragments of the MuMTV genome showed that the gag-pol region shares the most homology (estimated to be greater than 80%) with the human MuMTV-related sequences, however, DNA fragments partially homologous to the MuMTV LTR, gag ad env regions were also detected. Analysis of several human DNA samples suggests that the majority of the human MuMTV-related sequences are genetically transmitted but additional Eco R1 fragments were detected in the DNA of one out of three breast cancer cell lines, MCF7. These sequences are potential probes for the human MuMTV-related retroviral sequences and will allow their possible role in human breast cancer to be evaluated.     

The effect of 1-deoxymannojirimycin on rat liver alpha-mannosidases

Cloned murine mammary tumor virus (MuMTV) sequences allowed us to search for murine mammary tumor virus related sequences in the DNA of surgically removed human breast tumors. Out of 28 tumors so far examined two were found to contain an Eco RI DNA fragment homologous to the long terminal repeat-group antigen (LTR-Gag) and the Envelope (Env) sequences of MuMTV. We have taken the lymphocytes of these patients and cultured them. Rapid growth of lymphocytes, mostly of T origin, occurred in the presence of T cell growth factor (TCGF). Whereas DNA extracted from fresh lymphocytes is negative, that extracted from the 3-day cultured lymphocytes showed MuMTV related sequences. Long term cultures of T cells and a similar culture derived from a healthy person donor were negative at all stages. DNA extracted from the Ebstein Barr Virus-transformed B cells of the patient does not contain the MuMTV related sequences.     

Integration of New Endogenous Mouse Mammary Tumor Virus Proviral DNA at Common Sites in the DNA of Mammary Tumors of C3Hf Mice and Hypomethylation of the Endogenous Mouse Mammary Tumor Virus Proviral DNA in C3Hf Mammary Tumors and Spleens

To understand the molecular mechanisms by which the endogenous murine mammary tumor virus (MuMTV) proviruses are expressed and produce late-occurring mammary tumors in C3Hf mice, we analyzed, by the use of restriction enzymes and the Southern transfer procedure, genomic DNA from normal organs of mammary tumor-bearing and tumor-free mice and from 12 late-occurring C3Hf mammary tumors. We found, by using the restriction enzymes EcoRI and HindIII, that in addition to the preexisting endogenous MuMTV proviruses, new MuMTV-specific proviral DNA was integrated into new sites in the host genome in all 12 of the tumors that we examined. PstI digests of C3Hf tumor DNA revealed that the new proviral DNA found in C3Hf tumors was of endogenous origin. Moreover, the respective sizes of at least one of the new DNA fragments generated by EcoRI or HindIII digestion were the same in at least 50% of the C3Hf tumors analyzed, suggesting that the integration site of this new proviral DNA could be at the same location in the host genome of these tumors. Our results may imply that mammary tumorigenesis in C3Hf mice results from activation of cellular oncogenes by an MuMTV proviral DNA promoter. Specific hypomethylation of MuMTV proviral DNA was detected in the mammary tumors and spleens of C3Hf tumor-bearing mice. Our results indicated that most, if not all, of the hypomethylated MuMTV proviral DNA sequences were derived from the endogenous MuMTV provirus located at the MTV-1 locus, a locus responsible for the production of MuMTV antigens and increased incidence of mammary carcinoma in C3Hf mice. In spleens of non-tumor-bearing mice of ages 3, 6, 9, and 12 months, there was progressive hypomethylation of proviral DNA with increasing age, suggesting a possible correlation between demethylation of MuMTV proviral DNA in the spleens of C3Hf mice and the expression of endogenous MuMTV.     

Variants of a cloned synthetic lactose operator: I. A palindromic dimer lactose operator derived from one strand of the cloned 40-base pair operator

Starting with one strand of the 40-bp synthetic operator (Sadler et al., 1978), we have constructed and cloned a 66-bp, palindromic DNA segment with the following sequence

where the horizontal arrows indicate the locations of the two 21-bp “core? operator sequences in this segment and the vertical arrow designates the dyad axis of symmetry. Upon denaturation and rapid renaturation, each strand of this fragment forms a hairpin molecule still retaining an EcoRI cohesive end. Two hairpin molecules can be joined with T4 DNA ligase to form a duplex DNA molecule having no ends (dumbbell form A). Denaturation and rapid renaturation of dumbbell A yields a mixture of two dumbbell forms: dumbbell A which is a substrate for EcoKL, and a new form, dumbbell B, which is not a substrate. Each of the conformations of this DNA fragment have been purified and all are active in binding lactose repressor in vitro.     

Murine Mammary Tumor Virus Expression During Mammary Tumorigenesis in BALB/c Mice

Steady-state levels of murine mammary tumor virus (MuMTV) RNA were quantitated during mammary tumorigenesis in BALB/c mice by molecular hybridization with a representative MuMTV complementary DNA (cDNA) probe. Hyperplastic alveolar nodule (HAN) lines are preneoplastic mammary lesions that were induced in BALB/c mice by hormones alone or in combination with 7,12-dimethylbenz(a)anthracene and give rise to mammary tumors. The hormone-induced HAN lines D1 and D2 contained detectable amounts of hybridizable MuMTV sequences. MuMTV RNA sequences were also observed in five of the six transplanted BALB/c mammary tumors that were examined. Similar levels of hybridizable MuMTV RNA were observed between the D1 or D2 HAN line and mammary tumors derived from each HAN line. The D2 HAN line as well as D2, C4, and CD8 mammary tumors accumulated RNA that was apparently homologous to most of the MuMTV genome. Thermal denaturation of hybrids indicated extensive sequence homology between the MuMTV cDNA and hybridizable RNA in the BALB/c HAN lines and mammary tumors. A low level of type C viral RNA was observed in the BALB/c HAN lines and most mammary tumors by molecular hybridization with a cDNA to Moloney murine leukemia virus. These data demonstrate that MuMTV sequences are frequently expressed in hormone-induced BALB/c HAN lines and mammary tumors derived from HAN lines or ductal hyperplasias induced in BALB/c mice by hormones and/or a chemical carcinogen. The transition from the preneoplastic to the neoplastic state in BALB/c mice does not appear to be due to a change in the steady-state levels of MuMTV RNA since the hormone-induced HAN lines and mammary tumors had similar levels of hybridizable MuMTV RNA.     

Murine mammary tumor virus: characterization of infection of nonmurine cells.

Murine mammary tumor virus (MuMTV) was used to productively infect feline and mink cells. MuMTV "proviral" DNA could be detected in the infected cells by molecular hybridization using radioactive MuMTV complementary DNA as a probe. Kinetic analysis of MuMTV proviral DNA synthesis after infection showed that maximum MuMTV DNA synthesis was achieved by 8 h; however, this was followed by a decline in detectable proviral DNA and eventual stabilization at a lower level. MuMTV synthesis in feline cells was greatly stimulated by the synthetic glucocorticoid, dexamehtasone. On the other hand, MuMTV synthesis in mink cells was relatively at a much higher level in absence of dexamethasone and the stimulation with dexamethasone was not as marked as in the case with infected feline cells. Thermal denaturation of hybrids between MuMTV complementary DNA and infected mink cell RNA revealed no difference from homologous hybrids.     

DNA sequences complementary to human 7 SK RNA show structural similarities to the short mobile elements of the mammalian genome

A complementary DNA clone of 7 SK RNA from HeLa cells was used to study the genomic organization of 7 SK sequences in the human genome. Genomic hybridizations and genomic clones show that 7 SK is homologous to a family of disperse repeated sequences most of which lack the 3' end of the 7 SK RNA sequence. Only few of the genomic K sequences are homologous to both 3' and 5' 7 SK probes and presumably include the gene(s) for 7 SK RNA. The sequence of four genomic 7 SK clones confirms that they are in most cases pseudogenes. Although Alu sequences are frequently found near the 3' and 5' end of K DNA, the sequences immediately flanking the pseudogenes are different in all clones studied. However, direct repeats were found flanking directly the K DNA or the K-Alu unit, suggesting that the K sequences alone or in conjunction with Alu DNA might constitute a mobile element.     

Sequence definition and organization of a human repeated DNA

DNA sequence data for a DNA repeated sequence, found largely in centromeres of specific human chromosomes is presented. The sequence consists of two tandem 169 and 171 base-pair units that show 27% base variation with each other. In contrast the dimer is more faithfully copied in longer tandem repeats, such as the sequenced 680 base-pair tetramer. In the major sequence of the tetramer, base variation of the order of only 1%, in comparison to the complete dimer is seen. A minimum of two steps in the formation of this sequence is proposed, consisting of evolution of a tandem dimer of two 170 base-pair variant units of a related family within the human genome, and later saltation or amplification of this dimer. No evidence that these sequences contained or evolved from a simpler 6 to 20 base-pair repeat was found, and no homology with known simpler human satellites could be discerned. In reviewing and comparing the literature on repeated DNAs it appears that overall length and tandem repetition are the critical features, rather than individual unit repeat length or secondary structural potential, in defining these sequences as a class and their special centromeric functions and higher chromosome order. The possibility that such sequences arise from a reservoir of interspersed sequences that are common to at least several species is discussed.     

Enrichment of meiotic recombination hotspot sequences by avidin capture technology

About 40% of the hotspots for meiotic recombination contain the degenerate consensus sequence 5′-CCNCCNTNNCCNC-3′. Here we present a novel protocol for enriching hotspot sequences from digested genomic DNA by using biotinylated oligonucleotides and streptavidin-coated magnetic beads. The captured hotspots can be released by simple digestion with restriction enzymes for subsequent characterization by second generation sequencing or PCR. The capture protocol specifically enriches hotspot sequences, judged by using fluorophore-conjugated synthetic oligonucleotides and synthetic double-stranded oligonucleotides in combination with PCR. The capture protocol enriches single-stranded DNA, denatured double-stranded DNA, and large fragments (> 3000 bp) of digested plasmid DNA with good efficacy. No false positive and false negatives were detected when enriching digested DNA from human cell cultures and primary human cells. The protocol can probably be adapted to enriching sequences other than the hotspot sequence by altering the sequence in the capture oligonucleotide. We intend to apply this protocol in studies assessing effects of micronutrient status on meiotic recombination events in human sperm.     

Rapid purification of plasmid DNA by a single centrifugation in a two-step cesium chloride-ethidium bromide gradient

A procedure for rapid, preparative purification of plasmid DNA is described and compared with a conventional equilibrium centrifugation method. A discontinuous, two-step CsCl-ethidium bromide gradient is used, with the starting position of the plasmid-containing extract being at the bottom of the tube. During centrifugation in a fixed angle rotor, covalently closed circular plasmid DNA is separated from contaminating protein, RNA, and chromosomal DNA in 5 hr. Plasmids purified by this method are considerably less contaminated with RNA than when purified by a 48-hr equilibrium run in a homogeneous gradient, as determined by agarose gel electrophoresis and 5'-end-labeling studies. Plasmid DNA purified in two-step gradients can be used directly for restriction endonuclease analysis and DNA sequencing.     

Cloning and sequence analysis of two monkey metallothionein cDNAs

We have isolated two metallothionein (MT) cDNA clones copied from the RNA of cadmium-resistant monkey kidney cells. The complete DNA sequences of these clones show that they encode two distinct MTs. One clone appears to represent monkey MT-II, as shown by its close homology to the human MT-II sequence, whereas the second may correspond to monkey MT-I or a related variant metallothionein. Conserved sequences were identified in both the 5′ and 3′ untranslated regions of these clones.     

Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.     

Screening recombinant phage M13 plaques with RNA probes; a one-step procedure which identifies clones containing either of the complementary DNA strands

We describe a method for detecting specific DNA sequences cloned in M13 phage vectors, based on the procedure of Woo (in Wu, R., Methods in Enzymology, Vol. 68, Academic Press, New York, 1979, pp. 389-395). M13 plaques are adsorbed to a nitrocellulose filter that has been pre-saturated with bacteria. The filter is incubated on an agar plate to amplify the phage; the DNA is alkali-denatured and then hybridized with a radioactive RNA probe. Unlike standard procedures, this method detects and distinguishes M13 plaques containing phage particles which harbor either the coding or non-coding (RNA-like) DNA strand, when single-stranded RNA is used as probe. We have optimized this procedure with M13 clones containing mouse histidine tRNA gene sequences and have used it to determine the sequence of both strands of a mouse glycine tRNA gene.     

Cloning of eukaryotic genes in single-strand phage vectors: the human interferon genes

Using oligonucleotide probes with defined sequences, we have selected clones from a human lymphocyte cDNA library which represent human leukocyte (HuIFN-α) and fibroblast (HuIFN-β) interferon gene sequences. Double-stranded f1 phage DNA was used as the vector for initial cloning of cDNA. Clones carrying interferon gene sequences were identified by hybridization with the oligonucleotide probes. The same oligonucleotide probes were used as primers for dideoxy chain termination sequencing of the clones. One HuIFN-α clone, 201, has a nucleotide sequence different from published HuIFN-α sequences. Under control of the lacUV5 promoter, the 201 gene has been used to express biologically active HuIFN-α in Escherichia coli.     

Molecular analysis of the human interferon-alpha gene family

Fifteen DNA clones containing sequences related to human interferon-alpha cDNA were isolated from a human chromosomal gene bank (Nagata et al., Nature 287 (1980) 401-408) and characterized by restriction mapping, R-loop and heteroduplex analysis. Nine distinct DNA segments hybridized strongly with interferon-alpha 1 cDNA and formed R-loops with poly(A) RNA from interferon-producing human leukocytes; most if not all of these segments represent functional interferon genes. Five segments hybridized weakly with the probe and did not form R-loops with the poly(A) RNA; one of these was characterized as an interferon-alpha pseudogene. Several DNA segments overlap and define a region of 36 kilobase pairs (kb) that contains three strongly and three weakly hybridizing sequences. From our data and those of Goeddel et al. (Nature 290 (1981) 20-25) we conclude that there exist at least 11 distinct genes of gene-like sequences of the interferon-alpha type in the human genome, of which most likely represents an allelic variant, and at least five pseudogenes distantly related to the interferon-alpha genes.