Comparison of the Deep Optic Nerve Head Structure between Normal-Tension Glaucoma and Nonarteritic Anterior Ischemic Optic Neuropathy

PurposeTo compare the deep optic nerve head (ONH) structure between normal-tension glaucoma (NTG) and nonarteritic anterior ischemic optic neuropathy (NAION) and also in healthy subjects as a control using enhanced depth imaging (EDI) spectral-domain optical coherence tomography (SD-OCT).MethodsThis prospective cross-sectional study included 21 NAION patients who had been diagnosed as NAION at least 6 months prior to study entry, and 42 NTG patients and 42 healthy controls who were matched with NAION patients in terms of age, intraocular pressure (IOP), and optic disc area. The retinal nerve fiber layer (RNFL) thickness in the affected sector was also matched between NAION and NTG patients. The ONH was imaged using SD-OCT with the EDI technique. The anterior lamina cribrosa surface depth (LCD) and average prelaminar tissue (PT) thickness were measured in a sector of interest in each eye and compared among the three groups.ResultsIn the sector-matched comparison, LCD was largest in NTG patients, followed by NAION patients, while PT was thinner in NTG patients than in NAION patients (all P < 0.001). NAION patients had a comparable LCD and a thinner PT relative to normal controls (P = 0.170 and < 0.001, respectively).ConclusionThe deep ONH configuration is strikingly different between NTG and NAION. The differing features provide comparative insight into the pathophysiology of the two diseases, and may be useful for differential diagnosis.     

Transfection activity of polyamidoamine dendrimers having hydrophobic amino acid residues in the periphery

We designed poly(amidoamine) dendrimers with phenylalanine or leucine residues at their chain ends. Thereby, we achieved efficient gene transfection of cells through synergy of the proton sponge effect, which is induced by the internal tertiary amines of the dendrimer, and hydrophobic interaction by the hydrophobic amino acid residues in the dendrimer periphery. Dendrimers having 16, 29, 46, and 64 terminal phenylalanine residues were prepared by the reaction of the amine-terminated poly(amidoamine) G4 dendrimer and L-phenylalanine using condensing reagent 1,3-dicyclohexylcarbodiimide. Transfection activity of these phenylalanine-modified dendrimers for CV1 cells, an African green monkey kidney cell line, increased concomitant with the increasing number of the terminal phenylalanine residues, except for the dendrimer with 64 phenylalanine residues, which showed poor water solubility and hardly formed a complex with DNA at neutral pH. However, under weakly acidic conditions, the dendrimer with 64 phenylalanine residues formed a complex with DNA, thereby achieving highly efficient transfection. In contrast, the attachment of L-leucine residues was unable to improve the transfection activity of the parent dendrimer, probably because of the relatively lower hydrophobicity of this amino acid. The phenylalanine-modified dendrimer exhibited a higher transfection activity and a lower cytotoxicity than some widely used transfection reagents. For that reason, the phenylalanine-modified dendrimers are considered to be promising gene carriers.     

Interaction of multicomponent anionic liposomes with cationic pyridylphenylene dendrimer: Does the complex behavior depend on the liposome composition?

Dendrimers are individual macromolecular compounds having a great potential for biomedical application. The key step of the cell penetration by dendrimers is the interaction with lipid bilayer. Here, the interaction between cationic pyridylphenylene dendrimer of third generation (D₃⁵⁰⁺) and multicomponent liquid (CL/POPC), solid (CL/DPPC) and cholesterol-containing (CL/POPC/30% Chol) anionic liposomes was investigated by dynamic light scattering, fluorescence spectroscopy, conductometry, calorimetric studies and molecular dynamic (MD) simulations. Microelectrophoresis and MD simulations revealed the interaction is electrostatic and reversible with only part of pyridinium groups of dendrimers involved in binding with liposomes. The ability of dendrimer molecules to migrate between liposomes was discovered by the labeling liposomes with Rhodamine B. The phase state of the lipid membrane and the incorporation of cholesterol into the lipid bilayer were found to not affect the mechanism of the dendrimer - liposome complex formation. Rigid dendrimer adsorption on liposomal surface does not induce the formation of significant defects in the lipid membrane pave the way for possible biological application of pyridylphenylene dendrimers.     

Synthesis and evaluation of novel dendrimers with a hydrophilic interior as nanocarriers for drug delivery

Novel polyester-co-polyether dendrimers consisting of a hydrophilic core were synthesized by a combination of convergent and divergent syntheses. The core was synthesized from biocompatible moieties, butanetetracarboxylic acid and aspartic acid, and the dendrons from PEO (poly(ethylene oxide)), dihydroxybenzoic acid or gallic acid, and PEG monomethacrylate. The dendrimers, Den-1-(G 2) (second generation dendrimer-1) and Den-2-(G 2) (second generation dendrimer-2) consisting of 16 and 24 allyl surface groups, respectively, were obtained by coupling the dendrons to the core. The dendrimer (Den-1-(G 2)-OH) with hydroxyl groups at the surface was synthesized by oxidation of the allyl functional groups of Den-1-(G 2), which was divergently coupled to the dendrons to obtain the third generation dendrimer Den-1-(G 3) consisting of 32 surface groups. The modifications in surface groups and generation of dendrimers were shown to influence the shape of dendrimers in the AFM studies. The aggregation as well as self-assembly of dendrimers was observed at high concentration in water by light scattering studies; however, it was reduced on dilution and in the presence of sodium chloride. Dendrimers demonstrated good ability to encapsulate the guest molecule, with loading of 15.80 and 6.47% w/w for rhodamine and beta-carotene, respectively. UV spectroscopy proved the absence of any pi-pi complexation between the dendrimer and encapsulated compounds. (1)H NMR and FTIR studies showed that the physical entrapment and/or hydrogen bonding by PEO in the interior and branch of the dendrimer are the mechanisms of encapsulation. The release of the encapsulated compounds was found to be slow and sustained, suggesting that these dendrimers can serve as potential drug delivery vehicles.     

Core and periphery functionalized dendrimers for transition metal catalysis; a covalent and a non-covalent approach

Dendrimers are well-defined hyperbranched macromolecules with characteristic globular structures for the larger systems. The recent impressive strides in synthetic procedures increased the accessibility of functionalized dendrimers at a practicable scale, resulting in a rapid development of dendrimer chemistry. Dendrimers have inspired many chemists to develop new materials and several applications have been explored, catalysis being one of them. The position of the catalytic site(s) as well as the spatial separation of the catalysts within the dendritic framework is of crucial importance. Dendrimers that are functionalized with transition metals in the core can potentially mimic properties of enzymes, their efficient natural counterparts, whereas the surface-functionalized systems have been proposed to fill the gap between homogeneous and heterogeneous catalysis. We prepared both core- and periphery-functionalized dendritic catalysts that are sufficiently large to enable separation by modern nanofiltration techniques. Here we review our recent findings using these promising novel transition metal-functionalized dendrimers as catalysts in several reactions. We will discuss some of the consequences of the architecturally different systems that have been studied and will elaborate on a novel non-covalent strategy of dendrimer functionalization.     

Temperature‐sensitive elastin‐mimetic dendrimers: Effect of peptide length and dendrimer generation to temperature sensitivity

Dendrimers are synthetic macromolecules with unique structure, which are a potential scaffold for peptides. Elastin is one of the main components of extracellular matrix and a temperature‐sensitive biomacromolecule. Previously, Val‐Pro‐Gly‐Val‐Gly peptides have been conjugated to a dendrimer for designing an elastin‐mimetic dendrimer. In this study, various elastin‐mimetic dendrimers using different length peptides and different dendrimer generations were synthesized to control the temperature dependency. The elastin‐mimetic dendrimers formed β‐turn structure by heating, which was similar to the elastin‐like peptides. The elastin‐mimetic dendrimers exhibited an inverse phase transition, largely depending on the peptide length and slightly depending on the dendrimer generation. The elastin‐mimetic dendrimers formed aggregates after the phase transition. The endothermal peak was observed in elastin‐mimetic dendrimers with long peptides, but not with short ones. The peptide length and the dendrimer generation are important factors to tune the temperature dependency on the elastin‐mimetic dendrimer. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 603–612, 2014.     

Photophysical properties of Newkome-type dendrimers in aqueous medium.

Newkome-type first, second and third generation dendrimers, having t-butyl (GB), ethyl (GE) and carboxylic (GA) end groups, were synthesized. A pyrene group, which can act as fluorescent sensor, was attached to the core of the dendrimers and their photophysical properties in aqueous solution were studied. These dendrimers were found to aggregate in aqueous solution, which manifested as an excimer peak in the pyrene emission spectra for the first and second generation dendrimers with ethyl and t-butyl end groups. The excimer peak however was not seen in case of the third generation dendrimer. Dendrimers with carboxylic end groups, did not show the excimer peak in water, which implies the hydrophobic nature of the aggregation. It is observed that the intensity of the excimer peak decreases with the increase in the size of the dendrimer. Lifetime studies carried out on the first and second generation dendrimers showed the formation of excimer species as a risetime in the decay curve. The aggregation of the third generation dendrimer was proposed from the quenching studies using silver ions and CCl(4) as quenchers.     

Parallel Changes in Structural and Functional Measures of Optic Nerve Myelination after Optic Neuritis

IntroductionVisual evoked potential (VEP) latency prolongation and optic nerve lesion length after acute optic neuritis (ON) corresponds to the degree of demyelination, while subsequent recovery of latency may represent optic nerve remyelination. We aimed to investigate the relationship between multifocal VEP (mfVEP) latency and optic nerve lesion length after acute ON.MethodsThirty acute ON patients were studied at 1,3,6 and 12 months using mfVEP and at 1 and 12 months with optic nerve MRI. LogMAR and low contrast visual acuity were documented. By one month, the mfVEP amplitude had recovered sufficiently for latency to be measured in 23 (76.7%) patients with seven patients having no recordable mfVEP in more than 66% of segments in at least one test. Only data from these 23 patients was analysed further.ResultsBoth latency and lesion length showed significant recovery during the follow-up period. Lesion length and mfVEP latency were highly correlated at 1 (r = 0.94, p = <0.0001) and 12 months (r = 0.75, p < 0.001). Both measures demonstrated a similar trend of recovery. Speed of latency recovery was faster in the early follow-up period while lesion length shortening remained relatively constant. At 1 month, latency delay was worse by 1.76ms for additional 1mm of lesion length while at 12 months, 1mm of lesion length accounted for 1.94ms of latency delay.ConclusionA strong association between two putative measures of demyelination in early and chronic ON was found. Parallel recovery of both measures could reflect optic nerve remyelination.     

Carboxymethyl chitosan-poly(amidoamine) dendrimer core–shell nanoparticles for intracellular lysozyme delivery

Intracellular delivery of native, active proteins is challenging due to the fragility of most proteins. Herein, a novel polymer/protein polyion complex (PIC) nanoparticle with core–shell structure was prepared. Carboxymethyl chitosan-grafted-terminal carboxyl group-poly(amidoamine) (CM-chitosan-PAMAM) dendrimers were synthesized by amidation and saponification reactions. ¹H NMR was used to characterize CM-chitosan-PAMAM dendrimers. The TEM images and results of lysozyme loading efficiency indicated that CM-chitosan-PAMAM dendrimers could self-assemble into core–shell nanoparticles, and lysozyme was efficiently encapsulated inside the core of CM-chitosan-PAMAM dendrimer nanoparticles. Activity of lysozyme was completely inhibited by CM-chitosan-PAMAM Dendrimers at physiological pH, whereas it was released into the medium and exhibited a significant enzymatic activity in an acidic intracellular environment. Moreover, the CM-chitosan-PAMAM dendrimer nanoparticles did not exhibit significant cytotoxicity in the range of concentrations below 3.16 mg/ml. The results indicated that these CM-chitosan-PAMAM dendrimers have excellent properties as highly potent and non-toxic intracellular protein carriers, which would create opportunities for novel applications in protein delivery.     

The interaction of tryptophan and ANS with PAMAM dendrimers

Dendrimers are globular, hyperbranched polymers possessing a high concentration of surface functional groups and internal cavities. These unique features make them very useful in many biomedical applications, especially as carrier molecules. In this study, the interaction of tryptophan and 1-anilinonaphthalene-8-sulfonic acid with three types of polyamidoamine dendrimers was examined. It was observed that the type of dendrimer surface group has a strong impact on the interactions between the dendrimers and fluorescent molecules.     

Dendrimers bind antioxidant polyphenols and cisplatin drug

Synthetic polymers of a specific shape and size play major role in drug delivery systems. Dendrimers are unique synthetic macromolecules of nanometer dimensions with a highly branched structure and globular shape with potential applications in gene and drug delivery. We examine the interaction of several dendrimers of different compositions mPEG-PAMAM (G3), mPEG-PAMAM (G4) and PAMAM (G4) with hydrophilic and hydrophobic drugs cisplatin, resveratrol, genistein and curcumin at physiological conditions. FTIR and UV-visible spectroscopic methods as well as molecular modeling were used to analyse drug binding mode, the binding constant and the effects of drug complexation on dendrimer stability and conformation. Structural analysis showed that cisplatin binds dendrimers in hydrophilic mode via Pt cation and polymer terminal NH(2) groups, while curcumin, genistein and resveratrol are located mainly in the cavities binding through both hydrophobic and hydrophilic contacts. The overall binding constants of durg-dendrimers are ranging from 10(2) M(-1) to 10(3) M(-1). The affinity of dendrimer binding was PAMAM-G4>mPEG-PAMAM-G4>mPEG-PAMAM-G3, while the order of drug-polymer stability was curcumin>cisplatin>genistein>resveratrol. Molecular modeling showed larger stability for genisten-PAMAM-G4 (ΔG = -4.75 kcal/mol) than curcumin-PAMAM-G4 ((ΔG = -4.53 kcal/mol) and resveratrol-PAMAM-G4 ((ΔG = -4.39 kcal/mol). Dendrimers might act as carriers to transport hydrophobic and hydrophilic drugs.     

Structure Activity Relationship of Dendrimer Microbicides with Dual Action Antiviral Activity

Background

Topical microbicides, used by women to prevent the transmission of HIV and other sexually transmitted infections are urgently required. Dendrimers are highly branched nanoparticles being developed as microbicides. However, the anti-HIV and HSV structure-activity relationship of dendrimers comprising benzyhydryl amide cores and lysine branches, and a comprehensive analysis of their broad-spectrum anti-HIV activity and mechanism of action have not been published.

Methods and Findings

Dendrimers with optimized activity against HIV-1 and HSV-2 were identified with respect to the number of lysine branches (generations) and surface groups. Antiviral activity was determined in cell culture assays. Time-of-addition assays were performed to determine dendrimer mechanism of action. In vivo toxicity and HSV-2 inhibitory activity were evaluated in the mouse HSV-2 susceptibility model. Surface groups imparting the most potent inhibitory activity against HIV-1 and HSV-2 were naphthalene disulfonic acid (DNAA) and 3,5-disulfobenzoic acid exhibiting the greatest anionic charge and hydrophobicity of the seven surface groups tested. Their anti-HIV-1 activity did not appreciably increase beyond a second-generation dendrimer while dendrimers larger than two generations were required for potent anti-HSV-2 activity. Second (SPL7115) and fourth generation (SPL7013) DNAA dendrimers demonstrated broad-spectrum anti-HIV activity. However, SPL7013 was more active against HSV and blocking HIV-1 envelope mediated cell-to-cell fusion. SPL7013 and SPL7115 inhibited viral entry with similar potency against CXCR4-(X4) and CCR5-using (R5) HIV-1 strains. SPL7013 was not toxic and provided at least 12 h protection against HSV-2 in the mouse vagina.

Conclusions

Dendrimers can be engineered with optimized potency against HIV and HSV representing a unique platform for the controlled synthesis of chemically defined multivalent agents as viral entry inhibitors. SPL7013 is formulated as VivaGel® and is currently in clinical development to provide protection against HIV and HSV. SPL7013 could also be combined with other microbicides.     

PGJ2 Provides Prolonged CNS Stroke Protection by Reducing White Matter Edema

Few clinically effective approaches reduce CNS-white matter injury. After early in-vivo white matter infarct, NFκB-driven pro-inflammatory signals can amplify a relatively small amount of vascular damage, resulting in progressive endothelial dysfunction to create a severe ischemic lesion. This process can be minimized by 15-deoxy-Δ^12,14-prostaglandin J2 (PGJ₂), an analog of the metabolically active PGD₂ metabolite. We evaluated PGJ₂''s effects and mechanisms using rodent anterior ischemic optic neuropathy (rAION); an in vivo white matter ischemia model. PGJ₂ administration systemically administered either acutely or 5 hours post-insult results in significant neuroprotection, with stereologic evaluation showing improved neuronal survival 30 days post-infarct. Quantitative capillary vascular analysis reveals that PGJ₂ improves perfusion at 1 day post-infarct by reducing tissue edema. Our results suggest that PGJ₂ acts by reducing NFκB signaling through preventing p65 nuclear localization and inhibiting inflammatory gene expression. Importantly, PGJ₂ showed no in vivo toxicity structurally as measured by optic nerve (ON) myelin thickness, functionally by ON-compound action potentials, on a cellular basis by oligodendrocyte precursor survival or changes in ON-myelin gene expression. PGJ₂ may be a clinically useful neuroprotective agent for ON and other CNS infarcts involving white matter, with mechanisms of action enabling effective treatment beyond the currently considered maximal time for intervention.     

Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.     

Enhanced cellular uptake of a triplex-forming oligonucleotide by nanoparticle formation in the presence of polypropylenimine dendrimers

We used polypropylenimine dendrimers for delivering a 31 nt triplex-forming oligonucleotide (ODN) in breast, prostate and ovarian cancer cell lines, using ³²P-labeled ODN. Dendrimers enhanced the uptake of ODN by ~14-fold in MDA-MB-231 breast cancer cells, compared with control ODN uptake. Dendrimers exerted their effect in a concentration- and molecular weight-dependent manner, with generation 4 (G-4) dendrimer having maximum efficacy. A similar increase in ODN uptake was found with MCF-7 and SK-BR-3 (breast), LNCaP (prostate) and SK-OV-3 (ovarian) cancer cells. The dendrimers had no significant effect on cell viability at concentrations at which maximum ODN uptake occurred. [³H]Thymidine incorporation showed that complexing the ODN with G-4 significantly increased the growth-inhibitory effect of the ODN. Western blot analysis showed a significant 65% reduction of c-myc protein level in ODN–G-4 treated cells compared with that of ODN-treated/control cells. Gel electrophoretic analysis showed that ODN remained intact in cells even after 48 h of treatment. The hydrodynamic radii of nanoparticles formed from ODN in the presence of the dendrimers were in the range of 130–280 nm, as determined by dynamic laser light scattering. Taken together, our results indicate that polypropylenimine dendrimers might be useful vehicles for delivering therapeutic oligonucleotides in cancer cells.     

Liquid-crystalline dispersions formed by the complexes of linear double-stranded DNA molecules with dendrimers

The specific features of liquid-crystalline dispersions formed by double-stranded DNA molecules interacting with polypropylenimine dendrimers of five generations (G1—G5) in aqueous saline solutions of various ionic strengths were studied. It was demonstrated that the binding of dendrimer molecules to DNA led to the formation of dispersions independently of solution ionic strength and dendrimer structure. By the example of a generation 4 dendrimer, it was shown that the shape of dispersion particles of the (DNA-dendrimer G4) complex were close to a sphere with a diameter of 300–400 nm. The boundary conditions (ionic strength of solution and molecular mass of dendrimer) for the formation of optically active (cholesteric) and optically inactive (DNA-dendrimer) dispersions were determined by circular dichroism spectroscopy. The dispersions formed by dendrimers G1–G3 and G5 were optically inactive. Dendrimers G4 formed liquid-crystalline dispersions of two types. Cholesteric liquid-crystalline dispersions were formed in high ionic strength solutions (μ > 0.4), whereas the dispersions formed in low and intermediate ionic strength solutions (μ < 0.4) lacked an intense negative band in their circular dichroism spectra. The effect of molecular crowding on both the (DNA-dendrimer G4) binding efficiency and the pattern of spatial packing of the (DNA-dendrimer G4) complexes in the liquid-crystalline dispersion particles was demonstrated. The factors determining the structural polymorphism of the liquid-crystalline dispersions of (DNA-dendrimer) complexes are postulated.     

Dendrimers in gene transfection

Dendrimers are a new class of nanocomposite materials. They are branching polymers whose structure is formed by monomeric subunit branches diverging to all sides from a central nucleus. The type of nucleus, attached monomers, and functional groups can be chosen during synthesis, which produces dendrimers of definite size, shape, density, polarity, branch mobility, and solubility. This review deals with problems of dendrimer molecular structures and capability of in vitro, in vivo, ex vivo, and in situ transfection of genetic material. Advantages and shortcomings of different types of dendrimers in this respect are discussed.     

Dendrimers as artificial enzymes

Dendrimers are regular tree-like macromolecules accessible by chemical synthesis from a variety of building blocks. Their topology enforces a globular shape that offers a unique opportunity to design artificial enzymes. Catalytic groups such as metal complexes and cofactors can be placed at the dendrimer core to exploit microenvironment and selectivity effects of the dendritic shell. In a second approach, attaching catalytic groups in multiple copies at the end of the dendritic branches may lead to cooperativity effects. Finally, exploration of dendritic structural space by screening combinatorial libraries of peptide dendrimers for catalytic activity can lead to discovery of functional dendrimers with enzyme-like properties, in a process mimicking natural selection.     

Gene delivery into mesenchymal stem cells: a biomimetic approach using RGD nanoclusters based on poly(amidoamine) dendrimers

Poly(amidoamine) dendrimers (generations 5 and 6) with amine termini were conjugated with peptides containing the arginine-glycine-aspartic acid (RGD) sequence having in view their application as gene delivery vectors. The idea behind the work was to take advantage of the cationic nature of dendrimers and of the integrin targeting capabilities of the RGD motif to improve gene delivery. Dendrimers were used as scaffolds for RGD clustering and, by controlling the number of peptides (4, 8, and 16) linked to each dendrimer, it was possible to evaluate the effect of RGD density on the gene delivery process. The new vectors were characterized in respect to their ability to neutralize and compact plasmid DNA (pDNA). The complexes formed by the vectors and pDNA were studied concerning their size, zeta potential, capacity of being internalized by cells and ability of transferring genes. Transfection efficiency was analyzed, first, by using a pDNA encoding for Enhanced Green Fluorescent Protein and Firefly Luciferase and, second, by using a pDNA encoding for Bone Morphogenetic Protein-2. Gene expression in mesenchymal stem cells was enhanced using the new vectors in comparison to native dendrimers and was shown to be dependent on the electrostatic interaction established between the dendrimer moiety and the cell surface, as well as on the RGD density of nanoclusters. The use of dendrimer scaffolds for RGD cluster formation is a new approach that can be extended beyond gene delivery applications, whenever RGD clustering is important for modulating cellular responses.     

Bundling and aggregation of DNA by cationic dendrimers

Dendrimers are unique synthetic macromolecules of nanometer dimensions with a highly branched structure and globular shape. Among dendrimers, polyamidoamine (PAMAM) have received most attention as potential transfection agents for gene delivery, because these macromolecules bind DNA at physiological pH. The aim of this study was to examine the interaction of calf-thymus DNA with several dendrimers of different compositions, such as mPEG-PAMAM (G3), mPEG-PAMAM (G4), and PAMAM (G4) at physiological conditions, using constant DNA concentration and various dendrimer contents. FTIR, UV-visible, and CD spectroscopic methods, as well as atomic force microscopy (AFM), were used to analyze the macromolecule binding mode, the binding constant, and the effects of dendrimer complexation on DNA stability, aggregation, condensation, and conformation. Structural analysis showed a strong dendrimer-DNA interaction via major and minor grooves and the backbone phosphate group with overall binding constants of K(mPEG-G3) = 1.5 (±0.5) × 10(3) M(-1), K(mPEG-G4) = 3.4 (±0.80) × 10(3) M(-1), and K(PAMAM-G4) = 8.2 (±0.90) × 10(4) M(-1). The order of stability of polymer-DNA complexation is PAMAM-G4 > mPEG-G4 > mPEG-G3. Both hydrophilic and hydrophobic interactions were observed for dendrimer-DNA complexes. DNA remained in the B-family structure, while biopolymer particle formation and condensation occurred at high dendrimer concentrations.