共查询到20条相似文献,搜索用时 15 毫秒
1.
Normal human genomic DNA (N-DNA) and mutated DNA (M-DNA) from K562 leukemic cells show different thermodynamic properties and binding affinities on interaction with anticancer drugs; adriamycin (ADR) and daunomycin (DNM). Isothermal calorimetric thermograms representing titration of ADR/DNM with N-DNA and M-DNA on analysis best fitted with sequential model of four and three events respectively. From Raman spectroscopy it has been identified that M-DNA is partially transformed to A form owing to mutations and N-DNA on binding of drugs too undergoes transition to A form of DNA. A correlation of thermodynamic contribution and structural data reveal the presence of different binding events in drug and DNA interactions. These events are assumed to be representative of minor groove complexation, reorientation of the drug in the complex, DNA deformation to accommodate the drugs and finally intercalation. Dynamic light scattering and zeta potential data also support differences in structure and mode of binding of N and M DNA. This study highlights that mutations can manifest structural changes in DNA, which may influence the binding efficacy of the drugs. New generation of drugs can be designed which recognize the difference in DNA structure in the cancerous cells instead of their biochemical manifestation. 相似文献
2.
The anticancer drugs Adriamycin (ADR) and Daunomycin (DNM) of the anthracycline family are effective in treating a variety of cancers. Although their interactions with other cellular targets may play a role in the selective cytotoxicity of these drugs, it is generally believed that intercalation with DNA is essential for their activity. However, a relationship has not yet been established between intercalation and cellular processes leading to cytotoxicity. The present study was designed to investigate the relationship, if any, between intercalation and DNA strand breaks. ADR and DNM were observed to be strong intercalators of human genomic DNA by absorption and fluorimetric methods that were further substantiated by rise in thermal melting temperature. DNM is the better intercalator of the two, which is also evident from circular dichroic spectral changes. DNA strand breaks, considered to be an index of genotoxicity, was assayed by single cell gel electrophoresis (SCGE; comet assay). ADR and DNM induced equivalent genotoxicity in normal human lymphocytes at a clinically used dose, which was observed to be independent of intercalation efficiency though positively correlated to yield of reactive oxygen species. 相似文献
3.
The fluorene derivative tilorone has received great attention as a DNA intercalator and has been widely recognized as an inducer of interferon. The biological activity of tilorone is known to be related to its binding mode with DNA; however, few structural and thermodynamic studies have elaborated on this issue. This paper presents two-dimensional (2-D) NMR and isothermal titration calorimetry (ITC) for the tilorone/DNA complex, coupled with circular dichroism (CD) spectroscopy and viscosity measurements. NMR investigation suggests that tilorone binds to DNA through intercalation, showing greater affinity for insertion between AT base pairs than between CG pairs. CD spectral changes were observed for T/B (tilorone/DNA base pair molar ratio) ratios greater than the stoichiometric ratio generally expected for intercalators (i.e., T/B = 0.5, according to the neighbor-exclusion principle). However, there was a clear plateau in the CD intensity between T/B < 0.35 and T/B > 0.45. From comparison with NMR and other measurements, we postulate that CD changes below the plateau should be related to the intercalation and the latter to electrostatic interactions and nonspecific bindings. ITC data showed that DeltaH < -TDeltaS < 0, which indicated that tilorone/DNA binding is enthalpy controlled. The magnitude of Kb (the binding constant) was of the same order as that of ethidium bromide. The stoichiometric number, obtained from ITC, CD, and UV data, implied a relatively smaller value (0.28-0.35) than that of the neighbor-exclusion principle. This is because side chains located in the groove disrupt further intercalation to the adjacent sites. 相似文献
4.
Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies. 相似文献
5.
Isothermal titration calorimetry (ITC) profiles of berenil bound to different DNAs show that, despite the strong preference of berenil for AT-rich regions in DNA, it can bind to other DNA sequences significantly. The ITC results were used to quantify the binding of berenil, and the thermodynamic profiles were obtained using natural DNAs as well as synthetic polynucleotides. ITC binding isotherms cannot be simply described when a single set of identical binding sites is considered, except for poly[d(A-T)2]. Ultraviolet melting of DNA and differential scanning calorimetry were also used to quantify several aspects of the binding of berenil to salmon testes DNA. We present evidence for secondary binding sites for berenil in DNA, corresponding to G+C rich sites. Berenil binding to poly[d(G-C)2] is also observed. Circular dichroism experiments showed that binding to GC-rich sites involves drug intercalation. Using a molecular modeling approach we demonstrate that intercalation of berenil into CpG steps is sterically feasible. 相似文献
6.
Thermodynamic characterization of the multivalent binding of chartreusin to DNA 总被引:3,自引:1,他引:2 下载免费PDF全文
Characterization of the thermodynamics of DNA– drug interactions is a very useful part in rational drug design. Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC) and UV melting experiments have been used to analyze the multivalent (intercalation plus minor groove) binding of the antitumor antibiotic chartreusin to DNA. Using DNA UV melting studies in the presence of the ligand and the binding enthalpy determined by ITC, we determined that the binding constant for the interaction was 3.6 × 105 M–1 at 20°C, in a solution containing 18 mM Na+. The DNA–drug interaction was enthalpy driven, with a ΔHb of –7.07 kcal/mol at 20°C. Binding enthalpies were determined by ITC in the 20–35°C range and used to calculate a binding-induced change in heat capacity (ΔCp) of –391 cal/mol K. We have obtained a detailed thermodynamic profile for the interaction of this multivalent drug, which makes possible a dissection of ΔGobs into the component free energy terms. The hydrophobic transfer of the chartreusin chromophore from the solution to the DNA intercalating site is the main contributor to the free energy of binding. 相似文献
7.
DNA intercalation by quinacrine and methylene blue: a comparative binding and thermodynamic characterization study 总被引:1,自引:0,他引:1
There is compelling evidence that cellular DNA is the target of many anticancer agents. Consequently, elucidation of the molecular nature governing the interaction of small molecules to DNA is paramount to the progression of rational drug design strategies. In this study, we have compared the binding and thermodynamic aspects of two known DNA-binding agents, quinacrine (QNA) and methylene blue (MB), with calf thymus (CT) DNA. The study revealed noncooperative binding phenomena for both the drugs to DNA with an affinity one order higher for QNA compared to MB as observed from diverse techniques, but both bindings obeyed neighbor exclusion principle. The data of the salt dependence of QNA and MB from the plot of log K versus log [Na+] revealed a slope of 1.06 and 0.93 consistent with the values predicted by theories for the binding of monovalent cations, and have been analyzed for contributions from polyelectrolytic and nonpolyelectrolytic forces. The binding of both drugs was further characterized by strong stabilization of DNA against thermal strand separation in both optical melting and differential scanning calorimetry studies. The binding data analyzed from the thermal denaturation and from isothermal titration calorimetry (ITC) were in close proximity to those obtained from spectral titration data. ITC results revealed the binding to be exothermic and favored by both negative enthalpy and positive entropy changes. The heat capacity changes obtained from temperature dependence of enthalpy indicated -146 and -78 cal/(mol.K), respectively, for the binding of QNA and MB to CT DNA. Circular dichroism study further characterized the structural changes on DNA upon intercalation of these molecules. Molecular aspects of interaction of these molecules to DNA are discussed. 相似文献
8.
H. Mansouri-Torshizi M. Saeidifar A. Divsalar A. A. Saboury 《Nucleosides, nucleotides & nucleic acids》2013,32(6):405-422
The interaction of new 1, 10-phenanthrolineoctyldithiocarbamatopalladium (II) nitrate with DNA from calf thymus was investigated at 300 and 310 K in a Tris-HCl buffer of pH 7.0 medium containing 20 mM sodium chloride. This water soluble, square planar Pd(II) complex has been synthesized and spectroscopic (electronic, infrared, and nuclear magnetic resonance) and elemental analysis of the complex are discussed. This complex shows greater growth inhibitory activity against human tumor cell line K562 than cisplatin. Results of UV-visible studies show that the complex exhibits cooperative binding with DNA and denatures the DNA at an extremely low concentration (~11.98 μM). Fluorescence studies reveal that the mode of binding of this complex with DNA seems to be intercalation. The results of sephadex G-25 column show that the binding of metal complex with DNA is so strong that it does not readily break. Several binding and thermodynamic parameters are also described. They may shed light on the mechanisms of interaction of this agent with DNA, which should be quite different from that of cisplatin. 相似文献
9.
Mansouri-Torshizi H Saeidifar M Divsalar A Saboury AA 《Nucleosides, nucleotides & nucleic acids》2011,30(6):405-422
The interaction of new 1, 10-phenanthrolineoctyldithiocarbamatopalladium (II) nitrate with DNA from calf thymus was investigated at 300 and 310 K in a Tris-HCl buffer of pH 7.0 medium containing 20 mM sodium chloride. This water soluble, square planar Pd(II) complex has been synthesized and spectroscopic (electronic, infrared, and nuclear magnetic resonance) and elemental analysis of the complex are discussed. This complex shows greater growth inhibitory activity against human tumor cell line K562 than cisplatin. Results of UV-visible studies show that the complex exhibits cooperative binding with DNA and denatures the DNA at an extremely low concentration (~11.98 μM). Fluorescence studies reveal that the mode of binding of this complex with DNA seems to be intercalation. The results of sephadex G-25 column show that the binding of metal complex with DNA is so strong that it does not readily break. Several binding and thermodynamic parameters are also described. They may shed light on the mechanisms of interaction of this agent with DNA, which should be quite different from that of cisplatin. 相似文献
10.
Isothermal titration (ITC) and differential scanning calorimetry (DSC) have been used to screen the binding thermodynamics of a family of DNA intercalators based on the dihydro-imidazo-phenanthridinium (DIP) framework. All members of this DIP-based ligand family bind to both genomic (calf thymus and/or salmon testes) and a synthetic dodecamer d(CGCGAATTCGCG) duplex DNA with broadly similar affinities regardless of side chain size or functionality. Viscosity measurements confirm that binding satisfies standard criteria for intercalation. Binding is exothermic but with an additional favourable positive entropy contribution in most cases at 25 degrees C, although a significant negative heat capacity effect (DeltaC(p)) means that both DeltaH(0) and DeltaS(0) decrease with increasing temperature. DIP-ligand binding to DNA also shows significant entropy-enthalpy compensation effects that are now almost standard in such situations, probably reflecting the conformational flexibility of macromolecular systems involving a multiplicity of weak non-covalent interactions. This ability to vary side chain functionality without compromising DNA binding suggests that the DIP framework should be a promising basis for more adventurous chemistry at the DNA level. 相似文献
11.
Comparison of the binding of anthracycline derivatives to purified DNA and to cell nuclei 总被引:1,自引:0,他引:1
Fluorescence method was used to study the interactions of anthracyclines with purified DNA and with cell nuclei at 37 degrees C, at pH ranging from 6.8 to 8. Four anthracyclines were used; adriamycin (ADR), 4'-o-tetrahydropyranyladriamycin (THP-ADR), daunorubicin (DNR) and aclacinomycin (ACM). The values of pKa of deprotonation of these four drugs in the pH range 6.5-8.5 are 8.4, 7.7, 8.4 and 7.0 for ADR, THP-ADR, DNR and ACM, respectively. The overall binding constants K* of these four drugs to purified DNA was determined at various pH values. The binding constants K0 and K+ of the respectively neutral form and once protonated form of the drugs to DNA were calculated. Using cell nuclei from K562 cells, the amount of drug intercalated (CN) within the nuclei of K562 cells and the amount of free drug (CE) in the solution were determined at various pH values: measuring at the same pH values, a linear correlation occurred between K* and CN/CE. 相似文献
12.
13.
A key step in the rational design of new DNA binding agents is to obtain a complete thermodynamic characterization of small molecule-DNA interactions. Ethidium bromide has served as a classic DNA intercalator for more than four decades. This work focuses on delineating the influence(s) of the 3- and 8-amino substituents of ethidium on the energetic contributions and concomitant fluorescent properties upon DNA complex formation. Binding affinities decrease by an order of magnitude upon the removal of either the 3- or 8-amino substituent, with a further order-of-magnitude decrease in the absence of both amino groups. The thermodynamic binding mechanism changes from enthalpy-driven for the parent ethidium to entropy-driven when both amino groups are removed. Upon DNA binding, fluorescence enhancement is observed in the presence of either or both of the amino groups, likely because of more efficient fluorescence quenching through solvent interactions of free amino groups than when buried within the intercalation site. The des-amino ethidium analog exhibits fluorescence quenching upon binding, consistent with less efficient quenching of the chromophore through interactions with solvent than within the intercalation site. Determination of the quantum efficiencies suggests distinct differences in the environments of the 3- and 8-amino substituents within the DNA binding site. 相似文献
14.
Mechanism of DNA binding by the ADR1 zinc finger transcription factor as determined by SPR 总被引:5,自引:0,他引:5
The ADR1 protein recognizes a six base-pair consensus DNA sequence using two zinc fingers and an adjacent accessory motif. Kinetic measurements were performed on the DNA-binding domain of ADR1 using surface plasmon resonance. Binding by ADR1 was characterized to two known native binding sequences from the ADH2 and CTA1 promoter regions, which differ in two of the six consensus positions. In addition, non-specific binding by ADR1 to a random DNA sequence was measured. ADR1 binds the native sites with nanomolar affinities. Remarkably, ADR1 binds non-specific DNA with affinities only approximately tenfold lower than the native sequences. The specific and non-specific binding affinities are conferred mainly by differences in the association phase of DNA binding. The association rate for the complex is strongly influenced by the proximal accessory region, while the dissociation reaction and specificity of binding are controlled by the two zinc fingers. Binding kinetics of two ADR1 mutants was also examined. ADR1 containing an R91K mutation in the accessory region bound with similar affinity to wild-type, but with slightly less sequence specificity. The R91K mutation was observed to increase binding affinity to a suboptimal sequence by decreasing the complex dissociation rate. L146H, a change-of-specificity mutation at the +3 position of the second zinc finger, bound its preferred sequence with a slightly higher affinity than wild-type. The L146H mutant indicates that beneficial protein-DNA contacts provide similar levels of stabilization to the complex, whether they are hydrogen-bonding or van der Waals interactions. 相似文献
15.
Anton Kuzyk Robert Schreiber Zhiyuan Fan Günther Pardatscher Eva-Maria Roller Alexander Högele 《Journal of biomolecular structure & dynamics》2013,31(1):92-93
We used the DNA origami method (Rothemund, 2006) for the fabrication of self-assembled nanoscopic materials (Seeman, 2010). In DNA origami, a virus-based 8?kilobase-long DNA single-strand is folded into shape with the help of ~ 200 synthetic oligonucleotides. The resulting DNA nanostructures can be designed to adopt any three-dimensional shape and can be addressed through DNA hybridization or chemical modification with nanometer precision. We have realized that complex assemblies of nanoparticles, including magnetic, fluorescent, and plasmonic nanoparticles. Such nanoconstructs may exhibit striking optical properties such as strong optical activity in the visible range (Kuzyk et al., 2012). To this end, plasmonic particles were assembled in solution to form helices of controlled handedness. We achieved spatial control over particle placement better than 2?nm and attachment yields of 97% and above. As a collective optical response emerging from our dispersed nanostructures, we detected pronounced circular dichroism (CD) originating from the plasmon–plasmon interactions in the particle helices. In recent experiments, we were able to show that the optical response of chiral biomolecules can be transferred from the UV into the visible region in plasmonic hotspots. Thus, sensitive detection of chiral biomolecules may become feasible in the near future. We also found that the orientation of the helices in respect to the incoming light beam critically influences the resulting CD spectra. Our results can be explained with theoretical models based on plasmonic dipole interaction and demonstrate the potential of DNA origami for the assembly of metafluids with designed optical properties. 相似文献
16.
Gene expression can be altered by small molecules that target DNA; sequence as well as shape selectivities are both extremely important for DNA recognition by intercalating and groove‐binding ligands. We have characterized a carbohydrate scaffold (1) exhibiting DNA “shape readout” properties. Thermodynamic studies with 1 and model duplex DNAs demonstrate the molecule's high affinity and selectivity towards B* form (continuous AT‐rich) DNA. Isothermal titration calorimetry (ITC), circular dichroism (CD) titration, ultraviolet (UV) thermal denaturation, and Differential Scanning Calorimetry were used to characterize the binding of 1 with a B* form AT‐rich DNA duplex d[5′‐G2A6T6C2‐3′]. The binding constant was determined using ITC at various temperatures, salt concentrations, and pH. ITC titrations were fit using a two‐binding site model. The first binding event was shown to have a 1:1 binding stoichiometry and was predominantly entropy‐driven with a binding constant of approximately 108 M?1. ITC‐derived binding enthalpies were used to obtain the binding‐induced change in heat capacity (ΔCp) of ?225 ± 19 cal/mol·K. The ionic strength dependence of the binding constant indicated a significant electrolytic contribution in ligand:DNA binding, with approximately four to five ion pairs involved in binding. Ligand 1 displayed a significantly higher affinity towards AT‐tract DNA over sequences containing GC inserts, and binding experiments revealed the order of binding affinity for 1 with DNA duplexes: contiguous B* form AT‐rich DNA (d[5′‐G2A6T6C2‐3′]) >B form alternate AT‐rich DNA (d[5′‐G2(AT)6C2‐3′]) > A form GC‐rich DNA (d[5′‐A2G6C6T2‐3′]), demonstrating the preference of ligand 1 for B* form DNA. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 720–732, 2014. 相似文献
17.
Influence of substituent modifications on DNA binding energetics of acridine-based anticancer agents
The DNA binding energetics of a series of analogues derived from the anticancer agent N-[2-(dimethylamino)ethyl]-9-aminoacridine-4-carboxamide (AAC) are investigated. The effects of substituent modification at the C5 position of the acridine chromophore on the interaction of AAC with DNA are determined using spectrophotometry and isothermal titration calorimetry (ITC). The binding affinity and binding free energy associated with the interaction of AAC with DNA are significantly enhanced upon substitution at the C5 position. Energetic profiles describing ligand-DNA complex formation obtained from ITC indicate that C5 substitution significantly enhances binding enthalpy relative to the parent AAC. In many cases, the enhanced binding enthalpies of the C5-substituted analogues correlate with anticancer activity. Because of the cationic character of AAC and its analogues, the DNA binding properties of these compounds are dependent on ionic strength. To quantitate the ionic contributions to complex formation, the observed binding free energy of each compound is parsed into its polyelectrolyte and nonelectrostatic components. Enhanced nonelectrostatic contributions to the overall binding free energies observed with C5-substituted analogues relative to the parent AAC suggest that C5 substituents play a critical role in directing both thermodynamic mechanisms associated with complex formation and molecular interactions between the ligand and its DNA binding site. These studies have demonstrated that substitution of AAC at the C5 position results in enhanced DNA binding affinity and energetics. 相似文献
18.
Acetylation of Werner protein at K1127 and K1117 is important for nuclear trafficking and DNA repair
《DNA Repair》2019
Werner syndrome is a rare autosomal recessive disorder where Werner (WRN) gene is mutated. Being a nucleolar protein, during DNA damage, WRN translocates at the damage site where its catalytic function is required in DNA repair. Several studies have indicated that WRN acetylation may modulate WRN trafficking and catalytic function (Blander et al., 2002; Lozada et al., 2014). Among the six acetylation sites in WRN protein identified by mass-spectrometry analysis (Li et al., 2010) we here explore the role of acetylation sites in C-terminal of WRN (K1127, K1117, K1389, K1413) because the C- terminal domain is the hub for protein- protein interaction and DNA binding activity (Brosh et al. [4]; Muftuoglu et al., 2008; Huang et al., 2006). To explore their functional activity, we created mutations in these sites by changing the acetylation residue lysine (K) to a non-acetylation residue arginine (R) and expressed them in WRN mutant cell lines. We observed that K1127R and K1117R mutants are sensitive to the DNA damaging agents etoposide and mitomycin C and display deficient DNA repair. Importantly, deacetylation of WRN by SIRT1 (Mammalian Sir2) is necessary for restoration of WRN localization at nucleoli after completion of DNA repair. Among all putative acetylation sites, K1127R, K1117R and the double mutant K1127R/K1117R showed significantly delayed re-entry to the nucleolus after damage recovery, even when SIRT1 is overexpressed. These mutants showed partial interaction with SIRT1 compared to WT WRN. Thus, our results suggest that K1127 and K1117 are the major sites of acetylation, necessary for DNA repair. These results elucidate the mechanism by which SIRT1 regulates WRN trafficking via these acetylation sites during DNA damage. 相似文献
19.
The DNA binding properties of the Escherichia coli RecQ helicase 总被引:6,自引:0,他引:6
The RecQ helicase family is highly conserved from bacteria to men and plays a conserved role in the preservation of genome integrity. Its deficiency in human cells leads to a marked genomic instability that is associated with premature aging and cancer. To determine the thermodynamic parameters for the interaction of Escherichia coli RecQ helicase with DNA, equilibrium binding studies have been performed using the thermodynamic rigorous fluorescence titration technique. Steady-state fluorescence anisotropy measurements of fluorescein-labeled oligonucleotides revealed that RecQ helicase bound to DNA with an apparent binding stoichiometry of 1 protein monomer/10 nucleotides. This stoichiometry was not altered in the presence of AMPPNP (adenosine 5'-(beta,gamma-imido) triphosphate) or ADP. Analyses of RecQ helicase interactions with oligonucleotides of different lengths over a wide range of pH, NaCl, and nucleic acid concentrations indicate that the RecQ helicase has a single strong DNA binding site with an association constant at 25 degrees C of K=6.7 +/- 0.95 x 10(6) M(-1) and a cooperativity parameter of omega=25.5 +/- 1.2. Both single-stranded DNA and double-stranded DNA bind competitively to the same site. The intrinsic affinities are salt-dependent, and the formation of DNA-helicase complex is accompanied by a net release of 3-4 ions. Allosteric effects of nucleotide cofactors on RecQ binding to DNA were observed only for single-stranded DNA in the presence of 1.5 mM AMPPNP, whereas both AMPPNP and ADP had no detectable effect on double-stranded DNA binding over a large range of nucleotide cofactor concentrations. 相似文献
20.
Titrations of specific 18-bp duplex DNA with the cardiac-specific homeodomain Nkx2.5(C56S) have utilized an ultrasensitive isothermal titration calorimeter (ITC). As the free DNA nears depletion, we observe large apparent decreases in the binding enthalpy when the DNA is impaired or when the temperature is sufficiently high to produce some unfolding of the free protein. Either effect can be attributed to refolding of the biopolymer that occurs as a result of stabilization due to the large favorable change in free energy on the homeodomain binding to DNA (-49.4 kJ/mol at 298 K). In either case, thermodynamic parameters obtained in such ITC experiments are unreliable. By using a lower temperature (85 vs. 95 degrees C) during the annealing of complementary DNA strands, damage of the 18-bp duplex DNA (T(m) = 72 degrees C) is avoided, and titrations with the homeodomain are normal at temperatures from 10 to 40 degrees C when >95% of the protein is folded. Under the latter conditions, the heat capacity plot is linear with a DeltaC(p) value of -0.80 +/- 0.03 kJ K(-1) mol(-1), which is more negative than that calculated from the burial of solvent accessible surface areas (-0.64 +/- 0.05 kJ K(-1) mol(-1)), consistent with water structures being at the protein-DNA interfaces. 相似文献