The effect of deuterium oxide on the stability of the collagen model peptides H‐(Pro‐Pro‐Gly)10‐OH,H‐(Gly‐Pro‐4(R)Hyp)9‐OH,and Type I collagen

The collagen triple helix has a larger accessible surface area per molecular mass than globular proteins, and therefore potentially more water interaction sites. The effect of deuterium oxide on the stability of collagen model peptides and Type I collagen molecules was analyzed by circular dichroism and differential scanning calorimetry. The transition temperatures (T_m) of the protonated peptide (Pro‐Pro‐Gly)₁₀ were 25.4 and 28.7°C in H₂O and D₂O, respectively. The increase of the T_m of (Pro‐Pro‐Gly)₁₀ measured calorimetrically at 1.0°C min^?1 in a low pH solution from the protonated to the deuterated solvent was 5.1°C. The increases of the T_m for (Gly‐Pro‐4(R)Hyp)₉ and pepsin‐extracted Type I collagen were measured as 4.2 and 2.2°C, respectively. These results indicated that the increase in the T_m in the presence of D₂O is comparable to that of globular proteins, and much less than reported previously for collagen model peptides [Gough and Bhatnagar, J Biomol Struct Dyn 1999, 17, 481–491]. These experimental results suggest that the interaction of water molecules with collagen is similar to the interaction of water with globular proteins, when the ratio of collagen to water is very small and collagen is monomerically dispersed in the solvent. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 93–101, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Li+ counterion self-diffusion in ordered DNA

The anisotropic self-diffusion coefficient of ⁷Li⁺ (I = 3/2) counterions has been studied in hydrated, macroscopically oriented Li-(B)DNA fibers at relatively high water contents, corresponding to approximate DNA-DNA helix axis distances of 22–35 Å, using the pulsed field gradient hmr spin-echo method. Self-diffusion coefficients parallel (D_∥) and perpendicular (D_?) to the DNA helix axis increase with increasing salt content and with increasing DNA-DNA helix axis distance. The observed anisotropy D_∥/D_? decreases from 1.6 to 1.2 with the DNA-DNA separation increasing from 22 to 35 Å in the salt-free sample. This result can be understood by the obstruction effect caused by the DNA molecules themselves. The values of the Li⁺ self-diffusion coefficients in the most water-rich system with no added salt (corresponding to an approximate distance of 35 Å between the DNA helix axes) were D_∥ ～ 1.15 × 10^?10 m² s^?1 and D_? ～ 0.98 × 10^?10 m² s^?1, compared to 9.14 × 10^?10 m² s^?1 for the diffusion of Li⁺ in an aqueous solution of LiCl (～ 2.1M). The possible occurrence of restriction effects in the DNA fibers have also been studied by determining the self-diffusion coefficient at different effective diffusion times. The self-diffusion coefficient of Li⁺ in the sample with the largest DNA-DNA helix axis distance seems to be independent of the effective diffusion time, which indicates that the lithium ions are not trapped within impermeable barriers. The possibility of diffusion through permeable barriers has also been investigated, and is discussed. © 1994 John Wiley & Sons, Inc.     

Translational and rotational diffusion of tobacco mosaic virus from polarized and depolarized light scattering

The translational and rotational dynamics of tobacco mosaic virus in sodium phosphate buffer (pH =7.5) solutions has been investigated by polarized and depolarized light scattering Rayleigh linewidth studies. For concentrations ranging from 1.75 × 10^?4 g ml^?1 to 0.25 × 10^?4 g ml^?1 the translational diffusion coefficient (D_T) has been found to be slightly concentration dependent and extrapolation to zero concentration gives D₀^20°C = 0.34 ± 0.01 × 10^?7 cm²S^?1. A full analysis of the polarized spectra obtained at high and low scattering angles and the depolarized spectra at near zero scattering angles has enabled these techniques to be compared and the rotational diffusion constant D_R to be determined. At a solution concentration of 1.75 × 10^?4 g ml^?1 a mean value is found to be D_R^20°C = 350 ± 30s^?1. These values of D_T and D_R are in approximate agreement with calculations based on models of the tobacco mosaic virus molecule as a cylindrical rod.     

Solvent‐dependent conformation of amylose tris(phenylcarbamate) as deduced from scattering and viscosity data

The z‐average mean‐square radius of gyration 〈S²〉_z, the particle scattering function P(k), the second virial coefficient, and the intrinsic viscosity [η] have been determined for amylose tris(phenylcarbamate) (ATPC) in methyl acetate (MEA) at 25°C, in ethyl acetate (EA) at 33°C, and in 4‐methyl‐2‐pentanone (MIBK) at 25°C by light and small‐angle X‐ray scattering and viscometry as functions of the weight‐average molecular weight in a range from 2 × 10⁴ to 3 × 10⁶. The first two solvents attain the theta state, whereas the last one is a good solvent for the amylose derivative. Analysis of the 〈S²〉_z, P(k), and [η] data based on the wormlike chain yields h (the contour length or helix pitch per repeating unit) = 0.37 ± 0.02 and λ^?1 (the Kuhn segment length) = 15 ± 2 nm in MEA, h = 0.39 ± 0.02 and λ^?1 = 17 ± 2 nm in EA, and h = 0.42 ± 0.02 nm and λ^?1 = 24 ± 2 nm in MIBK. These h values, comparable with the helix pitches (0.37–0.40 nm) per residue of amylose triesters in the crystalline state, are somewhat larger than the previously determined h of 0.33 ± 0.02 nm for ATPC in 1,4‐dioxane and 2‐ethoxyethanol, in which intramolecular hydrogen bonds are formed between the C?O and NH groups of the neighbor repeating units. The slightly extended helices of ATPC in the ketone and ester solvents are most likely due to the replacement of those hydrogen bonds by intermolecular hydrogen bonds between the NH groups of the polymer and the carbonyl groups of the solvent. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 729–736, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor

The binding of a DNA aptamer (5′‐CCGTCTTCCAGACAAGAGTGCAGGG‐3′) to recombinant human vascular endothelial growth factor (VEGF₁₆₅) was characterized using surface plasmon resonance (SPR), fluorescence anisotropy and isothermal titration calorimetry (ITC). Results from both fluorescence anisotropy and ITC indicated that a single aptamer molecule binds to each VEGF homodimer, unlike other VEGF inhibitors that exhibit 2(ligand):1(VEGF homodimer) stoichiometry. In addition, ITC revealed that the association of the aptamer to VEGF at 20°C is enthalpically driven, with an unfavorable entropy contribution. SPR kinetic studies, with careful control of possible mass transfer effects, demonstrated that the aptamer binds to VEGF with an association rate constant k_on = 4.79 ± 0.03 × 10⁴ M^?1 s^?1 and a dissociation rate constant k_off = 5.21 ± 0.02 × 10^?4 s^?1 at 25°C. Key recognition hot‐spots were determined by a combination of aptamer sequence substitutions, truncations, and extensions. Most single‐nucleotide substitutions, particularly within an mfold‐predicted stem, suppress binding, whereas those within a predicted loop have a minimal effect. The 5′‐end of the aptamer plays a key role in VEGF recognition, as a single‐nucleotide truncation abolished VEGF binding. Conversely, an 11‐fold increase in the association rate (and affinity) is observed with a single cytosine nucleotide extension, due to pairing of the 3′‐GGG with 5′‐CCC in the extended aptamer. Our approach effectively maps the secondary structural elements in the free aptamer, which present the unpaired interface for high affinity VEGF recognition. These data demonstrate that a directed binding analysis can be used in concert with library screening to characterize and improve aptamer/ligand recognition. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 145–156, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Diverse modes of 5′‐[4‐(aminoiminomethyl)phenyl]‐[2,2′‐bifuran]‐5‐carboximidamide (DB832) interaction with multi‐stranded DNA structures

The modes of binding of 5′‐[4‐(aminoiminomethyl)phenyl]‐[2,2′‐Bifuran]‐5‐carboximidamide (DB832) to multi‐stranded DNAs: human telomere quadruplex, monomolecular R‐triplex, pyr/pur/pyr triplex consisting of 12 T*(T·A) triplets, and DNA double helical hairpin were studied. The optical adsorption of the ligand was used for monitoring the binding and for determination of the association constants and the numbers of binding sites. CD spectra of DB832 complexes with the oligonucleotides and the data on the energy transfer from DNA bases to the bound DB832 assisted in elucidating the binding modes. The affinity of DB832 to the studied multi‐stranded DNAs was found to be greater (K_ass ≈ 10⁷M^?1) than to the duplex DNA (K_ass ≈ 2 × 10⁵M^?1). A considerable stabilizing effect of DB832 binding on R‐triplex conformation was detected. The nature of the ligand tight binding differed for the studied multi‐stranded DNA depending on their specific conformational features: recombination‐type R‐triplex demonstrated the highest affinity for DB832 groove binding, while pyr/pur/pyr TTA triplex favored DB832 intercalation at the end stacking contacts and the human telomere quadruplex d[AG₃(T₂AG₃)₃] accommodated the ligand in a capping mode. Additionally, the pyr/pur/pyr TTA triplex and d[AG₃(T₂AG₃)₃] quadruplex bound DB832 into their grooves, though with a markedly lesser affinity. DB832 may be useful for discrimination of the multi‐sranded DNA conformations and for R‐triplex stabilization. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 8–20, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

The lateral diffusion coefficient of lecithin molecules in single bilayer vesicles studied by 14N NMR

The ¹⁴N nuclear relaxation times T₁ and T₂ in egg yolk phosphatidylcholine have been observed in single bilayer vesicles dispersed in the media of different viscosities, ¹H₂O and ²H₂O. The lateral diffusion coefficient of lipid molecule D has been calculated according to the method reported earlier: D = 2.2 × 10^?8cm²s^?1 in ¹H₂O and 2.1 × 10^?8cm²s^?1 in ²H₂O at 20°C. They are in excellent agreement. This result gives a strong basis of usefulness of ¹⁴N NMR method in the evaluation of D without introducing any system perturbation.     

The molecular structure and solution conformation of an acidic heteropolysaccharide from Auricularia auricula-judae

A water soluble acidic heteropolysaccharide named WAF was isolated from Auricularia auricula‐judae by extracting with 0.9% NaCl solution. By using gas chromatography, gas chromatography‐mass spectrometry, and NMR, its chemical structure was determined to be composed of a backbone of α‐(1→3)‐linked D ‐mannopyranose residues with pendant side groups of β‐D ‐xylose, β‐D ‐glucose, or β‐D ‐glucuronic acid at position O6 or O2. Six fractions prepared from WAF with a weight‐average molecular mass (M_w) between 5.9 × 10⁴ and 64.7 × 10⁴ g/mol were characterized with laser light scattering and viscometry in 0.1M NaCl at 25°C. The dependence of intrinsic viscosity ([η]) and radius of gyration (R_g) on M_w for this polysaccharide were found to be [η] = 1.79 × 10^?3M_w^0.96 cm³ g^?1 and R_g = 6.99 × 10^?2 M_w^0.54 nm. The molar mass per unit contour length (M_L) and the persistence length (L_p) were estimated to be 1124 nm^?1 and 11 nm, respectively. The WAF exhibited a semirigid character typical of linear polysaccharides. Molecular modeling was then used to predict the ordered and disordered states of WAF; the simulated M_L and L_p were however much smaller than the experimental values. Taken altogether, the results suggested that WAF formed a duplex in solution. © 2010 Wiley Periodicals, Inc. Biopolymers 95: 217–227, 2011.     

Chain conformation and bioactivity of water‐soluble polysaccharide extracted from Rhizoma Panacis Japonici

A water‐soluble α‐(1→4)‐D ‐glucan heteropolysaccharide with 37% degree of branch extracted by base from Rhizoma Panacis Japonici, coded as RPS3, was fractionated into six fractions by the method of nonsolvent addition. Their weight‐average molecular mass (M_w), polydispersity index (M_w/M_n), and radius of gyration (〈s²〉_z^1/2) were determined with laser light scattering (LLS) and size exclusion chromatography combined with LLS. The structure of the fraction was determined by methylation analyses and ¹³C NMR. The dependences of intrinsic viscosity ([η]) and 〈s²〉_z^1/2 on M_w were established as [η] = 0.71 M_w^{0.27 ± 0.01} (cm³/g) and 〈s²〉_z^1/2 = 1.53 M_w^{0.27 ± 0.02} (nm) in the M_w range from 5.62 × 10⁴ to 3.05 × 10⁶ (g/mol) for RPS3 in 0.15M NaCl aqueous solution at 25°C. On the basis of the current theory of the polymer solution, the fractal dimension (d_f), unperturbed chain dimension (A), and characteristic ratio (C_∞) were calculated to be 3.0, 1.48 Å, and 15.1, respectively. The results revealed that the RPS3 chains existed as spherical conformation in the aqueous solution. Transmission electron microscope further provided the evidence of the sphere shape of the RPS3 and its fractionated molecules in water. In vitro cytotoxicity assay indicated that the fractions could inhibit the tumor cells and showed no harm to normal cells at low dose. The bioactivity was relative with molecular mass of the samples. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 383–390, 2010. This article was originally published online as an acceptedpreprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office atbiopolymers@wiley.com     

Kinetics and mathematical modeling of infrared thin-layer drying of garlic slices

Drying of garlic slices in thin-layer have been studied with Infrared (IR) at 0.075, 0.15, 0.225 and 0.3 W cm^?2 radiation intensity and 0.75 and 1.25 m s^?1 air flow velocity. The results showed increasing in drying rate and decreasing at the time of drying with decreasing air flow velocity and increasing IR radiation intensity. The effective moisture diffusivity (D_eff) was obtained using Fick’s diffusion equation and its mean values ranged between 5.83×10^?11 and 7.66×10^?10 m² s^?1 for all investigated conditions. In addition, a third-order polynomial equation linking the effective moisture diffusivity and moisture content was found. Average activation energy increased with the decrease of IR radiation and increase of air flow velocity. Thirteen different mathematical models were verified with non-linear regression analysis for describing the garlic drying process. Modified Henderson and Pabis model presented the best prediction of the drying of garlic slices.     

Purification and Properties of 5-Ketogluconate Reductase from Gluconobacter liquefaciens

5-Ketogluconate reductase (5KGR) from the cell free extract of Gluconobacter liquefaciens (IFO 12388) was partially purified about 120-fold by a procedure employing ammonium sulfate fractionation, and DEAE-cellulose-, hydroxylapatite- and DEAE-Sephadex A-50-column chromatographies. NADP was specifically required for the oxidative reaction of gluconic acid. The optimum pH for the oxidation of gluconic acid (GA) to 5-ketogluconic acid (5KGA) by the enzyme was 10.0 and for the reduction of 5KGA was 7.5. The optimum temperature of the enzyme was 50°C for both reactions of oxidation and reduction. The enzyme was considerably unstable and lost all of its activity within 3 days. The enzyme activity was strongly inhibited with p-chloromercuribenzoate and mercury ion, but remarkably stimulated by EDTA (1 × 10^?3m). Apparent Km values were 1.8 × 10^?2m for GA, 0.9 × 10^?3m for 5KGA, 1.6 × 10^?5 m for NADP, and 1.1 × 10^?5 m for NADPH₂.     

Conformation dependence of the CαDα stretch mode in peptides: Side‐chain influence in dipeptide structures

We have shown by theoretical studies of alanine peptides that the C^αD^α stretch frequency could be particularly useful for determining peptide structure because of its sensitivity to the φ,ψ torsion angles at the C^α atom. To demonstrate that this is a robust methodology worthy of experimental exploration, we have also shown that this mode is even more determinative of conformation in aqueous solution, mainly as a result of the development of differential C^α? D^α···O(water) interactions. As further assurance, we now determine the influence of the side chain on this band, showing for aliphatic, a polar, and an aromatic side chains that the dependence is minor and explaining why this is also expected for other side chains. These results should stimulate new experimental methodologies in the field of peptide structure determination. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 1065–1071, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Purification and Properties of 2-Ketogluconate Reductase from Gluconobacter liquefaciens.

2-Ketogluconate reductase (2KGR) from the cell free extract of Gluconobacter liquefaciens (IFO 12388) was purified about 1000-fold by a procedure involving ammonium sulfate fractionation and column chromatographies using DEAE-cellulose, hydroxylapatite, and Sephadex gel The purified enzyme gave a single band on polyacrymamide gel electrophoresis. NADP was specifically required for the oxidation reaction of gluconic acid. Using gel filtration a molecular weight of about 110,000 was estimated for the enzyme. The pH optimum for the oxidation of gluconic acid (GA) to 2-ketogluconic acid (2KGA) by the enzyme was 10.5 and for the reduction of 2KGA was 6.5. The optimum temperature of the enzyme was 50 C for both reactions of oxidation and reduction. The enzyme was stable at pH between 5.0 and 11.0 and at temperature under 50°C, The enzyme activity was strongly inhibited with p-chloromercuribenzoate and mercury ions, but remarkably stimulated by manganese ions (1×10^?3 m). Km value of the enzyme for GA was 1.3×10^?2 m and for 2KGA was 6.6×10^?3 _m. Km values for NADP and NADPH₂ were 1.25×10^?5 and 1.52×10^?5 m respectively.     

Biochemical properties of the 1 alpha, 25-dihydroxyvitamin D3 cytoplasmic receptors from human and chick parathyroid glands

Cytoplasmic receptors for 1α, 25-dihydroxyvitamin D₃ from human parathyroid adenoma tissue and rachitic chick parathyroid glands have been characterized with regard to a number of physical, chemical, and ligand binding properties. Both receptors are 3.6–3.7 S proteins with molecular weights of approximately 75,000 and Stoke's molecular radii of 36 Å. It was found that the receptors possess a cysteine residue in or near the 1α, 25-dihydroxyvitamin D₃ binding site which is critical for ligand binding activity. The receptors both have equilibrium dissociation constants for 1α, 25-dihydroxyvitamin D₃ in the range of 2 to 5 × 10^?10m at 4 °C and second-order association rate constants for their seco-steroid ligand of 1 × 10⁷, m^?1 min^?1 (0 °C). The dissociation rate constants were found to be 5.3 × 10^?4 min^?1 (4 °C) for the human receptor and 1.3 × 10^?5 min^?1 (4 °C) for the chick receptor. The great deal of similarity which exists between the cytoplasmic 1α, 25-dihydroxyvitamin D₃ receptors from avian and mammalian parathyroid glands suggests a homologous function for these molecules in the two tissues.     

Histone-induced conformational changes in DNA as probed by quasi-elastic light scattering.

Quasi-elastic light scattering as measured by intensity fluctuation (self-beat) spectroscopy in the time domain can be profitably used to follow both the translational diffusion D and the dominant internal flexing mode τ_int of DNA and its complexes with various histones in aqueous salt solutions. Without histones, DNA is found to have D = 1.6 × 10^?8 cm²/sec and τ_int ? 5 × 10^?4 sec in 0.8 M NaCl, 2 M urea at 20°C. Total histone as well as fraction F2A induce supercoiling (D = 2.6 × 10^?8 cm²/sec, τ_int ? 2.8 × 10^?4 sec) whereas fraction F1 induces uncoiling (D = 1.0 × 10^?8 cm²/sec, τ_int ? 9.4 × 10^?4 sec). Upon increasing the salt concentration to 1.5 M the DNA–histone complex dissociates (D = 1.8 × 10^?8 cm²/sec). Upon decreasing the salt concentration to far below 0.8 M, the DNA–histone complex eventually precipitates as a chromatin gel.     

Impact of light quality on leaf and shoot hydraulic properties: a case study in silver birch (Betula pendula)

Responses of leaf and shoot hydraulic conductance to light quality were examined on shoots of silver birch (Betula pendula), cut from lower (‘shade position’) and upper thirds of the crowns (‘sun position’) of trees growing in a natural temperate forest stand. Hydraulic conductances of leaf blades (K_lb), petioles (K_P) and branches (i.e. leafless stem; K_B) were determined using a high pressure flow meter in steady state mode. The shoots were exposed to photosynthetic photon flux density of 200–250 µmol m^?2 s^?1 using white, blue or red light. K_lb depended significantly on both light quality and canopy position (P < 0.001), K_B on canopy position (P < 0.001) and exposure time (P = 0.014), and none of the three factors had effect on K_P. The highest values of K_lb were recorded under the blue light (3.63 and 3.13 × 10^?4 kg m^?2 MPa^?1 s^?1 for the sun and shade leaves, respectively), intermediate values under white light (3.37 and 2.46 × 10^?4 kg m^?2 MPa^?1 s^?1, respectively) and lowest values under red light (2.83 and 2.02 × 10^?4 kg m^?2 MPa^?1 s^?1, respectively). Light quality has an important impact on leaf hydraulic properties, independently of light intensity or of total light energy, and the specific light receptors involved in this response require identification. Given that natural canopy shade depletes blue and red light, K_lb may be decreased both by reduced fluence and shifts in light spectra, indicating the need for studies of the natural heterogeneity of K_lb within and under canopies, and its impacts on gas exchange.     

Dynamic light scattering from collagen solutions. I. Translational diffusion coefficient and aggregation effects

Solutions of native collagen extracted from rat tail tendons in neutral salt solution have been studied by dynamic light scattering. The spectra obtained are consistent with the presence in solution of both single rod-shaped collagen molecules and aggregates of molecules. No contribution to the spectrum has been detected at any scattering angle from rotational diffusion of single molecules, although a measurable broadening effect is expected at high angles. The translational diffusion coefficient D of single molecules, calculated from the broader spectral component, shows an anomalous dependence on collagen concentration with a maximum value of D_20,w = 8.6 ± 0.2 × 10^?12 m²/sec near the concentration 0.04% by weight. Above 0.05% D falls linearly with increasing concentration and takes the value D _20,w = 8.1 ± 0.2 × 10^?12 m²/sec at 0.064% collagen.     

Bioencapsulation of apomyoglobin in nanoporous organosilica sol–gel glasses: Influence of the siloxane network on the conformation and stability of a model protein

Nanoporous sol–gel glasses were used as host materials for the encapsulation of apomyoglobin, a model protein employed to probe in a rational manner the important factors that influence the protein conformation and stability in silica‐based materials. The transparent glasses were prepared from tetramethoxysilane (TMOS) and modified with a series of mono‐, di‐ and tri‐substituted alkoxysilanes, R_nSi(OCH₃)_4?n (R = methyl‐, n = 1; 2; 3) of different molar content (5, 10, 15%) to obtain the decrease of the siloxane linkage (? Si? O? Si? ). The conformation and thermal stability of apomyoglobin characterized by circular dichroism spectroscopy (CD) was related to the structure of the silica host matrix characterized by ²⁹Si MAS NMR and N₂ adsorption. We observed that the protein transits from an unfolded state in unmodified glass (TMOS) to a native‐like helical state in the organically modified glasses, but also that the secondary structure of the protein was enhanced by the decrease of the siloxane network with the methyl modification (n = 0 < n = 1 < n = 2 < n = 3; 0 < 5 < 10 < 15 mol %). In 15% trimethyl‐modified glass, the protein even reached a maximum molar helicity (?24,000 deg. cm² mol^?1) comparable to the stable folded heme‐bound holoprotein in solution. The protein conformation and stability induced by the change of its microlocal environment (surface hydration, crowding effects, microstructure of the host matrix) were discussed owing to this trend dependency. These results can have an important impact for the design of new efficient biomaterials (sensors or implanted devices) in which properly folded protein is necessary. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 895–906, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Binding of Paeonol to Human Serum Albumin: A Hybrid Spectroscopic Approach and Conformational Study

The purpose of this study was to elucidate the binding of paeonol to human serum albumin (HSA) through spectroscopic methods. The fluorescence quenching of HSA by paeonol was a result of the formation of the HSA–paeonol complex with low binding affinity (K = 4.45 × 10³ M^?1 at 298 K). Thermodynamic parameters (ΔG^○ = –2.08 × 10⁴ J·mol^?1, ΔS^○ = 77.9 J·mol^?1·K^?1, ΔH^○ = 2.41 × 10³ J·mol^?1, k_q = 9.67 × 10¹² M^?1·s^?1) revealed that paeonol mainly binds HSA through hydrophobic force following a static quenching mode. The binding distance was estimated to be 1.91 nm by fluorescence resonant energy transfer. The conformation of HSA was changed and aggregates were formed in the presence of paeonol, revealed by synchronous fluorescence, circular dichroism, Fourier transform infrared spectroscopy, three‐dimensional fluorescence spectroscopy, and resonance light scattering results.     

A quasi-elastic laser light scattering study of tubulin and microtubule protein from bovine brain

Quasi-elastic light scattering has been used to characterize the oligomeric properties of solutions of glycerol-cycled bovine microtubule protein, and the properties of the 30 S oligomeric species and 6 S tubulin heterodimer prepared by gel filtration on Sepharose 6B. It is shown that in dimer preparations, as little as 0.04% by number of 30 S rings would account for the difference between an observed mean diffusion coefficient D_{20, W} = 3.1 × 10^?7 cm² s^?1 and the value of D_{20, W} = 5.1 × 10^?7 cm² s^?1 calculated for tubulin dimer of M_rel 100,000. The 30 S ring has an observed diffusion coefficient of D_{20, W} = 0.49 × 10^?7 cm² s^?1. These values are not changed significantly by the presence of 4 m-glycerol, indicating the persistence of 6 S and 30 S forms for dimer and ring, respectively.Mixtures of ring and dimer components of this preparation behave as a non-interacting two-component system, indicating the absence of substantial re-equilibration between the species at 5 °C and pH 6.5.The effect of salt on ring and microtubule protein samples indicates partial dissociation, consistent with the formation of additional intermediate oligomeric forms.In quasi-elastic light scattering measurements adapted to kinetic studies, changes in the oligomeric composition of microtubule protein are detected in the early stages of the reversible assembly process at pH 6.5. A 25% decrease in scattered light intensity, without significant change in mean diffusion coefficient, indicates the lability of the ring oligomeric structures, which undergo partial transformation to alternative oligomeric species under these assembly conditions.