Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.     

Effect of excess water on the desilylation of oligoribonucleotides using tetrabutylammonium fluoride.

The most commonly available 2' hydroxyl protecting group used in the synthesis of oligoribonucleotides is the tert-butyldimethylsilyl moiety. This protecting group is generally cleaved with 1 M tetrabutylammonium fluoride (TBAF) in tetrahydrofuran (THF). The efficiency of this reaction was tested on ribonucleotidyldeoxythymidine dinucleotides (AT, CT, GT, and UT). We have found that the efficiency of desilylation of uridine and cytidine is greatly dependent on the water content of the TBAF reagent. Conversely, the water content of the TBAF reagent [up to 17% (w/w)] had no detectable effect on the rate of desilylation of adenosine and guanosine. It was concluded that for effective desilylation of pyrimidine nucleosides the water content of the TBAF reagent must be 5% or less, which is readily achieved using molecular sieves. TBAF dried in such a manner was shown to be effective in deprotecting an oligoribonucleotide containing both purine and pyrimidine residues.     

Nucleoside analogue substitutions in the trinucleotide DNA template recognition sequence 3'-(CTG)-5' and their effects on the activity of bacteriophage T7 primase

Bacteriophage T7 primase catalyzes the synthesis of the oligoribonucleotides pppACC(C/A) and pppACAC from the single-stranded DNA template sites 3'-d[CTGG(G/T)]-5' and 3'-(CTGTG)-5', respectively. The 3'-terminal deoxycytidine residue is conserved but noncoding. A series of nucleoside analogues have been prepared and incorporated into the conserved 3'-d(CTG)-5' site, and the effects of these analogue templates on T7 primase activity have been examined. The nucleosides employed include a novel pyrimidine derivative, 2-amino-5-(beta-2-deoxy-D-erythro-pentofuranosyl)pyridine (d2APy), whose synthesis is described. Template sites containing d2APy in place of the cryptic dC support oligoribonucleotide synthesis whereas those containing 3-deaza-2'-deoxycytidine (dc(3)C) and 5-methyl-6-oxo-2'-deoxycytidine (dm(5ox)C) substitutions do not, suggesting that the N3 nitrogen of cytidine is used for a critical interaction by the enzyme. Recognition sites containing 4-amino-1-(beta-2-deoxy-D-erythro-pentofuranosyl)-5-methyl-2,6[1H, 3H]-pyrimidione (dm(3)2P) or 2'-deoxyuridine (dU) substitutions for dT support oligoribonucleotide synthesis whereas those containing 5-methyl-4-pyrimidinone 2'-deoxyriboside (d(2H)T) substitutions do not, suggesting the importance of Watson-Crick interactions at this template residue. Template sites containing 7-deaza-2'-deoxyguanosine (dc(7)G) or 2'-deoxyinosine (dI) in place of dG support oligoribonucleotide synthesis. The reduced extent to which dc(7)G is successful within the template suggests a primase-DNA interaction. Inhibition studies suggest that the primase enzyme binds "null" substrates but cannot initiate RNA synthesis.     

Uncoupling two functions of the U1 small nuclear ribonucleoprotein particle during in vitro splicing.

To probe functions of the U1 small nuclear ribonucleoprotein particle (snRNP) during in vitro splicing, we have used unusual splicing substrates which replace the 5' splice site region of an adenovirus substrate with spliced leader (SL) RNA sequences from Leptomonas collosoma or Caenorhabditis elegans. In agreement with previous results (J.P. Bruzik and J.A. Steitz, Cell 62:889-899, 1990), we find that oligonucleotide-targeted RNase H destruction of the 5' end of U1 snRNA inhibits the splicing of a standard adenovirus splicing substrate but not of the SL RNA-containing substrates. However, use of an antisense 2'-O-methyl oligoribonucleotide that disrupts the first stem of U1 snRNA as well as stably sequestering positions of U1 snRNA involved in 5' and 3' splice site recognition inhibits the splicing of both the SL constructs and the standard adenovirus substrate. The 2'-O-methyl oligoribonucleotide is no more effective than RNase H pretreatment in preventing pairing of U1 with the 5' splice site, as assessed by inhibition of psoralen cross-link formation between the SL RNA-containing substrate and U1. The 2'-O-methyl oligoribonucleotide does not alter the protein composition of the U1 monoparticle or deplete the system of essential splicing factors. Native gel analysis indicates that the 2'-O-methyl oligoribonucleotide inhibits splicing by diminishing the formation of splicing complexes. One interpretation of these results is that removal of the 5' end of U1 inhibits base pairing in a different way than sequestering the same sequence with a complementary oligoribonucleotide. Alternatively, our data may indicate that two elements near the 5' end of U1 RNA normally act during spliceosome assembly; the extreme 5' end base pairs with the 5' splice site, while the sequence or structural integrity of stem I is essential for some additional function. It follows that different introns may differ in their use of the repertoire of U1 snRNP functions.     

Nonspecific deadenylation on sarcin/ricin domain RNA catalyzed by gelonin under acidic conditions

Gelonin is a single-chain ribosome-inactivating protein that can hydrolyze the glycosidic bond of a highly conserved adenosine residue in the sarcin/ricin domain (SRD) of the largest RNA in ribosome and thus irreversibly inhibit protein synthesis. Recently, the specificity in substrate recognition was challenged by the fact that gelonin could remove adenines from some other oligoribonucleotide substrates. However, the site specificity of gelonin to deadenylate various substrates were unknown. Hereby, the effect of pH values upon site specificity of the deadenylation activity of gelonin was studied using the synthetic oligoribonucleotide (named SRD RNA) that mimicked the ribosomal SRD. Interestingly, gelonin gradually acquired the ability to nonspecifically remove adenines from SRD RNA when pH values changed from neutral to acidic conditions. Another two SRD RNA mutants, either with the conserved adenosine deleted or with the tetraloop converted, showed very similar cleavage style to wild-type SRD RNA, underscoring the important role of pH value in site specificity of recognition by gelonin. Furthermore, the RNA N-glycosidase activity of gelonin was also enhanced with the decreasing of pH values. In addition, no obvious change was observed in the molecular conformation of gelonin at various pH values. Taken together, our data implied that the protonation of adenosines in SRD RNA was potentially an important factor for the nonspecific deadenlyation by gelonin.     

An apparent deletion of an oligonucleotide detected by RNA fingerprint in the nondiabetogenic B variant of encephalomyocarditis virus is caused by a point mutation.

The diabetogenic D variant of encephalomyocarditis virus (EMC-D) was previously shown to be different from the nondiabetogenic B variant of encephalomyocarditis virus (EMC-B) by a single spot in an oligonucleotide fingerprint after RNase T1 digestion of their genomic RNAs. An oligoribonucleotide was missing from EMC-B but was present in EMC-D. The oligoribonucleotide specific to EMC-D was isolated from a two-dimensional polyacrylamide gel and sequenced as 5'-ACAAUCUCACUUUUCCAACAACAG-3'. Molecular hybridizations of EMC-D and EMC-B genomic RNAs with a DNA primer complementary to the EMC-D-specific oligoribonucleotide revealed that the absence of a corresponding spot in EMC-B was due to a point mutation rather than a deletion. By sequencing a cloned cDNA of EMC-B corresponding to the EMC-D-specific oligoribonucleotide, the point mutation was identified as a G for EMC-B and an A for EMC-D transversion at base 9 of the oligonucleotide. Comparative sequence analysis of eight randomly picked RNA segments around the EMC-D-specific oligoribonucleotide revealed that there were no base changes between EMC-D and EMC-B. It is concluded that the diabetogenic EMC-D viral genome differs from the nondiabetogenic EMC-B viral genome by at least a point mutation.     

Ribosomal RNA identity elements for ricin A-chain recognition and catalysis. Analysis with tetraloop mutants.

Ricin is a cytotoxic protein that inactivates ribosomes by hydrolyzing the N-glycosidic bond between the base and the ribose of the adenosine at position 4324 in eukaryotic 28 S rRNA. Ricin A-chain will also catalyze depurination in naked prokaryotic 16 S rRNA; the adenosine is at position 1014 in a GAGA tetraloop. The rRNA identity elements for recognition by ricin A-chain and for the catalysis of cleavage were examined using synthetic GAGA tetraloop oligoribonucleotides. The RNA designated wild-type, an oligoribonucleotide (19-mer) that approximates the structure of the ricin-sensitive site in 16 S rRNA, and a number of mutants were transcribed in vitro from synthetic DNA templates with phage T7 RNA polymerase. With the wild-type tetraloop oligoribonucleotide the ricin A-chain-catalyzed reaction has a Km of 5.7 microM and a Kcat of 0.01 min-1. The toxin alpha-sarcin, which cleaves the phosphodiester bond on the 3' side of G4325 in 28 S rRNA, does not recognize the tetraloop RNA, although alpha-sarcin does affect a larger synthetic oligoribonucleotide that has a 17-nucleotide loop with a GAGA sequence; thus, there is a clear divergence in the identity elements for the two toxins. Mutants were constructed with all of the possible transitions and transversions of each nucleotide in the GAGA tetraloop; none was recognized by ricin A-chain. Thus, there is an absolute requirement for the integrity of the GAGA sequence in the tetraloop. The helical stem of the tetraloop oligoribonucleotide can be reduced to three base-pairs, indeed, to two base-pairs if the temperature is decreased, without affecting recognition; the nature of these base-pairs does not influence recognition or catalysis by ricin A-chain. If the tetraloop is opened so as to form a GAGA-containing hexaloop, recognition by ricin A-chain is lost. This suggests that during the elongation cycle, a GAGA tetraloop either exists or is formed in the putative 17-member single-stranded region of the ricin domain in 28 S rRNA and this bears on the mechanism of protein synthesis.     

AarI,a restriction endonuclease from Arthrobacter aurescens SS2-322, which recognizes the novel non-palindromic sequence 5'-CACCTGC(N)4/8-3'

A new type II restriction endonuclease AarI has been isolated from Arthrobacter aurescens SS2-322. AarI recognizes the non-palindromic heptanucleotide sequence 5'-CACCTGC(N)4/8-3' and makes a staggered cut at the fourth and eighth bases downstream of the target duplex producing a four base 5'-protruding end. AarI activity is stimulated by oligodeoxyribonucleotide duplexes containing an enzyme-specific recognition sequence.     

New approach to automated synthesis of oligoribonucleotides

The combination of 2'-OH protection in ribonucleosides by the p-nitrophenylethylsulfonyl (NPES) group with the 3'-(beta-cyanoethyl) (N,N-diisopropyl)-phosphoramidite function reveals a new approach to oligoribonucleotide synthesis. The corresponding adenosine and guanosine derivatives have been applied to automated solid phase synthesis with good success.     

Mammalian cell processing of a unique uracil residue in simian virus 40 DNA.

The processing of a unique uracil in DNA has been studied in mammalian cells. A synthetic oligodeoxyribonucleotide carrying a potential Bgl II restriction site, where one base has been substituted with a uracil, was inserted in the early intron of SV40 genome. Various heteroduplexes were constructed in such a manner that the restitution of an active Bgl II restriction site corresponds in each case to the specific substitution of the uracil by one of the four bases normally present in the DNA. DNA cuts by this restriction enzyme in one or several constructed heteroduplexes immediately determine the type of base pair substitution produced at the site of the U residue. When the uracil is inserted opposite a purine it is fully repaired; when facing a guanine it is replaced by a cytosine and opposite an adenine it is replaced by a thymine. These results indicate the error-free repair of uracil when it appears in the cell with the usual mechanisms such as cytosine deamination or incorporation of dUTP in place of dTTP during replication. When the uracil is inserted opposite a pyrimidine no error free repair at all is detected for U:C or U:T mismatches. It appears, moreover, that in approximately 18% of the cases U:T mismatch leads to a C:G base pairing. In the majority of the U:pyrimidine mismatches, mutations occur in the vicinity of the uracil, including base substitutions and frameshifts by addition of one or several bases.     

The synthesis and functional evaluation of RNA and DNA polymers having the sequence of Escherichia coli tRNA(fMet)

Stepwise, solid-phase chemical synthesis has provided long RNA and DNA polymers related to the sequence of Escherichia coli tRNA(fMet). The 34-ribonucleotide oligomer corresponding to the sequence of the 5'-half tRNA molecule has been synthesized and then characterized by gel purification, terminal nucleotide determinations and sequence analysis. This 34-nucleotide oligomer serves as an acceptor in the RNA-ligase-catalyzed reaction with a phosphorylated 43-ribonucleotide oligomer corresponding to the sequence of the 3'-half molecule of tRNA(fMet). The DNA molecule having the sequence of tRNA(fMet) is a 76-deoxyribonucleotide oligomer with a 3'-terminal riboadenosine residue and all U residues replaced by T. These polymers have been compared with an oligodeoxyribonucleotide lacking all 2'-hydroxyl groups except for the 3'-terminal 2'-OH, an oligoribonucleotide lacking modified nucleosides and E. coli tRNA(fMet). The all-RNA 77-nucleotide oligomer can be aminoacylated by E. coli methionyl-tRNA synthetase preparation from E. coli with methionine and threonylated in the A37 position using a yeast extract. In agreement with work by Khan and Roe using tDNA(Phe) and tDNA(Lys), the rA77-DNA(fMet) can be aminoacylated, and preliminary evidence suggests that it can be threonylated to a small extent. Kinetic data support the notion that aminoacylation of tRNA(fMet) does not depend on the presence of 2'-hydroxyl groups with the exception of that in the 3'-terminal nucleotide.     

A new affinity reagent for the site-specific, covalent attachment of DNA to active-site nucleophiles: application to the EcoRI and RsrI restriction and modification enzymes.

A modified oligodeoxyribonucleotide duplex containing an unnatural internucleotide trisubstituted 3' to 5' pyrophosphate bond in one strand [5'(oligo1)3'-P(OCH3)P-5'(oligo2) 3'] reacts with nucleophiles in aqueous media by acting as a phosphorylating affinity reagent. When interacted with a protein, a portion of the oligonucleotide [--P-5'(oligo2)3'] becomes attached to an amino acid nucleophilic group through a phosphate of the O-methyl-modified pyrophosphate linkage. We demonstrate the affinity labeling of nucleophilic groups at the active sites of the EcoRI and RsrI restriction and modification enzymes with an oligodeoxyribonucleotide duplex containing a modified scissile bond in the EcoRI recognition site. With the EcoRI and RsrI endonucleases in molar excess approximately 1% of the oligonucleotide becomes attached to the protein, and with the companion methyltransferases the yield approaches 40% for the EcoRI enzyme and 30% for the RsrI methyltransferase. Crosslinking proceeds only upon formation of a sequence-specific enzyme-DNA complex, and generates a covalent bond between the 3'-phosphate of the modified pyrophosphate in the substrate and a nucleophilic group at the active site of the enzyme. The reaction results in the elimination of an oligodeoxyribonucleotide remnant that contains the 3'-O-methylphosphate [5'(oligo1)3'-P(OCH3)] derived from the modified phosphate of the pyrophosphate linkage. Hydrolysis properties of the covalent protein-DNA adducts indicate that phosphoamide (P-N) bonds are formed with the EcoRI endonuclease and methyltransferase.     

Oligoribonucleotide synthesis by use of the 2-(methylthio)-phenylthiomethyl (MPTM) group

The 2-(methylthio)phenylthiomethyl (MPTM) group was developed as a new type of 2'-hydroxyl protecting group in oligoribonucleotide synthesis. The building monomer units of uridine and cytidine for the phosphotriester approach were synthesized from 2'-O-(1,3-benzodithiol-2-yl)-3',5'-O- (1,1,3,3-tetraisopropyldisiloxan-1,3-diyl)uridine and successfully utilized for the synthesis of CpUpG.     

The structure of cytidilyl(2',5')adenosine when bound to pancreatic ribonuclease S

The three-dimensional structure of the RNase S complex with the synthetic dinucleoside monophosphate cytidilyl(2′,5′)adenosine(C₂,p₅,A) is determined using difference Fourier techniques at 2.0 Å resolution in conjunction with computer graphic model-building and energy minimization. The latter has been carried out as a function of the rigid body parameters of the dinucleoside monophosphate and the dihedral angles of the nucleoside portion as well as of relevent amino acids in the active site of the enzyme.The bound dinucleoside monophosphate is found to assume an extended conformation, with the adenine and cytidine bases nearly perpendicular. The bases form specific hydrogen bonds with groups in the active site. Although the atoms involved in the recognition of the pyrimidine base by the enzyme are the same as in the pyrimidine bases of UMP, CMP and UpcA, the details of the binding are different. The adenosine moiety blocks most of the various positions that His119 occupies in the native enzyme and forces it into one well-defined position. One of the His119 ring protons is in contact with O(5′) (the leaving group), O(1′) of the adenine ribose and with a free phosphoryl oxygen. No strong charge contacts with the phosphate group are observed.We show how combining X-ray data with computer graphic model-building, electron density fitting and energy calculations leads to the model we propose and discuss in detail the enzyme-nucleic acid interactions.     

NMR structural refinement of an extrahelical adenosine tridecamer d(CGCAGAATTCGCG)2 via a hybrid relaxation matrix procedure

Until very recently interproton distances from NOESY experiments have been derived solely from the two-spin approximation method. Unfortunately, even at short mixing times, there is a significant error in many of these distances. A complete relaxation matrix approach employing a matrix eigenvalue/eigenvector solution to the Bloch equations avoids the approximation of the two-spin method. We have calculated the structure of an extrahelical adenosine tridecamer oligodeoxyribonucleotide duplex, d(CGCAGAATTCGCG)2, by an iterative refinement approach using a hybrid relaxation matrix method combined with restrained molecular dynamics calculations. Distances from the 2D NOESY spectra have been calculated from the relaxation rate matrix which has been evaluated from a hybrid NOESY volume matrix comprising elements from the experiment and those calculated from an initial structure. The hybrid matrix derived distances have then been used in a restrained molecular dynamics procedure to obtain a new structure that better approximates the NOESY spectra. The resulting partially refined structure is then used to calculate an improved theoretical NOESY volume matrix which is once again merged with the experimental matrix until refinement is complete. Although the crystal structure of the tridecamer clearly shows the extrahelical adenosine looped out way from the duplex, the NOESY distance restrained hybrid matrix/molecular dynamics structural refinement establishes that the extrahelical adenosine stacks into the duplex.     

Cryptic branch point activation allows accurate in vitro splicing of human beta-globin intron mutants

The excised introns of pre-mRNAs and intron-containing splicing intermediates are in a lariat configuration in which the 5' end of the intron is linked by a 2'-5' phosphodiester bond (RNA branch) to a single adenosine residue near the 3' end of the intron. To determine the role of the specific sequence surrounding the RNA branch, we have mutated the branch point sequence of the human beta-globin IVS1. Pre-mRNAs lacking the authentic branch point sequence are accurately spliced in vitro; processing of the mutant pre-mRNAs generates RNA lariats due to the activation of cryptic branch points within IVS1. The cryptic branch points always occur at adenosine residues, but the sequences surrounding the branched nucleotide vary. Regardless of the type of mutation or the sequences remaining within IVS1, the cryptic branch points are 22 to 37 nucleotides upstream of the 3' splice site. These results suggest that RNA branch point selection is primarily based on a mechanism that measures the distance from the 3' splice site.     

Polypyrimidine tract sequences direct selection of alternative branch sites and influence protein binding.

IVS1, an intron derived from the rat fibronectin gene, is spliced inefficiently in vitro, involving the use of three alternative branch sites. Mutation of one branch point site, BP3, so as to increase complementarity to U2 snRNA resulted in exclusive use of that site and improved splicing efficiency, indicating that the wild type BP3 site is one determinant of poor IVS1 splicing. Deletions within the polypyrimidine tract had a variable effect on splicing efficiency and altered the pattern of branch site usage. Selection of each branch site was influenced negatively by purine substitutions ca. 20 nucleotides downstream. It is proposed that all three IVS1 branch sites are pyrimidine tract-dependent. Pyrimidine tract deletions also influenced the crosslinking of PTB (the polypyrimidine tract-binding protein), hnRNP C, and splicing factor U2AF65. All three proteins bound preferentially to distinct regions within the polypyrimidine tract and thus are candidates for mediating pyrimidine tract-dependent branch site selection. The findings indicate the complexity of the IVS1 polypyrimidine tract and suggest a crucial role for this region in modulating branch site selection and IVS1 splicing.