The synthesis of blocked triplet-phosphoramidites and their use in mutagenesis.

A general approach for the synthesis of oligonucleotide-triplet phosphoramidites and the synthesis of four such blocks are described. A strategy was devised to minimize the number of dimer precursors needed for synthesis of a complete set of triplet-amidite blocks encoding all 20 amino acids. Whereas synthesis of 20 triplet-amidite blocks consisting of codon sequences requires 16 dimer blocks, just seven dimer blocks are required to synthesize all required antisense sequences. The antisense sequences are then converted to codons in template mediated replication. Using a mixture of four triplet-amidites and conventional automated solid-phase DNA synthesis, short (6mer) and medium length (30mer) oligonucleotide mixtures were synthesized and analyzed. The latter was replicated in vitro and used as a mutagenic cassette to produce four mutants of Asp 221 in the enzyme thymidylate synthase. The method establishes the direction and utility for the production and use of triplet-amidite blocks in DNA synthesis.     

alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.     

High throughput parallel synthesis of oligonucleotides with 1536 channel synthesizer

A 1536 channel oligonucleotide synthesizer, the MultiSyn, was developed with the capability to simultaneously synthesize 1536 oligonucleotides of 20mer length in 10 h. The instrument was designed to synthesize different sequences of various lengths in micro-wells and has synthesized oligonucleotides as long as 119 nt with reasonably good yields using CPG beads of 1000 Å pore size. The instrument consists of four 384 channel synthesis modules. Phosphoramidite chemistry was employed and step yields as high as 99.3% were achieved. The enhancement of oligonucleotide synthesis throughput is accomplished by increasing the spatial density of reaction wells. We have identified several parameters that are critical in achieving a good synthesis yield and negligible failure rate in small reaction wells. The coefficient of variation (CV) of product yields in 1536 reaction wells was 20%. The quality of the product was examined by capillary electrophoresis and mass spectrometry. The instrument has robustly synthesized oligonucleotides of various lengths for use as primers and probes for PCR amplifications, oligonucleotide microarrays and genotyping applications. This high throughput oligonucleotide synthesizer is a useful instrument for genomic applications, which require tens of thousands of probes or primers in a short time.     

Multiplexed single nucleotide polymorphism genotyping by oligonucleotide ligation and flow cytometry

BACKGROUND: We have developed a rapid, high throughput method for single nucleotide polymorphism (SNP) genotyping that employs an oligonucleotide ligation assay (OLA) and flow cytometric analysis of fluorescent microspheres. METHODS: A fluoresceinated oligonucleotide reporter sequence is added to a "capture" probe by OLA. Capture probes are designed to hybridize both to genomic "targets" amplified by polymerase chain reaction and to a separate complementary DNA sequence that has been coupled to a microsphere. These sequences on the capture probes are called "ZipCodes". The OLA-modified capture probes are hybridized to ZipCode complement-coupled microspheres. The use of microspheres with different ratios of red and orange fluorescence makes a multiplexed format possible where many SNPs may be analyzed in a single tube. Flow cytometric analysis of the microspheres simultaneously identifies both the microsphere type and the fluorescent green signal associated with the SNP genotype. RESULTS: Application of this methodology is demonstrated by the multiplexed genotyping of seven CEPH DNA samples for nine SNP markers located near the ApoE locus on chromosome 19. The microsphere-based SNP analysis agreed with genotyping by sequencing in all cases. CONCLUSIONS: Multiplexed SNP genotyping by OLA with flow cytometric analysis of fluorescent microspheres is an accurate and rapid method for the analysis of SNPs.     

Oligodeoxyribonucleotide Phosphorothioates: Substantial Reduction of (N-1)-mer Content Through the Use of Trimeric Phosphoramidite Synthons

Abstract

Use of fully protected trimeric phosphoramidite synthons in the synthesis of oligonucleotide phosphorothioate shows a substantial reduction (>85%) in (n-1)-mer content as compared to oligomers synthesized through coupling of standard phosphoramidite monomers. A 20-mer oligodeoxyribonucleotide phosphorothioate which is in phase I clinical trials was chosen as an example for the studies.     

Suspension arrays for high throughput, multiplexed single nucleotide polymorphism genotyping

BACKGROUND: Genetic diversity can help explain disease susceptibility and differential drug response. The most common type of variant is the single nucleotide polymorphism (SNP). We present a low-cost, high throughput assay for SNP genotyping. METHODS: The assay uses oligonucleotide probes covalently attached to fluorescently encoded microspheres. These probes are hybridized directly to fluorescently labeled polymerase chain reaction (PCR) products and the results are analyzed in a standard flow cytometer. RESULTS: The genotypes determined with our assay are in good agreement with those determined by TaqMan. The range of G/C content for oligonucleotide probes was 23.5-65% in the 17 bases surrounding the SNP. Further optimization of probe length and target concentration is shown to dramatically enhance the assay performance for certain SNPs. Using microspheres which have unique fluorescent signatures, we performed a 32-plex assay where we simultaneously determined the genotypes of eight different polymorphic genes. CONCLUSIONS: We demonstrate, for the first time, the feasibility of multiplexed genotyping with suspension arrays using direct hybridization analyses. Our approach enables probes to be removed from or added to an array, enhancing flexibility over conventional chips. The ability to multiplex both the PCR preparation and the hybridization should enhance the throughput, cost, and speed of the assay.     

High-density,microsphere-based fiber optic DNA microarrays

A high-density fiber optic DNA microarray has been developed consisting of oligonucleotide-functionalized, 3.1-microm-diameter microspheres randomly distributed on the etched face of an imaging fiber bundle. The fiber bundles are comprised of 6000-50000 fused optical fibers and each fiber terminates with an etched well. The microwell array is capable of housing complementary-sized microspheres, each containing thousands of copies of a unique oligonucleotide probe sequence. The array fabrication process results in random microsphere placement. Determining the position of microspheres in the random array requires an optical encoding scheme. This array platform provides many advantages over other array formats. The microsphere-stock suspension concentration added to the etched fiber can be controlled to provide inherent sensor redundancy. Examining identical microspheres has a beneficial effect on the signal-to-noise ratio. As other sequences of interest are discovered, new microsphere sensing elements can be added to existing microsphere pools and new arrays can be fabricated incorporating the new sequences without altering the existing detection capabilities. These microarrays contain the smallest feature sizes (3 microm) of any DNA array, allowing interrogation of extremely small sample volumes. Reducing the feature size results in higher local target molecule concentrations, creating rapid and highly sensitive assays. The microsphere array platform is also flexible in its applications; research has included DNA-protein interaction profiles, microbial strain differentiation, and non-labeled target interrogation with molecular beacons. Fiber optic microsphere-based DNA microarrays have a simple fabrication protocol enabling their expansion into other applications, such as single cell-based assays.     

Multiplexed DNA quantification by spectroscopic shift of two microsphere cavities

We have developed a novel, spectroscopic technique for high-sensitivity, label-free DNA quantification. We demonstrate that an optical resonance (whispering gallery mode) excited in a micron-sized silica sphere can be used to detect and measure nucleic acids. The surface of the silica sphere is chemically modified with oligonucleotides. We show that hybridization to the target DNA leads to a red shift of the optical resonance wavelength. The sensitivity of this resonant technique is measured as 6 pg/mm(2) mass loading, higher as compared to most optical single-pass devices such as surface plasmon resonance biosensors. Furthermore, we show that each microsphere can be identified by its unique resonance wavelength. Specific, multiplexed DNA detection is demonstrated by using two microspheres. The multiplexed signal from two microspheres allows us to discriminate a single nucleotide mismatch in an 11-mer oligonucleotide with a high signal-to-noise ratio of 54. This all-photonic whispering gallery mode biosensor can be integrated on a semiconductor chip that makes it an easy to manufacture, analytic component for a portable, robust lab-on-a-chip device.     

SNP Detection for Cytochrome P450 Alleles by Target-assembled Tandem Oligonucleotide Systems Based on Exciplexes

Abstract

We report the first use of exciplex-based split-probes for detection of the wild type and *3 mutant alleles of human cytochrome P450 2C9. A tandem 8-mer split DNA oligonucleotide probe system was designed that allows detection of the complementary target DNA sequence. This exciplex-based fluorescence detector system operates by means of a contiguous hybridization of two oligonucleotide exciplex split-probes to a complementary target nucleic acid target. Each probe oligonucleotide is chemically modified at one of its termini by a potential exciplex-forming partner, each of which is fluorescently silent at the wavelength of detection. Under conditions that ensure correct three-dimensional assembly, the chemical moieties on suitable photoexcitation form an exciplex that fluoresces with a large Stokes shift (in this case 130 nm). Preliminary proof-of-concept studies used two 8-mer probe oligonucleotides, but in order to give better specificity for genomic applications, probe length was extended to give coverage of 24 bases. Eight pairs of tandem 12-mer oligonucleotide probes spanning the 2C9*3 region were designed and tested to find the best set of probes. Target sequences tested were in the form of (i) synthetic oligonucleotides, (ii) embedded in short PCR products (150 bp), or (iii) inserted into plasmid DNA (～ 3 Kbp). The exciplex system was able to differentiate wild type and human cytochrome P450 2C9 *3 SNP (1075 A→C) alleles, based on fluorescence emission spectra and DNA melting curves, indicating promise for future applications in genetic testing and molecular diagnostics.     

SNP detection for cytochrome P450 alleles by target-assembled tandem oligonucleotide systems based on exciplexes

We report the first use of exciplex-based split-probes for detection of the wild type and *3 mutant alleles of human cytochrome P450 2C9. A tandem 8-mer split DNA oligonucleotide probe system was designed that allows detection of the complementary target DNA sequence. This exciplex-based fluorescence detector system operates by means of a contiguous hybridization of two oligonucleotide exciplex split-probes to a complementary target nucleic acid target. Each probe oligonucleotide is chemically modified at one of its termini by a potential exciplex-forming partner, each of which is fluorescently silent at the wavelength of detection. Under conditions that ensure correct three-dimensional assembly, the chemical moieties on suitable photoexcitation form an exciplex that fluoresces with a large Stokes shift (in this case 130 nm). Preliminary proof-of-concept studies used two 8-mer probe oligonucleotides, but in order to give better specificity for genomic applications, probe length was extended to give coverage of 24 bases. Eight pairs of tandem 12-mer oligonucleotide probes spanning the 2C9*3 region were designed and tested to find the best set of probes. Target sequences tested were in the form of (i) synthetic oligonucleotides, (ii) embedded in short PCR products (150 bp), or (iii) inserted into plasmid DNA (approximately 3 Kbp). The exciplex system was able to differentiate wild type and human cytochrome P450 2C9 *3 SNP (1075 A-->C) alleles, based on fluorescence emission spectra and DNA melting curves, indicating promise for future applications in genetic testing and molecular diagnostics.     

Reusable Solid-Phase Supports for Oligonucleotide Synthesis Using Hydroquinone-O,O'-diacetic Acid (“Q-Linker”)

Abstract

Reusable solid-phase supports for large scale oligonucleotide synthesis have been prepared by converting amino derivatized supports into hydroxyl supports. Rapid nucleo side attachment, via a Q-linker arm, was automatically performed on the DNA synthesizer using HBTU and DMAP as the coupling reagents. All steps were suitable for automation and ～ 1.5 h was required to prepare the supports for reuse. Up to twelve consecutive syntheses of a 20-mer phosphorothioate were performed on a synthesis column.     

Universal oligonucleotide microarray for sub-typing of Influenza A virus

A universal microchip was developed for genotyping Influenza A viruses. It contains two sets of oligonucleotide probes allowing viruses to be classified by the subtypes of hemagglutinin (H1-H13, H15, H16) and neuraminidase (N1-N9). Additional sets of probes are used to detect H1N1 swine influenza viruses. Selection of probes was done in two steps. Initially, amino acid sequences specific to each subtype were identified, and then the most specific and representative oligonucleotide probes were selected. Overall, between 19 and 24 probes were used to identify each subtype of hemagglutinin (HA) and neuraminidase (NA). Genotyping included preparation of fluorescently labeled PCR amplicons of influenza virus cDNA and their hybridization to microarrays of specific oligonucleotide probes. Out of 40 samples tested, 36 unambiguously identified HA and NA subtypes of Influenza A virus.     

Synthesis of very short chain lysophosphatidyloligodeoxynucleotides

Very short chain 5'-O-lysophosphatidyloligonucleotides [5'-O-(1-O-palmitoyl-sn-glycero-3-phosphoryl)oligodeoxynucleotides, (5'-LyPOdNs)] were synthesized following a two-step chemoenzymatic synthesis. 5'-O-(sn-Glycero-3-phosphoryl)oligodeoxynucleotides (5'-GPOdNs) were first prepared by simply using a phosphoramidite of [(4S)-2,2-dimethyl-1,3-dioxolan-4-yl]methanol (1) in a further coupling step after the solid-phase elongation of each desired oligodeoxynucleotide. Next, the regioselective palmitoylation at the C-1 hydroxyl of the glycerol moiety of 5'-GPOdNs was achieved by a lipase-catalyzed transacylation with trifluoroethyl palmitate in organic solvent. Despite of the molecular bulkiness of 5'-GPOdNs, 2-, 3-, and 4-mer 5'-LyPOdNs were prepared by this procedure. Although in very low yield, 5- and 6-mer 5'-LyPOdNs were also obtained by this way.     

Simultaneous rapid chemical synthesis of over one hundred oligonucleotides on a microscale

An inexpensive, extremely rapid manual method for simultaneous synthesis of large numbers of oligodeoxyribonucleotides on 50 or 150 nanomole scale is described. The oligonucleotides are assembled in parallel by the phosphotriester method on small cellulose paper disks in a simple gas pressure-controlled continuous-flow system. For each addition of a nucleotide the disks are sorted into four sets which are placed in four columns for addition of A, C, G and T, respectively. During one 2-week period, three rounds of synthesis by this method yielded 254 oligomers (8- to 22-mers), many of which were also purified during this time. Using 50 nanomole scale reactions the yields for 17-mers, for example, were in the range of 0.5 O.D.₂₆₀ units (˜5 nmol, i.e., ˜10% yield), an amount sufficient for most purposes. The equipment required is relatively inexpensive and for the most part usually already available in molecular biology laboratories. All chemicals are commercially available and the current reagent cost per oligonucleotide (25 μg, average length 17-mer) is ˜3 US dollars.     

Rapid synthesis of long-chain deoxyribooligonucleotides by the N-methylimidazolide phosphotriester method.

A modified phosphotriester method has been employed for the efficient chemical synthesis of long-chain deoxyribooligonucleotides. During the course of this work, a general and rapid procedure was developed for the preparation of 24-62-mers in solution. Preparative reversed phase column chromatography on silanized silica gel was used to purify triester intermediates starting from 10-mers. The rapid synthesis of 32-mer and 42-mer on glass and silica gel supports using suitably protected 2-8-mer blocks as coupling units has been also accomplished. In particular, a convenient procedure for the solid-phase synthesis of oligonucleotide blocks bearing 3'-terminal phosphodiester groups is described.     

Fructose induces and glucose represses chloroperoxidase mRNA levels

The fungus Caldariomyces fumago can be induced to secrete the heme protein chloroperoxidase at levels of 500 mg/liter. Chloroperoxidase synthesis is controlled at the mRNA level. Glucose strongly represses production of chloroperoxidase mRNA and protein, whereas fructose induces both to high levels. Chloroperoxidase has been partially sequenced by automated Edman degradation of tryptic peptides. Based on this amino acid sequence data, a 2-fold degenerate, 29-base oligonucleotide (29-mer) complementary to chloroperoxidase mRNA was synthesized. Polyadenylated RNA, purified from C. fumago, was used as substrate for cDNA synthesis using the 29-mer as primer. cDNAs were made double-stranded and cloned into plasmid pBR322 by conventional methods. Screening the resultant cDNA bank by colony hybridization with the 29-mer as probe showed that 18% of the clones contained the 29-mer sequence. Dideoxy sequencing of one clone (pMA340) identified it as part of the coding region for chloroperoxidase by comparison with known amino acid sequences. In addition, the amino-terminal coding region of clone pMA340 reveals a putative signal peptide for chloroperoxidase. Clone pMA340 was then used in Northern analysis of chloroperoxidase mRNA levels under conditions which induce and repress enzyme secretion.     

Cleavage of RNA in hybrid duplexes by ribonuclease H ofE. coli: I. Substrate properties of complexes formed by RNA and a tandem of short oligodeoxyribonucleotides

We studied theE. coli RNase H cleavage of a 5′-labeled RNA fragment within two hybrid duplexes with identical sequences, one of which is formed by RNA and a 20-mer oligodeoxyribonucleotide (RNA/p20) whereas the second, by RNA and a tandem of short oligodeoxyribonucleotides (octanucleotide : tetranucleotide : octanucleotide) (RNA/tandem). It was shown that RNA in the RNA/p20 complex is hydrolyzed from the 3′-end to yield consecutively the 17-, 14-, 11-, 8-, and 5-mer 5′-labeled fragments. On hydrolysis of RNA in complex RNA/tandem, the same products were registered but their accumulation rates in this case differed. Thus, the initial rates of accumulation of the 17- and 8-mer were close. Moreover, the accumulation of the final 5-mer differed considerably: in the RNA/tandem complex it appeared within first minutes of the reaction but only after a considerable lag period in complex RNA/p20. These data testify that the tandem is involved not only in the consecutive accumulation of the shortened products (which is characteristic of complexes including extended oligonucleotides) but also in the parallel accumulation. This results from hydrolysis of each duplex segment formed by RNA and the short oligonucleotide of the tandem. Although the order of recognition and cleavage of RNA target by ribonuclease H at certain bonds depends on the type of the hybrid duplex, the destruction of RNA target within complex RNA/tandem and in complex with the full-size oligonucleotide occurs with a close effectiveness.     

Cleavage of RNA in hybrid duplexes by ribonuclease H from E. coli. I. Substrate properties of complexes formed by RNA and tandem of short oligodeoxyribonucleotides

We studied the E. coli RNase H cleavage of a 5'-labeled RNA fragment within two hybrid duplexes with identical sequences, one of which is formed by RNA and a 20-mer oligodeoxyribonucleotide (RNA/p20), whereas the second, by RNA and a tandem of short oligodeoxyribonucleotides (octanucleotide: (RNA/tandem). It was shown that RNA in the RNA/p20 complex is hydrolyzed from the 3'-end to yield consecutively the 17-, 14-, 11-, 8-, and 5-mer 5'-labeled fragments. On hydrolysis of RNA in complex RNA/tandem, the same products were registered, but their accumulation rates in this case differed. Thus, the initial rates of accumulation of the 17- and 8-mer were close. Moreover, the accumulation of the final 5-mer differed considerably: in the RNA/tandem complex it appeared within first minutes of the reaction, but only after a considerable lag period in complex RNA/p20. These data testify that the tandem is involved not only in the consecutive accumulation of the shortened products (which is characteristic of complexes including extended oligonucleotides) but also in the parallel accumulation. This results from hydrolysis of each duplex segment formed by RNA and the short oligonucleotide of the tandem. Although the order of recognition and cleavage of RNA target by ribonuclease H depends on the type of the hybrid duplex, the destruction of RNA target within complex RNA/tandem and in complex with the full-size oligonucleotide occurs with a close effectiveness.     

Stability of Phosphorothioate Oligonucleotides in Aqueous Ammonia in Presence of Stainless Steel

Abstract

Antisense oligonucleotides as modulators of gene expression represent an exciting new drug technology. Oligodeoxyribonucleotide phosphorothioates are now among the most intensively investigated nuclease-resistant antisense analogs, as evidenced by a number of ongoing clinical trials against several disease targets. Structurally, these differ from natural oligonucleotides by the replacement of one of two nonbridging oxygen atoms by a sulfur atom at each internucleotide linkage. Among factors in the successful development of these complex molecules to support broad clinical trials have been advances made in automation, analysis and purification. The large scale synthesis of oligonucleotide phosphorothioates is presently carried out by initial formation of the internucleotide phosphite linkage using solid-phase phosphoramidite chemistry followed by sulfurization. Efficient synthesis of 20-mer oligophosphorothioates has been achieved on 0.15 mole scale with only 1.75-fold excess of amidite synthons. However, as the scale of synthesis increases to meet future market demands, issues related to fast and efficient synthesis, automation, scalability and product purification are also being investigated. One issue has been the protocol for final product deprotection. Since deprotection involves large quantities of saturated aqueous ammonium hydroxide, one might consider use of stainless steel reactors to withstand resulting vapor pressure at 55°C. A recent report,¹ however, discusses the instability of dimer phosphorothioates in aqueous ammonia in the presence of metal ions. As this is potentially an important issue for phosphorothioate oligonucleotide synthesis, we describe herein our findings regarding deprotection of a 20-mer oligodeoxyribonucleotide phosphorothioate with aqueous ammonia during process development studies.     

Cooperative lectin recognition of periodical glycoclusters along DNA duplexes: alternate hybridization and full hybridization

We describe herein the construction of periodically, spatially controlled glycoclusters along DNA duplexes and their cooperative lectin recognition. Site-specifically alpha-mannosylated oligodeoxynucleotide 20-mer (Man-ODN20) was synthesized via the phosphoramidite solid-phase synthesis. Alternate hybridization of the Man-ODN20 with the half-sliding complementary ODN 20-mer (hscODN20) gave an alternately prolonged Man-cluster Man-ODN20/hscODN20. The binding of the Man-cluster to FITC-labeled ConA lectin showed sigmoidal fluorescence dependency on the concentration of Man-ODN, indicating that some mannose residues along the repeating DNA duplex were cooperatively bound to ConA (apparent affinity constant: K(af)=2.4 x 10(4)M(-1) and Hill coefficient: n=3.5). The duplex of Man-ODN20 with full complementary ODN 20-mer (fcODN20) was little bound to ConA. The binding behavior of Man-ODN20/hscODN20 is compared with that of the alternately prolonged Gal-cluster Gal-ODN20/hscODN20 previously reported. Duplexes 20-mer, 40-mer, and 60-mer presenting one, two, and three periodic galactoses were also prepared by full hybridization of 20-mer beta-galactosylated oligodeoxynucleotide (Gal-ODN20) with the periodically repeating full complementary 20-mer, 40-mer, and 60-mer ODNs. RCA(120) lectin was found to little bind the 20-mer and 40-mer duplexes and to bind weakly and non-cooperatively the 60-mer duplex (K(af)=1.1 x 10(4)M(-1)). The cooperative lectin recognition of these glycoclusters in relation with the degree of association (DA) of ODN and the numbers of glycosides along the DNA duplex is discussed.