Arsenic trioxide-induced apoptosis through oxidative stress in cells of colon cancer cell lines

Exposure of three colon cancer cell lines, SW480, DLD-1, and COLO201, to arsenic trioxide in the medium induced a marked concentration-dependent suppression of cell growth. The intracellular contents of reduced glutathione (GSH) in these cell lines tended to be inversely correlated with the sensitivity of the cells to arsenic trioxide. Among the cell lines, SW480 cells underwent apoptosis at the low arsenic trioxide concentration of 2 microM, which was prevented by pretreatment of the cells with N-acetylcysteine and was enhanced by buthionine sulfoximine. The production of reactive oxygen intermediates which were examined by 2',7'-dichlorodihydrofluorescein diacetate (H2DCF-DA), increased with time after treatment with arsenic trioxide. The apoptosis was executed by the activation of caspase 3, which was shown by Western blot, enzymatic activity, and apoptosis inhibition assay. The mitochondrial membrane potential of adherent apoptotic SW480 cells and the cells from intermediate layer separated by density gradient centrifugation, both of which showed the active form of caspase 3 by Western blot analysis, was not lost. The overexpression of Bcl-2 protein in SW480 cells could not prevent the apoptosis induced by the treatment with arsenic trioxide. All these findings indicate that arsenic trioxide-induced apoptosis in SW480 cells is executed by the activation of caspase 3 without mediating by mitochondria under the overproduction of reactive oxygen species.     

Conversion of topoisomerase I cleavage complexes on the leading strand of ribosomal DNA into 5'-phosphorylated DNA double-strand breaks by replication runoff

Topoisomerase I cleavage complexes can be induced by a variety of DNA damages and by the anticancer drug camptothecin. We have developed a ligation-mediated PCR (LM-PCR) assay to analyze replication-mediated DNA double-strand breaks induced by topoisomerase I cleavage complexes in human colon carcinoma HT29 cells at the nucleotide level. We found that conversion of topoisomerase I cleavage complexes into replication-mediated DNA double-strand breaks was only detectable on the leading strand for DNA synthesis, which suggests an asymmetry in the way that topoisomerase I cleavage complexes are metabolized on the two arms of a replication fork. Extension by Taq DNA polymerase was not required for ligation to the LM-PCR primer, indicating that the 3' DNA ends are extended by DNA polymerase in vivo closely to the 5' ends of the topoisomerase I cleavage complexes. These findings suggest that the replication-mediated DNA double-strand breaks generated at topoisomerase I cleavage sites are produced by replication runoff. We also found that the 5' ends of these DNA double-strand breaks are phosphorylated in vivo, which suggests that a DNA 5' kinase activity acts on the double-strand ends generated by replication runoff. The replication-mediated DNA double-strand breaks were rapidly reversible after cessation of the topoisomerase I cleavage complexes, suggesting the existence of efficient repair pathways for removal of topoisomerase I-DNA covalent adducts in ribosomal DNA.     

Apoptotic topoisomerase I-DNA complexes induced by staurosporine-mediated oxygen radicals

Topoisomerase I (Top1), an abundant nuclear enzyme expressed throughout the cell cycle, relaxes DNA supercoiling by forming transient covalent DNA cleavage complexes. We show here that staurosporine, a ubiquitous inducer of apoptosis in mammalian cells, stabilizes cellular Top1 cleavage complexes. These complexes are formed indirectly as staurosporine cannot induce Top1 cleavage complexes in normal DNA with recombinant Top1 or nuclear extract from normal cells. In treated cells, staurosporine produces oxidative DNA lesions and generates reactive oxygen species (ROS). Quenching of these ROS by the antioxidant N-acetyl-l-cysteine or inhibition of the mitochondrial dependent production of ROS by the caspase inhibitor benzyloxycarbonyl-VAD prevents staurosporine-induced Top1 cleavage complexes. Down-regulation of Top1 by small interfering RNA decreases staurosporine-induced apoptotic DNA fragmentation. We propose that Top1 cleavage complexes resulting from oxidative DNA lesions generated by ROS in staurosporine-treated cells contribute to the full apoptotic response.     

Apoptosis is induced in leishmanial cells by a novel protein kinase inhibitor withaferin A and is facilitated by apoptotic topoisomerase I-DNA complex

Protein kinase C (PKC) is an important constituent of the signaling pathways involved in apoptosis. We report here that like staurosporine, withaferin A is a potent inhibitor of PKC. In Leishmania donovani, the inhibition of PKC by withaferin A causes depolarization of DeltaPsim and generates ROS inside cells. Loss of DeltaPsim leads to the release of cytochrome c into the cytosol and subsequently activates caspase-like proteases and oligonucleosomal DNA cleavage. Moreover, in treated cells, oxidative DNA lesions facilitate the stabilization of topoisomerase I-mediated cleavable complexes, which also contribute to DNA fragmentation. However, withaferin A and staurosporine cannot induce cleavable complex formation in vitro with recombinant topoisomerase I nor with nuclear extracts from control cells. Taken together, our results indicate that inhibition of PKC by withaferin A is a central event for the induction of apoptosis and that the stabilization of topoisomerase I-DNA complex is necessary to amplify apoptotic process.     

Arsenic trioxide induces G2/M growth arrest and apoptosis after caspase-3 activation and bcl-2 phosphorylation in promonocytic U937 cells

Arsenic trioxide has recently been shown to inhibit growth and induce apoptosis in acute promyelocytic leukemia (APL), but little is known about the molecular mechanisms mediating these effects. Here we demonstrate that treatment of promonocytic U937 cells with arsenic trioxide leads to G2/M arrest which was associated with a dramatic increase in the levels of cyclin B and cyclin B-dependent kinase and apoptosis. We further show that apoptosis occurs after bcl-2 phosphorylation and caspase-3 activation followed by cleavage of PARP and PLC-gamma1 degradation and DNA fragmentation. The arsenic trioxide-induced apoptosis could be blocked by the protein synthesis inhibitor cycloheximide. In addition, pretreatment of U937 cells with the DNA polymerase inhibitor aphidicolin also blocked apoptosis, but did not cause the arrest of cells in the G2/M phase. The findings suggest that arsenic trioxide exerts its growth-inhibitory effects by modulating expression and/or activity of several key G2/M regulatory proteins. Furthermore, arsenic trioxide-mediated G2/M arrest correlates with the onset of apoptosis.     

Intracellular GSH level is a factor in As4.1 juxtaglomerular cell death by arsenic trioxide

Arsenic trioxide has been known to regulate many biological functions such as cell proliferation, apoptosis, differentiation, and angiogenesis in various cell lines. We investigated the involvement of GSH and ROS such as H(2)O(2) and O(2)(*-) in the death of As4.1 cells by arsenic trioxide. The intracellular ROS levels were changed depending on the concentration and length of incubation with arsenic trioxide. The intracellular O(2)(*-) level was significantly increased at all the concentrations tested. Arsenic trioxide reduced the intracellular GSH content. Treatment of Tiron, ROS scavenger decreased the levels of ROS in 10 microM arsenic trioxide-treated cells. Another ROS scavenger, Tempol did not decrease ROS levels in arsenic trioxide-treated cells, but slightly recovered the depleted GSH content and reduced the level of apoptosis in these cells. Exogenous SOD and catalase did not reduce the level of ROS, but did decrease the level of O(2)(*-). Both of them inhibited GSH depletion and apoptosis in arsenic trioxide-treated cells. In addition, ROS scavengers, SOD and catalase did not alter the accumulation of cells in the S phase induced by arsenic trioxide. Furthermore, JNK inhibitor rescued some cells from arsenic trioxide-induced apoptosis, and this inhibitor decreased the levels of O(2)(*-) and reduced the GSH depletion in these cells. In summary, we have demonstrated that arsenic trioxide potently generates ROS, especially O(2)(*-), in As4.1 juxtaglomerular cells, and Tempol, SOD, catalase, and JNK inhibitor partially rescued cells from arsenic trioxide-induced apoptosis through the up-regulation of intracellular GSH levels.     

Assessment of cytogenetic damage in lymphocytes and in exfoliated nasal cells of dental laboratory technicians exposed to chromium,cobalt, and nickel

The alkaline comet assay is able to identify in individual cells DNA strand breaks associated with different processes. Topoisomerase inhibitors, some of which are used as chemotherapeutic agents, stabilise topoisomerase-DNA cleavable complexes by stimulating DNA strand cleavage and inhibiting religation. This can result in the activation of stress-associated signalling pathways, inducing cell cycle arrest and activation of the biochemical cascade of apoptosis. The aim of our study was to assess the ability of the comet assay to detect stabilisation of cleavable complexes and induction of apoptosis by two topoisomerase II inhibitors, etoposide and ellipticine, and two topoisomerase I inhibitors, camptothecin and topotecan. The study was carried out on Chinese hamster ovary (CHO) cells, DC3F cells and DC3F/C-10, its camptothecin-resistant counterpart. The comet assay was able to identify stabilised cleavable complexes through the presence of DNA strand breaks after 1h treatment that disappeared within 24h after drug removal. Kinetics studies allowed to discriminate between these early DNA damages and DNA fragmentation related to apoptosis characterised by reappearance of DNA strand breaks 48h after treatment.     

The geometry of DNA supercoils modulates topoisomerase-mediated DNA cleavage and enzyme response to anticancer drugs

Collisions with DNA tracking systems are critical for the conversion of transient topoisomerase-DNA cleavage complexes to permanent strand breaks. Since DNA is overwound ahead of tracking systems, cleavage complexes most likely to produce permanent strand breaks should be formed between topoisomerases and positively supercoiled molecules. Therefore, the ability of human topoisomerase IIalpha and IIbeta and topoisomerase I to cleave positively supercoiled DNA was assessed in the absence or presence of anticancer drugs. Topoisomerase IIalpha and IIbeta maintained approximately 4-fold lower levels of cleavage complexes with positively rather than negatively supercoiled DNA. Topoisomerase IIalpha also displayed lower levels of cleavage with overwound substrates in the presence of nonintercalative drugs. Decreased drug efficacy was due primarily to a drop in baseline (i.e., nondrug) cleavage, rather than an altered interaction with the enzyme-DNA complex. Similar results were seen for topoisomerase IIbeta, but the effects of DNA geometry on drug-induced scission were somewhat less pronounced. With both topoisomerase IIalpha and IIbeta, intercalative drugs displayed greater relative cleavage enhancement with positively supercoiled DNA. This appeared to result from negative effects of high concentrations of intercalative agents on underwound DNA. In contrast to the type II enzymes, topoisomerase I maintained approximately 3-fold higher levels of cleavage complexes with positively supercoiled substrates and displayed an even more dramatic increase in the presence of camptothecin. These findings suggest that the geometry of DNA supercoils has a profound influence on topoisomerase-mediated DNA scission and that topoisomerase I may be an intrinsically more lethal target for anticancer drugs than either topoisomerase IIalpha or IIbeta.     

Telomeric DNA damage by topoisomerase I. A possible mechanism for cell killing by camptothecin

Topoisomerase I adjusts torsional stress in the genome by breaking and resealing one strand of the helix through a transient covalent coupling between enzyme and DNA. Camptothecin, a specific topoisomerase I poison, traps this covalent intermediate, thereby damaging the genome. Here we examined the activity of topoisomerase I at telomeric repeats to determine whether telomere structures are targets for DNA damage. We show that topoisomerase I is catalytically active in cleaving the G-rich telomeric strand in vitro in the presence of camptothecin but not in cleaving the C-rich strand. The topoisomerase I cleavage site is 5'-TT (downward arrow) AGGG-3' (cleavage site marked by the downward arrow). We also show that endogenous topoisomerase I can access telomeric DNA in vivo and form camptothecin-dependent covalent complexes. Therefore, each telomeric repeat represents a potential topoisomerase I cleavage site in vivo. Because telomere structures are comprised of a large number of repeats, telomeres in fact represent a high concentration of nested topoisomerase I sites. Therefore, more telomeric DNA damage by camptothecin could occur in cells with longer telomeres when cells possess equivalent levels of topoisomerase I. The evidence presented here suggests that DNA damage at telomeric repeats by topoisomerase I is a prominent feature of cell killing by camptothecin and triggers camptothecin-induced apoptosis.     

Arsenic trioxide induces Hsp70 expression via reactive oxygen species and JNK pathway in MDA231 cells

In the present study, we determined the molecular pathways that induce the heat shock proteins (Hsps) after treatment of cells with arsenic trioxide. Administration of arsenic trioxide to MDA231 cells leads to induce Hsp70, which is accompanied by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). We showed that arsenic trioxide-induced Hsp70 expression was caused by activation of ROS and prevented by the antioxidant N-Acetyl-Cysteine (NAC). SP600125 and dominant-negative SEK suppressed Hsp70 promoter-driven reporter gene expression, suggesting that JNK would be preferentially associated with the protective heat shock response against arsenic trioxide stress. In addition, SP600125, a specific JNK inhibitor, significantly reduced the amount of phosphorylated HSF1 upon administration of arsenic trioxide. It is likely that Hsp70 expression against arsenic trioxide exposure protects cells from oxidative injury and apoptotic cell death by means of JNK activity.     

Sequence-specific base pair mimics are efficient topoisomerase IB inhibitors

Topoisomerase IB controls DNA topology by cleaving DNA transiently. This property is used by inhibitors, such as camptothecin, that stabilize, by inhibiting the religation step, the cleavage complex, in which the enzyme is covalently attached to the 3'-phosphate of the cleaved DNA strand. These drugs are used in clinics as antitumor agents. Because three-dimensional structural studies have shown that camptothecin derivatives act as base pair mimics and intercalate between two base pairs in the ternary DNA-topoisomerase-inhibitor complex, we hypothesized that base pairs mimics could act like campthotecin and inhibit the religation reaction after the formation of the topoisomerase I-DNA cleavage complex. We show here that three base pair mimics, nucleobases analogues of the aminophenyl-thiazole family, once targeted specifically to a DNA sequence were potent topoisomerase IB inhibitors. The targeting was achieved through covalent linkage to a sequence-specific DNA ligand, a triplex-forming oligonucleotide, and was necessary to position and keep the nucleobase analogue in the cleavage complex. In the absence of triplex formation, only a weak binding to the DNA and topoisomerase I-mediated DNA cleavage was observed. The three compounds were equally active once conjugated, implying that the intercalation of the nucleobase upon triplex formation is the essential feature for the inhibition activity.     

Exploring the cellular activity of camptothecin-triple-helix-forming oligonucleotide conjugates

Topoisomerase I is a ubiquitous DNA-cleaving enzyme and an important therapeutic target in cancer chemotherapy for camptothecins (CPTs). These drugs stimulate DNA cleavage by topoisomerase I but exhibit little sequence preference, inducing toxicity and side effects. A convenient strategy to confer sequence specificity consists of the linkage of topoisomerase poisons to DNA sequence recognition elements. In this context, triple-helix-forming oligonucleotides (TFOs) covalently linked to CPTs were investigated for the capacity to direct topoisomerase I-mediated DNA cleavage in cells. In the first part of our study, we showed that these optimized conjugates were able to regulate gene expression in cells upon the use of a Photinus pyralis luciferase reporter gene system. Furthermore, the formation of covalent topoisomerase I/DNA complexes by the TFO-CPT conjugates was detected in cell nuclei. In the second part, we elucidated the molecular specificity of topoisomerase I cleavage by the conjugates by using modified DNA targets and in vitro cleavage assays. Mutations either in the triplex site or in the DNA duplex receptor are not tolerated; such DNA modifications completely abolished conjugate-induced cleavage all along the DNA. These results indicate that these conjugates may be further developed to improve chemotherapeutic cancer treatments by targeting topoisomerase I-induced DNA cleavage to appropriately chosen genes.     

Endoplasmic reticulum stress mediates the arsenic trioxide-induced apoptosis in human hepatocellular carcinoma cells

Arsenic trioxide has been proven to trigger apoptosis in human hepatocellular carcinoma cells. Endoplasmic reticulum stress has been known to be involved in apoptosis through the induction of CCAAT/enhancer-binding protein homologous protein. However, it is unknown whether endoplasmic reticulum stress mediates arsenic trioxide-induced apoptosis in human hepatocellular carcinoma cells. Our data showed that arsenic trioxide significantly induced apoptosis in human hepatocellular carcinoma cells. Furthermore, arsenic trioxide triggered endoplasmic reticulum stress, as indicated by endoplasmic reticulum dilation, upregulation of glucose-regulated protein 78 and CCAAT/enhancer-binding protein homologous protein. We further found that 4-phenylbutyric acid, an inhibitor of endoplasmic reticulum stress, alleviated arsenic trioxide-induced expression of CCAAT/enhancer-binding protein homologous protein. More important, knockdown of CCAAT/enhancer-binding protein homologous protein by siRNA or inhibition of endoplasmic reticulum stress by 4-phenylbutyric acid alleviated apoptosis induced by arsenic trioxide. Consequently, our results suggested that arsenic trioxide could induce endoplasmic reticulum stress-mediated apoptosis in hepatocellular carcinoma cells, and that CCAAT/enhancer-binding protein homologous protein might play an important role in this process.     

Characterization of a topoisomerase-like activity at specific hypersensitive sites in the Drosophila histone gene cluster

It is well known that treatment of DNA-topoisomerase complexes with SDS induces cleavage of the DNA by trapping a reactive intermediate in which the topoisomerase is covalently linked to the terminal phosphates of the cut DNA. I have used this technique to examine potential topoisomerase binding sites in the histone gene chromatin of Drosophila Kc cells. Treatment of Kc nuclei with SDS induces Mg++-dependent DNA cleavage near the borders of two nuclease-hypersensitive sites located 5' and 3' of histone H4. It is likely that the SDS-induced cleavage at these hypersensitive sites is due to a topoisomerase because protein becomes tightly bound to the ends of the cleaved DNA fragments. Preliminary experiments suggest that a type II topoisomerase may be responsible for the cleavage.     

The human topoisomerase I damage response plays a role in apoptosis

Previous studies have shown that human topoisomerase I cleavage complexes form as a response to various DNA damages in vivo, the so called human topoisomerase I "damage response". It was suggested that this damage response may play a role in DNA repair as well as in apoptosis, but only very few investigations have been done and the significance of the damage response still remains unclear. Here we demonstrate that human topoisomerase I cleavage complexes induced by high doses of UV irradiation are highly stable for up to 48 h. Furthermore, we show that human topoisomerase I cleavage complexes correlate with apoptosis. However, at low UV doses the cleavage complex level was very low and the complexes were repaired. Surprisingly, we found that high levels of stable cleavage complexes were not only found in UV-irradiated cells but also in untreated cells that underwent apoptosis. A possible role of human topoisomerase I in apoptosis is discussed.     

Iridoids as DNA topoisomerase I poisons

The discovery of new topoisomerase I inhibitors is necessary since most of the antitumor drugs are targeted against type II and only a very few can specifically affect type I. Topoisomerase poisons generate toxic DNA damage by stabilization of the covalent DNA-topoisomerase cleavage complex and some have therapeutic efficacy in human cancer. Two iridoids, aucubin and geniposide, have shown antitumoral activities, but their activity against topoisomerase enzymes has not been tested. Here it was found that both compounds are able to stabilize covalent attachments of the topoisomerase I subunits to DNA at sites of DNA strand breaks, generating cleavage complexes intermediates so being active as poisons of topoisomerase I, but not topoisomerase II. This result points to DNA damage induced by topoisomerase I poisoning as one of the possible mechanisms by which these two iridoids have shown antitumoral activity, increasing interest in their possible use in cancer chemoprevention and therapy.     

Iridoids as DNA topoisomerase I poisons

The discovery of new topoisomerase I inhibitors is necessary since most of the antitumor drugs are targeted against type II and only a very few can specifically affect type I. Topoisomerase poisons generate toxic DNA damage by stabilization of the covalent DNA-topoisomerase cleavage complex and some have therapeutic efficacy in human cancer. Two iridoids, aucubin and geniposide, have shown antitumoral activities, but their activity against topoisomerase enzymes has not been tested. Here it was found that both compounds are able to stabilize covalent attachments of the topoisomerase I subunits to DNA at sites of DNA strand breaks, generating cleavage complexes intermediates so being active as poisons of topoisomerase I, but not topoisomerase II. This result points to DNA damage induced by topoisomerase I poisoning as one of the possible mechanisms by which these two iridoids have shown antitumoral activity, increasing interest in their possible use in cancer chemoprevention and therapy.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

The modulation of topoisomerase I-mediated DNA cleavage and the induction of DNA-topoisomerase I crosslinks by crotonaldehyde-derived DNA adducts

Crotonaldehyde is a representative alpha,beta-unsaturated aldehyde endowed of mutagenic and carcinogenic properties related to its propensity to react with DNA. Cyclic crotonaldehyde-derived deoxyguanosine (CrA-PdG) adducts can undergo ring opening in duplex DNA to yield a highly reactive aldehydic moiety. Here, we demonstrate that site-specifically modified DNA oligonucleotides containing a single CrA-PdG adduct can form crosslinks with topoisomerase I (Top1), both directly and indirectly. Direct covalent complex formation between the CrA-PdG adduct and Top1 is detectable after reduction with sodium cyanoborohydride, which is consistent with the formation of a Schiff base between Top1 and the ring open aldehyde form of the adduct. In addition, we show that the CrA-PdG adduct alters the cleavage and religation activities of Top1. It suppresses Top1 cleavage complexes at the adduct site and induces both reversible and irreversible cleavage complexes adjacent to the CrA-PdG adduct. The formation of stable DNA-Top1 crosslinks and the induction of Top1 cleavage complexes by CrA-PdG are mutually exclusive. Lastly, we found that crotonaldehyde induces the formation of DNA-Top1 complexes in mammalian cells, which suggests a potential relationship between formation of DNA-Top1 crosslinks and the mutagenic and carcinogenic properties of crotonaldehyde.