Identification of Simian virus 40 promoter DNA sequences capable of conferring restriction endonuclease hypersensitivity.

The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.     

Expression vector system based on the chicken beta-actin promoter directs efficient production of interleukin-5

We examined the promoter activity of the 1.3-kb chicken beta-actin gene sequence located between the 5' flanking region and the proximal region of the second exon. This promoter region showed higher promoter activity than the simian virus 40 (SV40) early promoter or the Rous sarcoma virus (RSV) long terminal repeat (LTR) as assayed by transient lacZ gene expression in mouse L cells. Furthermore, replacement of the 3' splice sequence in this promoter by that derived from the rabbit beta-globin gene resulted in a approximately 2.5-fold enhancement in the synthesis of beta-galactosidase (beta Gal). Introduction of the SV40 origin of DNA replication (ori) into the vector carrying this hybrid promoter, which we designate the AG promoter, markedly enhanced the production of beta Gal in an SV40 T antigen-producing cell, BMT10. We have constructed a useful vector containing the strong AG promoter, several unique restriction sites, a SV40 polyadenylation signal and the SV40 ori for transient expression of cDNA in BMT10 or COS cells. We demonstrate the use of this vector for efficient production of interleukin-5 in BMT10 cells.     

The repeated GC-rich motifs upstream from the TATA box are important elements of the SV40 early promoter.

We have constructed deletion and point mutations within the Simian virus 40 (SV40) early promoter region which contains two tandemly repeated 21 bp sequences and a related 22 bp sequence (the "upstream" 21 bp repeat region). After transfection into permissive CV-1 cells and non-permissive mouse 3T3-4E cells, the effect of the mutations on early gene expression was studied by measuring T-antigen production, using indirect immunofluoresence. Our results demonstrate that the 21 bp repeat region, and in particular the six GC-rich motifs 5'-CCGCCC-3' which are repeated in this region constitute an important element of the SV40 early promoter. Surprisingly, we found that the requirement for the 21 bp repeat region for early gene expression was partially fulfilled even when it was in the inverted orientation.     

The stimulation of gene expression by the R region from HTLV-1 and BLV

The 5' untranslated regions (5'UTR) of mRNA are known to stimulate or inhibit more or less translation. SR alpha, an association of SV40 early gene promoter and of the R region plus the first 39 nucleotides of the U5 region (designated as R) from the human T-cell leukemia virus (HTLV-1) is currently used to stimulate expression of various coding regions. Its effect is considered to take place at the translational level. In all studies published so far, the R region was associated with the promoter and 5'UTR from SV40 early genes. In the present work, the role of SV40 5'UTR and HTLV-1R region was evaluated separately using different promoters, reporter genes and cells. Both SV40 5'UTR (SU) and R region (R) from HTLV-1 stimulated separately the expression of adjacent reporter genes. When associated, the SV40 5'UTR and the R region from HTLV-1 (SUR) were a more potent stimulator of gene expression and their effects were more than additive. This effect was very potent in HeLa and HC11 cells and almost inexistent in CHO and COS 7 cells. It was of various intensity in other cell types including bird and fish cells. The presence of SUR in gene constructs favoured the accumulation of the mRNAs. SUR stimulated gene expression when added between the cap and the initiation codon. Unexpectedly, SUR was never inhibitory. SUR can therefore be considered essentially as potent and specific stimulator of gene expression favoring mRNA accumulation.     

Epstein-Barr virus episome-based promoter function in human myeloid cells.

Epstein-Barr virus (EBV) episomal replicons offer an expeditious means for amplifying transfected genes in human cells. A panel of EBV episomes was constructed to assess the relative utility of five distinct eukaryotic promoter elements for high level and inducible gene expression in stably transfected human myeloid leukemia cells. The Rous sarcoma virus 3' long terminal repeat (LTR) was most highly suited for EBV episome-based gene expression, whereas the lymphopapilloma virus and the SV40 early regulatory elements exhibited substantially lower activities. Chemically responsive promoter elements, such as the SV40 early, human metallothionein IIA and rat GRP78 gene promoters, retained their inducibility when EBV episome-based. Differences in gene expression obtained with the episomes reflected differential promoter activity rather than significant variations in episome copy numbers per cell. These observations provide guidelines for the optimal design of EBV episomal expression vectors for human expression work.     

Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system

We have characterized the promoter region of the human elongation factor 1 alpha-encoding gene (EF-1 alpha) and developed a versatile expression system which has a wide host range and a high efficiency of gene expression. To identify the promoter region of the EF-1 alpha gene necessary for efficient gene expression, we constructed four pEF-CAT plasmids that have the bacterial cat gene fused to four different sites of the human EF-1 alpha gene: (i) ligated to the end of the TATA box (pEF220-CAT); (ii) ligated in exon 1 (pEF204-CAT and pEF233-CAT), and (iii) ligated in exon 2 (pEF321-CAT). All the pEF-CAT plasmids were highly expressed in all the cell types tested, including fibroblasts and lymphoid cells. Plasmid pEF321-CAT, which contains the first exon and the first intron, gave the highest level of cat expression. Plasmids pEF204- and pEF233-CAT, which contain part of the first exon but do not contain the first intron, were less efficient in cat expression than was pEF321-CAT. Plasmid pEF220-CAT, which lacks both the first exon and the first intron, was the least efficient. Plasmid pEF321-CAT was several- to 100-fold more efficient in cat expression than plasmid pSV2-CAT depending on the recipient cell types. The promoter of pEF321 plasmid also directed the stable expression of the bacterial neo gene more efficiently than the promoter of the simian virus 40 (SV40) early gene or the long terminal repeat of Rous sarcoma virus. Using this system, the SV40 early gene and the cDNA encoding human CD4 were also expressed efficiently.     

Expression of adenovirus type 12 E1A gene in monkey cells, using a simian virus 40 vector.

Simian virus 40 (SV40) recombinants carrying the adenovirus type 12 E1A gene were constructed. The SV40 expression vector was constructed by removing most of the VP1 gene and an internal part of the intervening sequence for late 16S RNA and by joining the 5' and 3' splice sites into a small segment. The adenovirus type 12 E1A gene with or without its own promoter was inserted downstream from the SV40 late promoter and the splicing junctions. The recombinant DNA was propagated and packaged in monkey cells by cotransfection with an early temperature-sensitive mutant (tsA58) DNA as helper. Immunofluorescent staining of the monkey cells infected with the resulting virus stocks showed that up to 20% of the cells overproduced the E1A gene products in the nuclei. Two-dimensional gel electrophoresis of the products indicated that the products were very similar or identical to the authentic polypeptides synthesized in adenovirus type 12-infected human embryo kidney cells. The E1A mRNA was initiated at the SV40 late promoter irrespective of the presence of the E1A promoter and terminated at either the E1A or the SV40 polyadenylation signal. These hybrid mRNAs were correctly spliced in the E1A coding region.     

Deletion analysis of the mouse alpha 1(III) collagen promoter.

A chimeric gene was constructed by fusing the DNA sequences containing the 5' flanking region of the mouse alpha 1(III) collagen gene to the coding sequence of the bacterial chloramphenicol acetyltransferase (CAT) gene. Transient transfection experiments indicated that the alpha 1(III) promoter is active in NIH 3T3 fibroblasts and BC3H1 smooth muscle cells. The activity of the alpha 1(III) collagen promoter-CAT plasmid is stimulated approximately ten fold by the presence of the SV40 enhancer element. Removing sequences upstream of -200 stimulates the activity of the chimeric gene eight fold. Further deletion analysis identified sequences located between -350 and -300 that were instrumental in repressing the activity of the promoter. This 50 bp region contains a direct repeat sequence that may be involved in the regulation of the mouse alpha 1(III) collagen gene. Truncating the alpha 1(III) promoter to -80 further stimulated expression. We propose that the positive regulatory elements of this gene appear to be located within the first 80 bp of the promoter, whereas elements located further upstream exert a negative effect on the expression of the gene. Regulation of the alpha 1(III) gene contrasts with that of the alpha 2(I) collagen gene, which appears to be regulated by several positive elements located in various regions of the promoter.