Energetic basis for selective recognition of T*G mismatched base pairs in DNA by imidazole-rich polyamides

To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T·G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T·G–polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T·G mismatch containing DNA hairpin duplex and a similar DNA with only Watson–Crick base pairs. Large negative binding enthalpies for all of the polyamide–DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T·G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T·G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T·G mismatch sites.     

Studies of translational misreading in vivo show that the ribosome very efficiently discriminates against most potential errors

Protein synthesis must rapidly and repeatedly discriminate between a single correct and many incorrect aminoacyl-tRNAs. We have attempted to measure the frequencies of all possible missense errors by tRNA, tRNA and tRNA. The most frequent errors involve three types of mismatched nucleotide pairs, U•U, U•C, or U•G, all of which can form a noncanonical base pair with geometry similar to that of the canonical U•A or C•G Watson–Crick pairs. Our system is sensitive enough to measure errors at other potential mismatches that occur at frequencies as low as 1 in 500,000 codons. The ribosome appears to discriminate this efficiently against any pair with non-Watson–Crick geometry. This extreme accuracy may be necessary to allow discrimination against the errors involving near Watson–Crick pairing.     

Molecular dynamics simulations and coupled nucleotide substitution experiments indicate the nature of A·A base pairing and a putative structure of the coralyne-induced homo-adenine duplex

Coralyne is an alkaloid drug that binds homo-adenine DNA (and RNA) oligonucleotides more tightly than it does Watson–Crick DNA. Hud’s laboratory has shown that poly(dA) in the presence of coralyne forms an anti-parallel duplex, however attempts to determine the structure by NMR spectroscopy and X-ray crystallography have been unsuccessful. Assuming adenine–adenine hydrogen bonding between the two poly(dA) strands, we constructed 40 hypothetical homo-(dA) anti-parallel duplexes and docked coralyne into the six most favorable duplex structures. The two most stable structures had trans glycosidic bonds, but distinct pairing geometries, i.e. either Watson–Crick Hoogsteen (transWH) or Watson–Crick Watson–Crick (transWW) with stability of transWH > transWW. To narrow down the possibilities, 7-deaza adenine base substitutions (dA→7) were engineered into homo-(dA) sequences. These substitutions significantly reduced the thermal stability of the coralyne-induced homo-(dA) structure. These experiments strongly suggest the involvement of N7 in the coralyne-induced A·A base pairs. Moreover, due to the differential effect on melting as a function of the location of the dA→7 mutations, these results are consistent with the N1–N7 base pairing of the transWH pairs. Together, the simulation and base substitution experiments predict that the coralyne-induced homo-(dA) duplex structure adopts the transWH geometry.     

Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔT_M experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings.     

A remarkably stable kissing-loop interaction defines substrate recognition by the Neurospora Varkud Satellite ribozyme

Kissing loops are tertiary structure elements that often play key roles in functional RNAs. In the Neurospora VS ribozyme, a kissing-loop interaction between the stem–loop I (SLI) substrate and stem–loop V (SLV) of the catalytic domain is known to play an important role in substrate recognition. In addition, this I/V kissing-loop interaction is associated with a helix shift in SLI that activates the substrate for catalysis. To better understand the role of this kissing-loop interaction in substrate recognition and activation by the VS ribozyme, we performed a thermodynamic characterization by isothermal titration calorimetry using isolated SLI and SLV stem–loops. We demonstrate that preshifted SLI variants have higher affinity for SLV than shiftable SLI variants, with an energetic cost of 1.8–3 kcal/mol for the helix shift in SLI. The affinity of the preshifted SLI for SLV is remarkably high, the interaction being more stable by 7–8 kcal/mol than predicted for a comparable duplex containing three Watson–Crick base pairs. The structural basis of this remarkable stability is discussed in light of previous NMR studies. Comparative thermodynamic studies reveal that kissing-loop complexes containing 6–7 Watson–Crick base pairs are as stable as predicted from comparable RNA duplexes; however, those with 2–3 Watson–Crick base pairs are more stable than predicted. Interestingly, the stability of SLI/ribozyme complexes is similar to that of SLI/SLV complexes. Thus, the I/V kissing loop interaction represents the predominant energetic contribution to substrate recognition by the trans-cleaving VS ribozyme.     

Revealing A-T and G-C Hoogsteen base pairs in stressed protein-bound duplex DNA

Watson–Crick base pairs (bps) are the fundamental unit of genetic information and the building blocks of the DNA double helix. However, A-T and G-C can also form alternative ‘Hoogsteen’ bps, expanding the functional complexity of DNA. We developed ‘Hoog-finder’, which uses structural fingerprints to rapidly screen Hoogsteen bps, which may have been mismodeled as Watson–Crick in crystal structures of protein–DNA complexes. We uncovered 17 Hoogsteen bps, 7 of which were in complex with 6 proteins never before shown to bind Hoogsteen bps. The Hoogsteen bps occur near mismatches, nicks and lesions and some appear to participate in recognition and damage repair. Our results suggest a potentially broad role for Hoogsteen bps in stressed regions of the genome and call for a community-wide effort to identify these bps in current and future crystal structures of DNA and its complexes.     

Clamping down on weak terminal base pairs: oligonucleotides with molecular caps as fidelity-enhancing elements at the 5'- and 3'-terminal residues

The base-pairing fidelity of oligonucleotides depends on the identity of the nucleobases involved and the position of matched or mismatched base pairs in the duplex. Nucleobases forming weak base pairs, as well as a terminal position favor mispairing. We have searched for 5′-appended acylamido caps that enhance the stability and base-pairing fidelity of oligonucleotides with a 5′-terminal 2′-deoxyadenosine residue using combinatorial synthesis and MALDI-monitored nuclease selections. This provided the residue of 4-(pyren-1-yl)butyric acid as a lead. Lead optimization gave (S)-N-(pyren-1-ylmethyl)pyrrolidine-3-phosphate as a cap that increases duplex stability and base-pairing fidelity. For the duplex of 5′-AGGTTGAC-3′ with its fully complementary target, this cap gives an increase in the UV melting point T_m of +10.9°C. The T_m is 6.3–8.3°C lower when a mismatched nucleobase faces the 5′-terminal dA residue. The optimized cap can be introduced via automated DNA synthesis. It was combined with an anthraquinone carboxylic acid residue as a cap for the 3′-terminal residue. A doubly capped dodecamer thus prepared gives a melting point decrease for double-terminal mismatches that is 5.7–5.9°C greater than that for the unmodified control duplex.     

The structure of metallo-DNA with consecutive thymine–HgII–thymine base pairs explains positive entropy for the metallo base pair formation

We have determined the three-dimensional (3D) structure of DNA duplex that includes tandem Hg^II-mediated T–T base pairs (thymine–Hg^II–thymine, T–Hg^II–T) with NMR spectroscopy in solution. This is the first 3D structure of metallo-DNA (covalently metallated DNA) composed exclusively of ‘NATURAL’ bases. The T–Hg^II–T base pairs whose chemical structure was determined with the ¹⁵N NMR spectroscopy were well accommodated in a B-form double helix, mimicking normal Watson–Crick base pairs. The Hg atoms aligned along DNA helical axis were shielded from the bulk water. The complete dehydration of Hg atoms inside DNA explained the positive reaction entropy (ΔS) for the T–Hg^II–T base pair formation. The positive ΔS value arises owing to the Hg^II dehydration, which was approved with the 3D structure. The 3D structure explained extraordinary affinity of thymine towards Hg^II and revealed arrangement of T–Hg^II–T base pairs in metallo-DNA.     

Self-association of short DNA loops through minor groove C:G:G:C tetrads

In addition to the better known guanine-quadruplex, four-stranded nucleic acid structures can be formed by tetrads resulting from the association of Watson–Crick base pairs. When such association occurs through the minor groove side of the base pairs, the resulting structure presents distinctive features, clearly different from quadruplex structures containing planar G-tetrads. Although we have found this unusual DNA motif in a number of cyclic oligonucleotides, this is the first time that this DNA motif is found in linear oligonucleotides in solution, demonstrating that cyclization is not required to stabilize minor groove tetrads in solution. In this article, we have determined the solution structure of two linear octamers of sequence d(TGCTTCGT) and d(TCGTTGCT), and their cyclic analogue d<pCGCTCCGT>, utilizing 2D NMR spectroscopy and restrained molecular dynamics. These three molecules self-associate forming symmetric dimers stabilized by a novel kind of minor groove C:G:G:C tetrad, in which the pattern of hydrogen bonds differs from previously reported ones. We hypothesize that these quadruplex structures can be formed by many different DNA sequences, but its observation in linear oligonucleotides is usually hampered by competing Watson–Crick duplexes.     

DNA multiplex hybridization on microarrays and thermodynamic stability in solution: a direct comparison

Hybridization intensities of 30 distinct short duplex DNAs measured on spotted microarrays, were directly compared with thermodynamic stabilities measured in solution. DNA sequences were designed to promote formation of perfect match, or hybrid duplexes containing tandem mismatches. Thermodynamic parameters ΔH°, ΔS° and ΔG° of melting transitions in solution were evaluated directly using differential scanning calorimetry. Quantitative comparison with results from 63 multiplex microarray hybridization experiments provided a linear relationship for perfect match and most mismatch duplexes. Examination of outliers suggests that both duplex length and relative position of tandem mismatches could be important factors contributing to observed deviations from linearity. A detailed comparison of measured thermodynamic parameters with those calculated using the nearest-neighbor model was performed. Analysis revealed the nearest-neighbor model generally predicts mismatch duplexes to be less stable than experimentally observed. Results also show the relative stability of a tandem mismatch is highly dependent on the identity of the flanking Watson–Crick (w/c) base pairs. Thus, specifying the stability contribution of a tandem mismatch requires consideration of the sequence identity of at least four base pair units (tandem mismatch and flanking w/c base pairs). These observations underscore the need for rigorous evaluation of thermodynamic parameters describing tandem mismatch stability.     

Integrity of duplex structures without hydrogen bonding: DNA with pyrene paired at abasic sites

DNA polymerases specifically insert the hydrophobic pyrene deoxynucleotide (P) opposite tetrahydrofuran (F), an stable abasic site analog, and DNA duplexes containing this non-hydrogen-bonded pair possess a high degree of thermodynamic stability. These observations support the hypothesis that steric complementarity and stacking interactions may be sufficient for maintaining stability of DNA structure and specificity of DNA replication, even in the absence of hydrogen bonds across the base pair. Here we report the NMR characterization and structure determination of two DNA molecules containing pyrene residues. The first is a 13mer duplex with a pyrene·tetrahydrofuran pair (P·F pair) at the ninth position and the second mimics a replication intermediate right after incorporation of a pyrene nucleoside opposite an abasic site. Our data indicate that both molecules adopt right-handed helical conformations with Watson– Crick alignments for all canonical base pairs. The pyrene ring stays inside the helix close to its baseless partner in both molecules. The single-stranded region of the replication intermediate folds back over the opposing strand, sheltering the hydrophobic pyrene moiety from water exposure. The results support the idea that the stability and replication of a P·F pair is due to its ability to mimic Watson–Crick structure.     

Sequence effects of aminofluorene-modified DNA duplexes: thermodynamic and circular dichroism properties

Circular dichroism (CD) and UV-melting experiments were conducted with 16 oligodeoxynucleotides modified by the carcinogen 2-aminofluorene, whose sequence around the lesion was varied systematically [d(CTTCTNG[AF]NCCTC), N = G, A, C, T], to gain insight into the factors that determine the equilibrium between base-displaced stacked (S) and external B-type (B) duplex conformers. Differing stabilities among the duplexes can be attributed to different populations of S and B conformers. The AF modification always resulted in sequence-dependent thermal (T_m) and thermodynamic (−ΔG°) destabilization. The population of B-type conformers derived from eight selected duplexes (i.e. -AG*N- and -CG*N-) was inversely proportional to the −ΔG° and T_m values, which highlights the importance of carcinogen/base stacking in duplex stabilization even in the face of disrupted Watson–Crick base pairing in S-conformation. CD studies showed that the extent of the adduct-induced negative ellipticities in the 290–350 nm range is correlated linearly with −ΔG° and T_m, but inversely with the population of B-type conformations. Taken together, these results revealed a unique interplay between the extent of carcinogenic interaction with neighboring base pairs and the thermodynamic properties of the AF-modified duplexes. The sequence-dependent S/B heterogeneities have important implications in understanding how arylamine–DNA adducts are recognized in nucleotide excision repair.     

Structural effect of the anticancer agent 6-thioguanine on duplex DNA

The incorporation of 6-thioguanine (S6G) into DNA is an essential step in the cytotoxic activity of thiopurines. However, the structural effects of this substitution on duplex DNA have not been fully characterized. Here, we present the solution structures of DNA duplexes containing S6G opposite thymine (S6G·T) and opposite cytosine (S6G·C), solved by high-resolution NMR spectroscopy and restrained molecular dynamics. The data indicate that both duplexes adopt right-handed helical conformations with all Watson–Crick hydrogen bonding in place. The S6G·T structures exhibit a wobble-type base pairing at the lesion site, with thymine shifted toward the major groove and S6G displaced toward the minor groove. Aside from the lesion site, the helices, including the flanking base pairs, are not highly perturbed by the presence of the lesion. Surprisingly, thermal dependence experiments suggest greater stability in the S6G-T mismatch than the S6G-C base pair.     

Nearest neighbor parameters for Watson-Crick complementary heteroduplexes formed between 2'-O-methyl RNA and RNA oligonucleotides

Results from optical melting studies of Watson–Crick complementary heteroduplexes formed between 2′-O-methyl RNA and RNA oligonucleotides are used to determine nearest neighbor thermodynamic parameters for predicting the stabilities of such duplexes. The results are consistent with the physical model assumed by the individual nearest neighbor-hydrogen bonding model, which contains terms for helix initiation, base pair stacking and base pair composition. The sequence dependence is similar to that for Watson–Crick complementary RNA/RNA duplexes, which suggests that the sequence dependence may also be similar to that for other backbones that favor A-form RNA conformations.     

Solution structure of the DNA decamer duplex containing a 3'-T x T basepair of the cis-syn cyclobutane pyrimidine dimer: implication for the mutagenic property of the cis-syn dimer

The cis–syn dimer is the major DNA photoproduct produced by UV irradiation. In order to determine the origin of the mutagenic property of the cis–syn dimer, we used NMR restraints and molecular dynamics to determine the solution structure of a DNA decamer duplex containing a wobble pair between the 3′-T of the cis–syn dimer and the opposite T residue (CS/TA duplex). The solution structure of the CS/TA duplex revealed that the 3′-T·T base pair of the cis–syn dimer had base pair geometry that was significantly different from the canonical Watson–Crick base pair and caused destabilization and conformational distortion of its 3′-region. However, a 3′-T·A base pair at the cis–syn dimer within this related DNA decamer maintains the normal Watson–Crick base pair geometry and causes little distortion in the conformation of its 3′-side. Our results show that in spite of its stable hydrogen bonding, the insertion of a T residue opposite the 3′-T of the cis–syn dimer is inhibited by structural distortion caused by the 3′-T·T base pair. This may explain why the frequency of the 3′-T→A transversion, which is the major mutation produced by the cis–syn dimer, is only 4%.     

NMR structure of the DNA decamer duplex containing double T*G mismatches of cis-syn cyclobutane pyrimidine dimer: implications for DNA damage recognition by the XPC-hHR23B complex

The cis–syn cyclobutane pyrimidine dimer (CPD) is a cytotoxic, mutagenic and carcinogenic DNA photoproduct and is repaired by the nucleotide excision repair (NER) pathway in mammalian cells. The XPC–hHR23B complex as the initiator of global genomic NER binds to sites of certain kinds of DNA damage. Although CPDs are rarely recognized by the XPC–hHR23B complex, the presence of mismatched bases opposite a CPD significantly increased the binding affinity of the XPC–hHR23B complex to the CPD. In order to decipher the properties of the DNA structures that determine the binding affinity for XPC–hHR23B to DNA, we carried out structural analyses of the various types of CPDs by NMR spectroscopy. The DNA duplex which contains a single 3′ T·G wobble pair in a CPD (CPD/GA duplex) induces little conformational distortion. However, severe distortion of the helical conformation occurs when a CPD contains double T·G wobble pairs (CPD/GG duplex) even though the T residues of the CPD form stable hydrogen bonds with the opposite G residues. The helical bending angle of the CPD/GG duplex was larger than those of the CPD/GA duplex and properly matched CPD/AA duplex. The fluctuation of the backbone conformation and significant changes in the widths of the major and minor grooves at the double T·G wobble paired site were also observed in the CPD/GG duplex. These structural features were also found in a duplex that contains the (6–4) adduct, which is efficiently recognized by the XPC–hHR23B complex. Thus, we suggest that the unique structural features of the DNA double helix (that is, helical bending, flexible backbone conformation, and significant changes of the major and/or minor grooves) might be important factors in determining the binding affinity of the XPC–hHR23B complex to DNA.     

Proton exchange and local stability in a DNA triple helix containing a G.TA triad

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C⁺.GC triad. The results indicate that, in the G.TA triad, the stability of the Watson–Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6–1.8 kcal/mol at 1°C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.     

Selectivity and affinity of triplex-forming oligonucleotides containing 2'-aminoethoxy-5-(3-aminoprop-1-ynyl)uridine for recognizing AT base pairs in duplex DNA

We have used DNase I footprinting, fluorescence and ultraviolet (UV) melting experiments and circular dichroism to demonstrate that, in the parallel triplex binding motif, 2′-aminoethoxy-5-(3-aminoprop-1-ynyl)uridine (bis-amino-U, BAU) has very high affinity for AT relative to all other Watson–Crick base pairs in DNA. Complexes containing two or more substitutions with this nucleotide analogue are stable at pH 7.0, even though they contain several C.GC base triplets. These modified triplex-forming oligonucleotides retain exquisite sequence specificity, with enhanced discrimination against YR base pairs (especially CG). These properties make BAU a useful base analogue for the sequence-specific creation of stable triple helices at pH 7.0.     

Dissimilar mispair-recognition spectra of Arabidopsis DNA-mismatch-repair proteins MSH2*MSH6 (MutSalpha) and MSH2*MSH7 (MutSgamma)

Besides orthologs of other eukaryotic mismatch-repair (MMR) proteins, plants encode MSH7, a paralog of MSH6. The Arabidopsis thaliana recognition heterodimers AtMSH2·MSH6 (AtMutSα) and AtMSH2·MSH3 (AtMutSβ) were previously found to bind the same subsets of mismatches as their counterparts in other eukaryotes—respectively, base–base mismatches and single extra nucleotides, loopouts of extra nucleotides (one or more) only—but AtMSH2·MSH7 (AtMutSγ) bound well only to a G/T mismatch. To test hypotheses that MSH7 might be specialized for G/T, or for base mismatches in 5-methylcytosine contexts, we compared binding of AtMutSα and AtMutSγ to a series of mismatched DNA oligoduplexes, relative to their (roughly similar) binding to G/T DNA. AtMutSγ bound G/G, G/A, A/A and especially C/A mispairs as well or better than G/T, in contrast to MutSα, for which G/T was clearly the best base mismatch. The presence of 5-methylcytosine adjacent to or in a mispair generally lowered binding by both heterodimers, with no systematic difference between the two. Alignment of protein sequences reveals the absence in MSH7 of the clamp domains that in bacterial MutS proteins—and by inference MSH6 proteins—non-specifically bind the backbone of mismatched DNA, raising new questions as to how clamp domains enhance mismatch recogni tion. Plants must rigorously suppress mutation during mitotic division of meristematic cells that eventually give rise to gametes and may also use MMR proteins to antagonize homeologous recombination. The MSH6 versus MSH7 divergence may reflect specializations for particular mismatches and/or sequence contexts, so as to increase both DNA-replication and meiotic-recombination fidelity, or dedication of MSH6 to the former and MSH7 to the latter, consistent with genetic evidence from wheat.