Specific DNA G‐quadruplexes bind to ethanolamines

A significant number of G‐quadruplex‐forming sequences have been revealed in human genome by bioinformatic searches, implying that G‐quadruplexes may be involved in important biological processes and may be new chemotherapeutic targets. Therefore, it is important to discover the potential interactions of G‐quadruplexes with other molecules or groups. Here we describe a class of G‐quadruplexes, which can bind to ethanolamine groups that widely exist in biomolecules and drug molecules. The specific interaction of these G‐quadruplexes with ethanolamine groups was identified by high performance affinity chromatography (HPAC) using immobilized ethanolamine and diethanolamine as stationary phase reagents. The circular dichroism (CD) spectra and native polyacrylamide gel electrophoresis (PAGE) show that these ethanolamine binding quadruplexes adopt an intramolecularly parallel structure. The relationship of ethanolamine binding and G‐quadruplexe structure provides new clues for the G‐quadruplex‐related studies as well as for the molecular designs of therapeutic reagents. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 874–883, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Synthesis of quadruplex‐forming tetra‐end‐linked oligonucleotides: Effects of the linker size on quadruplex topology and stability

G‐quadruplexes are characteristic structural arrangements of guanine‐rich DNA sequences that abound in regions with relevant biological significance. These structures are highly polymorphic differing in the number and polarity of the strands, loop composition, and conformation. Furthermore, the cation species present in solution strongly influence the topology of the G‐quadruplexes. Recently, we reported the synthesis and structural studies of new G‐quadruplex forming oligodeoxynucleotides (ODNs) in which the 3′‐ and/or the 5′‐ends of four ODN strands are linked together by a non‐nucleotidic tetra‐end‐linker (TEL). These TEL‐ODN analogs having the sequence TGGGGT are able to form parallel G‐quadruplexes characterized by a remarkable high thermal stability. We report here an investigation about the influence of the reduction of the TEL size on the molecularity, topology, and stability of the resulting TEL‐G‐quadruplexes using a combination of circular dichroism (CD), CD melting, ¹H NMR spectroscopy, gel electrophoresis, and molecular modeling data. We found that all TEL‐(TGGGGT)₄ analogs, regardless the TEL size and the structural orientation of the ODN branches, formed parallel TEL‐G‐quadruplexes. The molecular modeling studies appear to be consistent with the experimental CD and NMR data revealing that the G‐quadruplexes formed by TEL‐ODNs having the longer TEL (L 1 ‐ 4 ) are more stable than the corresponding G‐quadruplexes having the shorter TEL (S 1 ‐ 4 ). The relative stability of S 1 ‐ 4 was also reported. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 466–477, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

An integrated molecular dynamics (MD) and experimental study of higher order human telomeric quadruplexes

Structural knowledge of telomeric DNA is critical for understanding telomere biology and for the utilization of telomeric DNA as a therapeutic target. Very little is known about the structure of long human DNA sequences that may form more than one quadruplex unit. Here, we report a combination of molecular dynamics simulations and experimental biophysical studies to explore the structural and dynamic properties of the human telomeric sequence (TTAGGG)₈TT that folds into two contiguous quadruplexes. Five higher order quadruplex models were built combining known single human telomeric quadruplex structures as unique building blocks. The biophysical properties of this sequence in K⁺ solution were experimentally investigated by means of analytical ultracentrifugation and UV spectroscopy. Additionally, the environments of loop adenines were probed by fluorescence studies using systematic single‐substitutions of 2‐aminopurine for the adenine bases. The comparison of the experimentally determined properties with the corresponding quantities predicted from the models allowed us to test the validity of each of the structural models. One model emerged whose properties are most consistent with the predictions, and which therefore is the most probable structure in solution. This structure features contiguous quadruplex units in an alternating hybrid‐1‐hybrid‐2 conformation with a highly ordered interface composed of loop residues from both quadruplexes © 2010 Wiley Periodicals, Inc. Biopolymers 93:533–548, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Characterization of the G‐quadruplex structure of a catalytic DNA with peroxidase activity

It has been reported that the complexes formed by hemin and some G‐quadruplexes can be developed as a new class of DNAzyme with peroxidase activity. This kind of DNAzyme has received a great deal of attention. But to date, the actual G‐quadruplex structure that can provide hemin with enhanced peroxidase activity is in doubt. Herein, the G‐quadruplex structure of CatG4, a 21‐nucleotide DNA oligomer which was previously reported to bind hemin and the resulting complex exhibiting enhanced peroxidase activity, was characterized by fluorescence and circular dichroism measurements. The results suggest that the catalytically active form of CatG4 may be a unimolecular parallel quadruplex rather than a unimolecular chair‐type antiparallel quadruplex or a multistranded parallel quadruplex. In addition, the fluorescence analysis of labeled oligonucleotides may be developed as a supplementary tool for the study of DNA conformations. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 331–339, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Diverse modes of 5′‐[4‐(aminoiminomethyl)phenyl]‐[2,2′‐bifuran]‐5‐carboximidamide (DB832) interaction with multi‐stranded DNA structures

The modes of binding of 5′‐[4‐(aminoiminomethyl)phenyl]‐[2,2′‐Bifuran]‐5‐carboximidamide (DB832) to multi‐stranded DNAs: human telomere quadruplex, monomolecular R‐triplex, pyr/pur/pyr triplex consisting of 12 T*(T·A) triplets, and DNA double helical hairpin were studied. The optical adsorption of the ligand was used for monitoring the binding and for determination of the association constants and the numbers of binding sites. CD spectra of DB832 complexes with the oligonucleotides and the data on the energy transfer from DNA bases to the bound DB832 assisted in elucidating the binding modes. The affinity of DB832 to the studied multi‐stranded DNAs was found to be greater (K_ass ≈ 10⁷M^?1) than to the duplex DNA (K_ass ≈ 2 × 10⁵M^?1). A considerable stabilizing effect of DB832 binding on R‐triplex conformation was detected. The nature of the ligand tight binding differed for the studied multi‐stranded DNA depending on their specific conformational features: recombination‐type R‐triplex demonstrated the highest affinity for DB832 groove binding, while pyr/pur/pyr TTA triplex favored DB832 intercalation at the end stacking contacts and the human telomere quadruplex d[AG₃(T₂AG₃)₃] accommodated the ligand in a capping mode. Additionally, the pyr/pur/pyr TTA triplex and d[AG₃(T₂AG₃)₃] quadruplex bound DB832 into their grooves, though with a markedly lesser affinity. DB832 may be useful for discrimination of the multi‐sranded DNA conformations and for R‐triplex stabilization. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 8–20, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Synchrotron radiation circular dichroism of various G‐quadruplex structures

Here we report synchrotron radiation circular dichroism spectra of various G‐quadruplexes from 179 to 350 nm, and a number of bands in the vacuum ultraviolet (VUV) are reported for the first time. For a tetramolecular parallel structure, the strongest band in the spectrum is a negative band in the VUV at 182 nm; for a bimolecular antiparallel structure with diagonal loops, a new strong positive band is found at 190 nm; for a bimolecular parallel structure with edgewise loops, a strong positive band at 189 nm is observed; and for a self‐folded chair‐type structure, the strongest band in the spectrum is a positive band at 187 nm. For the tetramolecular parallel structure, the CD signals at all wavelengths are dominated by contributions from quartets of G bases, and the signal strength is approximately proportional to the number of quartets. Our experiments on well‐characterized G‐quadruplex structures lead us to question past attributions of CD signals to helix handedness and G quartet polarity. Although differences can be observed in the VUV region for the various quadruplex types, there do not appear to be clear‐cut spectral features that can be used to identify specific topological features. It is suggested that this is because a dominant positive band in the VUV seen near 190 nm in all quadruplex structures is due to intrastrand guanine–guanine base stacking. However, our spectra can serve as reference spectra for the G‐quadruplex structures investigated and, not least, to benchmark theoretical calculations and empirical models. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 429–433, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

G-quadruplexes are specifically recognized and distinguished by selected designed ankyrin repeat proteins

We introduce designed ankyrin repeat binding proteins (DARPins) as a novel class of highly specific and structure-selective DNA-binding proteins, which can be functionally expressed within all cells. Human telomere quadruplex was used as target to select specific binders with ribosome display. The selected DARPins discriminate the human telomere quadruplex against the telomeric duplex and other quadruplexes. Affinities of the selected binders range from 3 to 100 nM. CD studies confirm that the quadruplex fold is maintained upon binding. The DARPins show different specificity profiles: some discriminate human telomere quadruplexes from other quadruplex-forming sequences like ILPR, c-MYC and c-KIT, while others recognize two of the sequences tested or even all quadruplexes. None of them recognizes dsDNA. Quadruplex-binding DARPins constitute valuable tools for specific detection at very small scales and for the in vivo investigation of quadruplex DNA.     

Quadruplexes of human telomere DNA analogs designed to contain G:A:G:A,G:G:A:A,and A:A:A:A tetrads

Replacement of two to four guanines by adenines in the human telomere DNA repeat dG₃(TTAG₃)₃ did not hinder the formation of quadruplexes if the substitutions took place in the terminal tetrad bridged by the diagonal loop of the intramolecular antiparallel three‐tetrad scaffold, as proved by CD and PAGE in both Na⁺ and K⁺ solutions. Thermodynamic data showed that, in Na⁺ solution, the dG₃(TTAG₃)₃ quadruplex was destabilized, the least by the two G:A:G:A tetrads, the most by the G:G:A:A tetrad in which the adenosines replaced syn‐guanosines. In physiological K⁺ solution, the highest destabilization was caused by the 4A tetrad. In K⁺, only the unmodified dG₃(TTAG₃)₃ quadruplex rearranged into a K⁺‐dependent quadruplex form, none of the multiple adenine‐modified structures did so. This may imply biological consequences for nonrepaired A‐for‐G mutations. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 880–886, 2010.     

Guanine quadruplex formation by RNA/DNA hybrid analogs of Oxytricha telomere G(4)T(4)G(4) fragment

Using circular dichroism spectroscopy, gel electrophoresis, and ultraviolet absorption spectroscopy, we have studied quadruplex folding of RNA/DNA analogs of the Oxytricha telomere fragment, G(4)T(4)G(4), which forms the well-known basket-type, antiparallel quadruplex. We have substituted riboguanines (g) for deoxyriboguanines (G) in the positions G1, G9, G4, and G12; these positions form the terminal tetrads of the G(4)T(4)G(4) quadruplex and adopt syn, syn, anti, and anti glycosidic geometries, respectively. We show that substitution of a single sugar was able to change the quadruplex topology. With the exception of G(4)T(4)G(3)g, which adopted an antiparallel structure, all the RNA/DNA hybrid analogs formed parallel, bimolecular quadruplexes in concentrated solution at low salt. In dilute solutions ( approximately 0.1 mM nucleoside), the RNA/DNA hybrids substituted at positions 4 or 12 adopted antiparallel quadruplexes, which were especially stable in Na(+) solutions. The hybrids substituted at positions 1 and 9 preferably formed parallel quadruplexes, which were more stable than the nonmodified G(4)T(4)G(4) quadruplex in K(+) solutions. Substitutions near the 3'end of the molecule affected folding more than substitutions near the 5'end. The ability to control quadruplex folding will allow further studies of biophysical and biological properties of the various folding topologies. (c) 2008 Wiley Periodicals, Inc. Biopolymers 89: 797-806, 2008.This article was originally published online as an accepted preprint. The "Published Online" date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com.     

Folding thermodynamics of the hybrid‐1 type intramolecular human telomeric G‐quadruplex

Guanine‐rich DNA sequences that may form G‐quadruplexes are located in strategic DNA loci with the ability to regulate biological events. G‐quadruplexes have been under intensive scrutiny owing to their potential to serve as novel drug targets in emerging anticancer strategies. Thermodynamic characterization of G‐quadruplexes is an important and necessary step in developing predictive algorithms for evaluating the conformational preferences of G‐rich sequences in the presence or the absence of their complementary C‐rich strands. We use a combination of spectroscopic, calorimetric, and volumetric techniques to characterize the folding/unfolding transitions of the 26‐meric human telomeric sequence d[A₃G₃(T₂AG₃)₃A₂]. In the presence of K⁺ ions, the latter adopts the hybrid‐1 G‐quadruplex conformation, a tightly packed structure with an unusually small number of solvent‐exposed atomic groups. The K⁺‐induced folding of the G‐quadruplex at room temperature is a slow process that involves significant accumulation of an intermediate at the early stages of the transition. The G‐quadruplex state of the oligomeric sequence is characterized by a larger volume and compressibility and a smaller expansibility than the coil state. These results are in qualitative agreement with each other all suggesting significant dehydration to accompany the G‐quadruplex formation. Based on our volume data, 432 ± 19 water molecules become released to the bulk upon the G‐quadruplex formation. This large number is consistent with a picture in which DNA dehydration is not limited to water molecules in direct contact with the regions that become buried but involves a general decrease in solute–solvent interactions all over the surface of the folded structure. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 216–227, 2014.     

Sequence‐dependent folding and unfolding of ligand‐bound purine riboswitches

Riboswitch regulation of gene expression requires ligand‐mediated RNA folding. From the fluorescence lifetime distribution of bound 2‐aminopurine ligand, we resolve three RNA conformers (C_o, C_i, C_c) of the liganded G‐ and A‐sensing riboswitches from Bacillus subtilis. The ligand binding affinities, and sensitivity to Mg²⁺, together with results from mutagenesis, suggest that C_o and C_i are partially unfolded species compromised in key loop‐loop interactions present in the fully folded C_c. These data verify that the ligand‐bound riboswitches may dynamically fold and unfold in solution, and reveal differences in the distribution of folded states between two structurally homologous purine riboswitches: Ligand‐mediated folding of the G‐sensing riboswitch is more effective, less dependent on Mg²⁺, and less debilitated by mutation, than the A‐sensing riboswitch, which remains more unfolded in its liganded state. We propose that these sequence‐dependent RNA dynamics, which adjust the balance of ligand‐mediated folding and unfolding, enable different degrees of kinetic discrimination in ligand binding, and fine‐tuning of gene regulatory mechanisms. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 953–965, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Stability of human telomere quadruplexes at high DNA concentrations

For mimicking macromolecular crowding of DNA quadruplexes, various crowding agents have been used, typically PEG, with quadruplexes of micromolar strand concentrations. Thermal and thermodynamic stabilities of these quadruplexes increased with the concentration of the agents, the rise depended on the crowder used. A different phenomenon was observed, and is presented in this article, when the crowder was the quadruplex itself. With DNA strand concentrations ranging from 3 µM to 9 mM, the thermostability did not change up to ～2 mM, above which it increased, indicating that the unfolding quadruplex units were not monomolecular above ～2 mM. The results are explained by self‐association of the G‐quadruplexes above this concentration. The ΔG^o₃₇ values, evaluated only below 2 mM, did not become more negative, as with the non‐DNA crowders, instead, slightly increased. Folding topology changed from antiparallel to hybrid above 2 mM, and then to parallel quadruplexes at high, 6–9 mM strand concentrations. In this range, the concentration of the DNA phosphate anions approached the concentration of the K⁺ counterions used. Volume exclusion is assumed to promote the topological changes of quadruplexes toward the parallel, and the decreased screening of anions could affect their stability. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 428–438, 2014.     

Comparison of the internalization of targeted dendrimers and dendrimer‐entrapped gold nanoparticles into cancer cells

Dendrimer‐based nanotechnology significantly advances the area of targeted cancer imaging and therapy. Herein, we compared the difference of surface acetylated fluorescein isocyanate (FI) and folic acid (FA) modified generation 5 (G5) poly(amidoamine) dendrimers (G5.NHAc‐FI‐FA), and dendrimer‐entrapped gold nanoparticles with similar modifications ([(Au⁰)_51.2‐G5.NHAc‐FI‐FA]) in terms of their specific internalization to FA receptor (FAR)‐overexpressing cancer cells. Confocal microscopic studies show that both G5.NHAc‐FI‐FA and [(Au⁰)_51.2‐G5.NHAc‐FI‐FA] exhibit similar internalization kinetics regardless of the existence of Au nanoparticles (NPs). Molecular dynamics simulation of the two different nanostructures reveals that the surface area and the FA moiety distribution from the center of the geometry are slightly different. This slight difference may not be recognized by the FARs on the cell membrane, consequently leading to similar internalization kinetics. This study underlines the fact that metal or inorganic NPs entrapped within dendrimers interact with cells in a similar way to that of dendrimers lacking host NPs. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 936–942, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

NMR studies of an immunomodulatory benzodiazepine binding to its molecular target on the mitochondrial F1F0‐ATPase

Bz‐423 is an inhibitor of the mitochondrial F₁F₀‐ATPase, with therapeutic properties in murine models of immune diseases. Here, we study the binding of a water‐soluble Bz‐423 analog (5‐(3‐(aminomethyl)phenyl)‐7‐chloro‐ 1‐methyl‐3‐(naphthalen‐2‐ylmethyl)‐1H‐benzo][e][1,4]diazepin‐2(3H)‐one); (1) to its target subunit on the enzyme, the oligomycin sensitivity conferring protein (OSCP), by NMR spectroscopy using chemical shift perturbation and cross‐relaxation experiments. Titration experiments with constructs representing residues 1–120 or 1–145 of the OSCP reveals that (a) 1 binds to a region of the protein, at the minimum, comprising residues M51, L56, K65, V66, K75, K77, and N92, and (b) binding of 1 induces conformational changes in the OSCP. Control experiments employing a variant of 1 in which a key binding element on the small molecule was deleted; it had no perturbational effect on the spectra of the OSCP, which indicates that the observed changes with 1 represent specific binding interactions. Collectively, these data suggest that 1 might inhibit the enzyme through an allosteric mechanism where binding results in conformational changes that perturb the OSCP‐F₁ interface resulting in disrupted communication between the peripheral stalk and the F₁‐domain of the enzyme. © 2009 Wiley Periodicals, Inc. Biopolymers 29: 85–92, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Deciphering interactions of the aminoglycoside phosphotransferase(3′)‐IIIa with its ligands

Aminoglycoside phosphotransferase(3′)‐IIIa (APH) is the enzyme with broadest substrate range among the phosphotransferases that cause resistance to aminoglycoside antibiotics. In this study, the thermodynamic characterization of interactions of APH with its ligands are done by determining dissociation constants of enzyme–substrate complexes using electron paramagnetic resonance and fluorescence spectroscopy. Metal binding studies showed that three divalent cations bind to the apo‐enzyme with low affinity. In the presence of AMPPCP, binding of the divalent cations occurs with 7‐to‐37‐fold higher affinity to three additional sites dependent on the presence and absence of different aminoglycosides. Surprisingly, when both ligands, AMPPCP and aminoglycoside, are present, the number of high affinity metal binding sites is reduced to two with a 2‐fold increase in binding affinity. The presence of divalent cations, with or without aminoglycoside present, shows only a small effect (<3‐fold) on binding affinity of the nucleotide to the enzyme. The presence of metal–nucleotide, but not nucleotide alone, increases the binding affinity of aminoglycosides to APH. Replacement of magnesium (II) with manganese (II) lowered the catalytic rates significantly while affecting the substrate selectivity of the enzyme such that the aminoglycosides with 2′‐NH₂ become better substrates (higher V_max) than those with 2′‐OH. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 801–809, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor

The binding of a DNA aptamer (5′‐CCGTCTTCCAGACAAGAGTGCAGGG‐3′) to recombinant human vascular endothelial growth factor (VEGF₁₆₅) was characterized using surface plasmon resonance (SPR), fluorescence anisotropy and isothermal titration calorimetry (ITC). Results from both fluorescence anisotropy and ITC indicated that a single aptamer molecule binds to each VEGF homodimer, unlike other VEGF inhibitors that exhibit 2(ligand):1(VEGF homodimer) stoichiometry. In addition, ITC revealed that the association of the aptamer to VEGF at 20°C is enthalpically driven, with an unfavorable entropy contribution. SPR kinetic studies, with careful control of possible mass transfer effects, demonstrated that the aptamer binds to VEGF with an association rate constant k_on = 4.79 ± 0.03 × 10⁴ M^?1 s^?1 and a dissociation rate constant k_off = 5.21 ± 0.02 × 10^?4 s^?1 at 25°C. Key recognition hot‐spots were determined by a combination of aptamer sequence substitutions, truncations, and extensions. Most single‐nucleotide substitutions, particularly within an mfold‐predicted stem, suppress binding, whereas those within a predicted loop have a minimal effect. The 5′‐end of the aptamer plays a key role in VEGF recognition, as a single‐nucleotide truncation abolished VEGF binding. Conversely, an 11‐fold increase in the association rate (and affinity) is observed with a single cytosine nucleotide extension, due to pairing of the 3′‐GGG with 5′‐CCC in the extended aptamer. Our approach effectively maps the secondary structural elements in the free aptamer, which present the unpaired interface for high affinity VEGF recognition. These data demonstrate that a directed binding analysis can be used in concert with library screening to characterize and improve aptamer/ligand recognition. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 145–156, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Hexamer oligonucleotide topology and assembly under solution phase NMR and theoretical modeling scrutiny

The entire family of noncomplementary hexamer oligodeoxyribonucleotides d(GCXYGC) (X and Y = A, G, C, or T) were assessed for topological indicators and equilibrium thermodynamics using a priori molecular modeling and solution phase NMR spectroscopy. Feasible modeled hairpin structures formed a basis from which solution structure and equilibria for each oligonucleotide were considered. ¹H and ³¹P variable temperature‐dependent (VT) and concentration‐dependent NMR data, NMR signal assignments, and diffusion parameters led to d(GCGAGC) and d(GCGGGC) being understood as exceptions within the family in terms of self‐association and topological character. A mean diffusion coefficient D_{298 K} = (2.0 ± 0.07) × 10^?10 m² s^?1 was evaluated across all hexamers except for d(GCGAGC) (D_{298 K} = 1.7 × 10^?10 m² s^?1) and d(GCGGGC) (D_{298 K} = 1.2 × 10^?10 m² s^?1). Melting under VT analysis (T_m = 323 K) combined with supporting NMR evidence confirmed d(GCGAGC) as the shortest tandem sheared GA mismatched duplex. Diffusion measurements were used to conclude that d(GCGGGC) preferentially exists as the shortest stable quadruplex structure. Thermodynamic analysis of all data led to the assertion that, with the exception of XY = GA and GG, the remaining noncomplementary oligonucleotides adopt equilibria between monomer and duplex, contributed largely by monomer random‐coil forms. Contrastingly, d(GCGAGC) showed preference for tandem sheared GA mismatch duplex formation with an association constant K = 3.9 × 10⁵M^?1. No direct evidence was acquired for hairpin formation in any instance although its potential existence is considered possible for d(GCGAGC) on the basis of molecular modeling studies. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 1023–1038, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

The four repeat Giardia lamblia telomere forms tetramolecular G-quadruplex with antiparallel topology

Abstract

Guanine rich DNA sequences of regulatory genomic regions form secondary structures known as G-quadruplexes usually stabilized by tetrads of Hoogsteen hydrogen bonded guanines. The in vivo existence of G-quadruplexes ascertains their biological roles. Human telomeric repeats are the most studied G-rich sequences. The four repeat Giardia telomeric sequence (TAGGG)₄ differs from its human counterpart (TTAGGG)_4, by deletion of one T at the G-tract intervening site of each repeat. We show here that whilst the two repeat Giardia telomeric sequence (TAGGG)₂ forms parallel and antiparallel quadruplexes with tetramolecular topology exclusively, the four repeat version (TAGGG)₄ forms a tetramolecular (antiparallel) and unimolecular (parallel) quadruplexes in Na⁺. The tetramolecular (antiparallel) G-quadruplex formed by four repeats of Giardia telomeric sequence is stabilized by the additional Watson-Crick bonding between its intervening TA bases aligned in antiparallel fashion. Four stranded antiparallel quadruplex for four repeats of any telomeric sequence have not been characterized till date. We hypothesize that telomeric association in antiparallel fashion, (via G-overhangs to form tetramolecular quadruplex) could be a biologically relevant molecular event. Further, coexistence of Hoogsteen as well as Watson-Crick base pairing might give insight for recognition of conformationally diverse DNA structures by ligands.

Communicated by Ramaswamy H. Sarma     

A strained DNA binding helix is conserved for site recognition,folding nucleation,and conformational modulation

Nucleic acid recognition is often mediated by α‐helices or disordered regions that fold into α‐helix on binding. A peptide bearing the DNA recognition helix of HPV16 E2 displays type II polyproline (PII) structure as judged by pH, temperature, and solvent effects on the CD spectra. NMR experiments indicate that the canonical α‐helix is stabilized at the N‐terminus, while the PII forms at the C‐terminus half of the peptide. Re‐examination of the dihedral angles of the DNA binding helix in the crystal structure and analysis of the NMR chemical shift indexes confirm that the N‐terminus half is a canonical α‐helix, while the C‐terminal half adopts a 3₁₀ helix structure. These regions precisely match two locally driven folding nucleii, which partake in the native hydrophobic core and modulate a conformational switch in the DNA binding helix. The peptide shows only weak and unspecific residual DNA binding, 10⁴‐fold lower affinity, and 500‐fold lower discrimination capacity compared with the domain. Thus, the precise side chain conformation required for modulated and tight physiological binding by HPV E2 is largely determined by the noncanonical strained α‐helix conformation, “presented” by this unique architecture. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 432–443, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com