Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis.

Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.     

Role of the purine repressor hinge sequence in repressor function.

A protease-hypersensitive hinge sequence in Escherichia coli purine repressor (PurR) connects an N-terminal DNA-binding domain with a contiguous corepressor-binding domain. Binding of one molecule of dimeric repressor to operator DNA protects the hinge against proteolytic cleavage. Mutations in the hinge region impair repressor function in vivo. Several nonfunctional hinge mutants were defective in low-affinity binding to operator DNA in the absence of corepressor as well as in high-affinity corepressor-dependent binding to operator DNA, although binding of corepressor was similar to binding of the wild-type repressor. These results establish a role for the hinge region in operator binding and lead to a proposal for two routes to form the holoPurR-operator complex.     

Serine to cysteine mutations in trp repressor protein alter tryptophan and operator binding

The tryptophan repressor regulates expression of the aroH, trpEDCBA, and trpR operons in Escherichia coli. The protein contains no cysteine residues, and the presence of this reactive side chain would allow introduction of spectral probes to monitor binding reactions. Three mutant trp aporepressors, each with a point mutation from serine to cysteine, were produced at positions 67, 86, and 88 by oligonucleotide-directed site-specific mutagenesis. This single conservative substitution affected both tryptophan and operator DNA affinities in all three purified proteins. Cysteine substitution for serine at position 67 decreased tryptophan binding by approximately 6-fold and the operator DNA affinity by approximately 50-fold. The proximity of this amino acid to Gln-68 which is involved in binding to operator DNA (Otwinowski, Z., Schevitz, R. W., Zhang, R.-G., Lawson, C. L., Joachimiak, A., Marmorstein, R. Q., Luisi, B. F., and Sigler, P. B. (1988) Nature 335, 321-329) may account for this effect. Substitution at position 86 diminished tryptophan binding by approximately 4-fold and operator DNA binding by approximately 130-fold. The participation of Ser-86 in the hydrogen bond network required for operator binding (Otwinowski, Z., Schevitz, R. W., Zhang, R.-G., Lawson, C. L., Joachimiak, A., Marmorstein, R. Q., Luisi, B. F., and Sigler, P. B. (1988) Nature 335, 321-329) presumably accounts for the DNA binding effects. The diminished corepressor activity in these two mutants may derive from distortions of the binding region, as the tryptophan and DNA binding sites are intimately related. The mutation at position 88 altered tryptophan binding the most of the three mutants (approximately 18-fold) and operator binding least (approximately 12-fold). Ser-88 forms a hydrogen bond with the amino group of bound tryptophan (Schevitz, R. W., Otwinowski, Z., Joachimiak, A., Lawson, C. L., and Sigler, P. B. (1985) Nature 317, 782-786), and alteration of the geometry of the side chain would be anticipated to perturb the topology of the binding site. The diminished operator affinity may derive from improper alignment of the tryptophan ligand, crucial for high affinity operator binding (Otwinowski, Z., Schevitz, R. W., Zhang, R.-G., Lawson, C. L., Joachimiak, A., Marmorstein, R. Q., Luisi, B. F., and Sigler, P. B. (1988) Nature 335, 321-329).(ABSTRACT TRUNCATED AT 400 WORDS)     

Nucleotide sequence of the gene encoding the repressor for the histidine utilization genes of Klebsiella aerogenes.

The hutC gene of Klebsiella aerogenes encodes a repressor that regulates expression of the histidine utilization (hut) operons. The DNA sequence of a region known to contain hutC was determined and shown to contain two long rightward-reading open reading frames (ORFs). One of these ORFs was identified as the 3' portion of the hutG gene. The other ORF was the hutC gene. The repressor predicted from the hutC sequence contained a helix-turn-helix motif strongly similar to that seen in other DNA-binding proteins, such as lac repressor and the catabolite gene activator protein. This motif was located in the N-terminal portion of the protein, and this portion of the protein seemed to be sufficient to allow repression of the hutUH operon but insufficient to allow interaction with the inducer. The presence of a promoterlike sequence and a ribosome-binding site immediately upstream of the hutC gene explained the earlier observation that hutC can be transcribed independently of the other hut operon genes. The predicted amino acid sequence of hut repressor strongly resembled that of the corresponding protein from Pseudomonas putida (S. L. Allison and A. T. Phillips, J. Bacteriol. 172:5470-5476, 1990). An unexpected, leftward-reading ORF extending from about the middle of hutC into the preceding (hutG) gene was also detected. The deduced amino acid sequence of this leftward ORF was quite distinct from that of an unexpected ORF of similar size found immediately downstream of the P. putida hutC gene. The nonstandard codon usage of this leftward ORF and the expression of repressor activity from plasmids with deletions in this region made it unlikely that this ORF was necessary for repressor activity.     

Regulation of the hut operons of Salmonella typhimurium and Klebsiella aerogenes by the heterologous hut repressors.

In merodiploid strains of Klebsiella aerogenes with chromosomal hut genes of K. aerogenes and episomal hut genes of Salmonella typhimurium, the repressor of either species can regulate the hut operons of the other species. The repression exerted by the homologous repressor on the left-hand hut operon is, in both organisms, stronger than that exerted by the heterologous repressor.     

Selection and design of high affinity DNA ligands for mutant single-chain derivatives of the bacteriophage 434 repressor

Single-chain repressor RRTRES is a derivative of bacteriophage 434 repressor, which contains covalently dimerized DNA-binding domains (amino acids 1-69) of the phage 434 repressor. In this single-chain molecule, the wild type domain R is connected to the mutant domain RTRES by a recombinant linker in a head-to-tail arrangement. The DNA-contacting amino acids of RTRES at the -1, 1, 2, and 5 positions of the a3 helix are T, R, E, S respectively. By using a randomized DNA pool containing the central sequence -CATACAAGAAAGNNNNNNTTT-, a cyclic, in vitro DNA-binding site selection was performed. The selected population was cloned and the individual members were characterized by determining their binding affinities to RRTRES. The results showed that the optimal operators contained the TTAC or TTCC sequences in the underlined positions as above, and that the Kd values were in the 1×10-12 mol/L-1×10-11mol/L concentration range. Since the affinity of the natural 434 repressor to its natural operator sites is in the 1×10-9 mol/L range, the observed binding affinity increase is remarkable. It was also found that binding affinity was strongly affected by the flanking bases of the optimal tetramer binding sites, especially by the base at the 5′ position. We constructed a new homodimeric single-chain repressor RTRESRTRES and its DNA-binding specificity was tested by using a series of new operators designed according to the recog-nition properties previously determined for the RTRES domain. These operators containing the con-sensus sequence GTAAGAAARNTTACN or GGAAGAAARNTTCCN (R is A or G) were recognized by RTRESRTRES specifically, and with high binding affinity. Thus, by using a combination of random selection and rational design principles, we have discovered novel, high affinity protein-DNA inter-actions with new specificity. This method can potentially be used to obtain new binding specificity for other DNA-binding proteins.     

Mutational analysis of the arginine repressor of Escherichia coli

Arginine biosynthesis in Escherichia coli is negatively regulated by a hexameric repressor protein, encoded by the gene argR and the corepressor arginine. By hydroxylamine mutagenesis two types of argR mutants were isolated and mapped. The first type is transdominant. In heterodiploids, these mutant polypeptides reduce the activity of the wild-type repressor, presumably by forming heteropolymers. Four mutant repressor proteins were purified. Two of these map in the N-terminal half of the protein. Gel retardation experiments showed that they bind poorly to DNA, but they could be precipitated by l -arginine at the same concentration as the wild-type repressor. The other two mutant repressors map in the C-terminal half of the protein. They are poorly precipitated by L-arginine and they bind poorly to DNA. In addition, one of these mutants appears to exist as a dimer. The second type of argR mutant repressor consists of super-repressors. Such mutants behave as arginine auxotrophs as a result of hyper-repression of arginine biosynthetic enzymes. They map at many locations throughout the argR gene. Three arginine super-repressor proteins were purified, in comparison with the wild-type repressor, two of them were shown to have a higher DNA-binding affinity in the absence of bound arginine, while the third was shown to have a higher DNA-binding affinity when bound to arginine.     

Flexibility of the DNA-binding domains of trp repressor

An orthorhombic crystal form of trp repressor (aporepressor plus L-tryptophan ligand) was solved by molecular replacement, refined to 1.65 A resolution, and compared to the structure of the repressor in trigonal crystals. Even though these two crystal forms of repressor were grown under identical conditions, the refined structures have distinctly different conformations of the DNA-binding domains. Unlike the repressor/aporepressor structural transition, the conformational shift is not caused by the binding or loss of the L-tryptophan ligand. We conclude that while L-tryptophan binding is essential for forming a specific complex with trp operator DNA, the corepressor ligand does not lock the repressor into a single conformation that is complementary to the operator. This flexibility may be required by the various binding modes proposed for trp repressor in its search for and adherence to its three different operator sites.     

Recognition of DNA by single-chain derivatives of the phage 434 repressor: high affinity binding depends on both the contacted and non-contacted base pairs.

Single-chain derivatives of the phage 434 repressor, termed single-chain repressors, contain covalently dimerized DNA-binding domains (DBD) which are connected with a peptide linker in a head-to-tail arrangement. The prototype RR69 contains two wild-type DBDs, while RR*69 contains a wild-type and an engineered DBD. In this latter domain, the DNA- contacting amino acids of thealpha3 helix of the 434 repressor are replaced by the corresponding residues of the related P22 repressor. We have used binding site selection, targeted mutagenesis and binding affinity studies to define the optimum DNA recognition sequence for these single-chain proteins. It is shown that RR69 recognizes DNA sequences containing the consensus boxes of the 434 operators in a palindromic arrangement, and that RR*69 optimally binds to non-palindromic sequences containing a 434 operator box and a TTAA box of which the latter is present in most P22 operators. The spacing of these boxes, as in the 434 operators, is 6 bp. The DNA-binding of both single-chain repressors, similar to that of the 434 repressor, is influenced indirectly by the sequence of the non-contacted, spacer region. Thus, high affinity binding is dependent on both direct and indirect recognition. Nonetheless, the single-chain framework can accommodate certain substitutions to obtain altered DNA-binding specificity and RR*69 represents an example for the combination of altered direct and unchanged indirect readout mechanisms.     

Multiple conformations of the cytidine repressor DNA-binding domain coalesce to one upon recognition of a specific DNA surface

The cytidine repressor (CytR) is a member of the LacR family of bacterial repressors with distinct functional features. The Escherichia coli CytR regulon comprises nine operons whose palindromic operators vary in both sequence and, most significantly, spacing between the recognition half-sites. This suggests a strong likelihood that protein folding would be coupled to DNA binding as a mechanism to accommodate the variety of different operator architectures to which CytR is targeted. Such coupling is a common feature of sequence-specific DNA-binding proteins, including the LacR family repressors; however, there are no significant structural rearrangements upon DNA binding within the three-helix DNA-binding domains (DBDs) studied to date. We used nuclear magnetic resonance (NMR) spectroscopy to characterize the CytR DBD free in solution and to determine the high-resolution structure of a CytR DBD monomer bound specifically to one DNA half-site of the uridine phosphorylase (udp) operator. We find that the free DBD populates multiple distinct conformations distinguished by up to four sets of NMR peaks per residue. This structural heterogeneity is previously unknown in the LacR family. These stable structures coalesce into a single, more stable udp-bound form that features a three-helix bundle containing a canonical helix-turn-helix motif. However, this structure differs from all other LacR family members whose structures are known with regard to the packing of the helices and consequently their relative orientations. Aspects of CytR activity are unique among repressors; we identify here structural properties that are also distinct and that might underlie the different functional properties.     

Conformational dynamics of a transposition repressor in modulating DNA binding

The repressor of bacteriophage Mu functions in the establishment and maintenance of lysogeny by binding to Mu operator DNA to shut down transposition. A domain at its N terminus functions in DNA binding, and temperature-sensitive mutations in this domain can be suppressed by truncations at the C terminus. To understand the role of the C-terminal tail in DNA binding, a fluorescent probe was attached to the C terminus to examine its environment and its movement with respect to the DNA binding domain. The emission spectrum of this probe indicated that the C terminus was in a relatively hydrophobic environment, comparable to the environment of the probe attached within the DNA-binding domain. Fluorescence of two tryptophan residues located within the DNA-binding domain was quenched by the probe attached to the C terminus, indicating that the C terminus is in close proximity to this domain. Addition of DNA, even when it did not contain operator DNA, reduced quenching of tryptophan fluorescence, indicating that the tail moves away from the DNA-binding domain as it interacts with DNA. The presence of the tail also produced a trypsin hypersensitive site within the DNA-binding domain; mutant repressors with an altered or truncated C terminus were relatively resistant to cleavage at this site. Interaction of the wild-type repressor with DNA greatly reduced cleavage at the site. A repressor with a temperature-sensitive mutation in the DNA-binding domain was especially sensitive to cleavage by trypsin even in the presence of DNA, and the C-terminal tail failed to move in the presence of DNA at elevated temperatures. These results indicate that the tail sterically inhibits DNA binding and that it moves during establishment of repression. Such conformational changes are likely to be involved in communication between repressor protomers for cooperative DNA binding.     

Probing the ATP-binding site of P1 ParA: partition and repression have different requirements for ATP binding and hydrolysis

The ParA family of proteins is involved in partition of a variety of plasmid and bacterial chromosomes. P1 ParA plays two roles in partition: it acts as a repressor of the par operon and has an undefined yet indispensable role in P1 plasmid localization. We constructed seven mutations in three putative ATP-binding motifs of ParA. Three classes of phenotypes resulted, each represented by mutations in more than one motif. Three mutations created 'super-repressors', in which repressor activity was much stronger than in wild-type ParA, while the remainder damaged repressor activity. All mutations eliminated partition activities, but two showed a plasmid stability defect that was worse than that of a null mutation. Four mutant ParAs, two super-repressors and two weak repressors, were analyzed biochemically, and all exhibited damaged ATPase activity. The super-repressors bound site-specifically to the par operator sequence, and this activity was strongly stimulated by ATP and ADP. These results support the proposal that ATP binding is essential but hydrolysis is inhibitory for ParA's repressor activity and suggest that ATP hydrolysis is essential for plasmid localization.     

Regulation of the Escherichia coli allantoin regulon: coordinated function of the repressor AllR and the activator AllS

The allantoin regulon of Escherichia coli, formed by three operons expressed from promoters allA(P), gcl(P) and allD(P), is involved in the anaerobic utilization of allantoin as nitrogen source. The expression of these operons is under the control of the repressor AllR. The hyperinduction of one of these promoters (allD(P)) by allantoin in an AllR defective mutant suggested the action of another regulator, presumably of activator type. In this work we have identified ybbS (proposed gene name allS), divergently transcribed from allA, as the gene encoding this activator. Analysis of the expression of the three structural operons in DeltaallS mutant showed that the expression from allD(P) was abolished, suggesting that AllS is essential for the expression of the corresponding operon. In a wild-type strain expression of allS takes place mainly anaerobically and is hyperinduced when the nitrogen source limits growth. However, expression of allS is independent of regulators of the Ntr response, NtrC or Nac. Band shift experiments showed that AllR binds to DNA containing the allS-allA intergenic region and the gcl(P) promoter and its binding is abolished by glyoxylate. Both DNA fragments contain a highly conserved inverted repeat, which after site-directed mutagenesis, has been proven to be the AllR-binding site. This site displays similarity with the IclR family recognized consensus. Interaction of AllR with the single operator present in the allS-allA intergenic region prevented binding of RNA polymerase to either of the two divergent promoters. The regulator AllS interacts only with allD(P) even in the absence of allantoin. Analysis of this promoter allowed us to identify an inverted repeat as a motif for AllS binding. We propose a model for the coordinate control of the allantoin regulon by AllR and AllS.     

Effect of amino acid alterations in the tryptophan-binding site of the trp repressor

Mutations in the tryptophan-binding site of the trp repressor have been generated using site-directed mutagenesis. The selection of sites for alteration was based on the three-dimensional x-ray crystallographic structure (Schevitz, R. W., Otwinowski, Z., Joachimiak, A., Lawson, C. L., and Sigler, P. B. (1985) Nature 317, 782-786). The changes generated include Thr-44 to Ala (T44A), Arg-54 to Leu (R54L), Arg-54 to Lys (R54K), Arg-84 to Leu (R84L), and Arg-84 to Lys (R84K). The mutant proteins were purified and characterized in detail for their binding properties. Both tryptophan and operator DNA affinities for all five mutants were decreased. The R84L, R54K, and R54L mutants exhibited increases in Kd for operator DNA relative to wild-type repressor ranging from approximately 10(3) to approximately 10(4), while R84K and T44A exhibited increases of 10- to 100-fold. This diminution in DNA binding activity derives at least in part from diminished affinity for tryptophan, although decreased affinity for nonspecific DNA was also observed for these mutant proteins. Tryptophan binding was not detectable by equilibrium dialysis for most of the mutant proteins, but this activity was measurable for several of the altered proteins by monitoring the fluorescence decrease associated with the displacement of 1-anilino-8-naphthalenesulfonate from the tryptophan-binding site (Chou, W.-Y., and Matthews, K. S. (1989) J. Biol. Chem. 264, 18314-18319). These measurements revealed that tryptophan bound to R84K, T44A, and R84L repressors with Kd values 1.5- to 13-fold higher than that for wild-type repressor. It was not possible to detect tryptophan binding to R54K and R54L even using the fluorescence assay. Circular dichroism spectra demonstrated that the mutants and the wild-type repressor possess similar secondary structural features. The results of this selected substitution in the tryptophan-binding site are readily interpreted based on the x-ray structural analysis.