Genetic studies on the role of octopine T-DNA border regions in crown gall tumor formation

Summary Crown gall tumors result from transfer and integration of the T-DNA from the Ti plasmid of Agrobacterium tumefaciens into plant nuclear DNA. In the present study, recombinant plasmids containing deletion and rearrangement deriviatives of the T-DNA region of the octopine Ti plasmid pTiA6 were tested in a binary tumorigenesis system (Hoekema et al. 1983) to determine the requirements for T-DNA border regions in tumor formation. Since two defined segments of the T-DNA region of octopine Ti plasmids can be detected in tumor DNA (the left (T_L-) and right (T_R-) DNA), four border regions exist in this Ti plasmid. Agrobacteria harboring plasmid constructs which contain a T-DNA gene capable of inciting tumors (gene 4, the tmr gene, which is involved in cytokinin biosynthesis) and various T-DNA border regions were tested for ability to cause tumors on Nicotiana glauca and other host plants. Such tmr constructs containing as their only border region the right border of either the T_L-DNA or the T_R-DNA are fully tumorigenic. Analogous tmr constructs containing only the T_L-DNa left border region are not tumorigenic. These results do not depend on the orientation or position of the single border with respect to the tmr gene; furthermore, the T_R-DNA right border can confer tumor-forming ability despite the presence of an intervening copy of the T_L-DNA left border.These results for relatively small plasmids are contrasted with previously determined requirements for border regions in tumorigenesis by intact Ti plasmids. A model previously proposed by Wang et al. (1984) for the role of border regions in DNA transfer to plant cells is extended in order to explain the tumor-forming ability of plasmid constructs containing a single border region. The results of this study interpreted according to the model suggest that the octopine T_L-DNA left border is defective in this DNA-transfer process.     

Overdrive, a T-DNA transmission enhancer on the A. tumefaciens tumour-inducing plasmid

During crown gall tumorigenesis a specific segment of the Agrobacterium tumefaciens tumour-inducing (Ti) plasmid, the T-DNA, integrates into plant nuclear DNA. Similar 23-bp direct repeats at each end of the T region signal T-DNA borders, and T-DNA transmission (transfer and integration) requires the right-hand direct repeat. A chemically synthesized right border repeat in its wild-type orientation promotes T-DNA transmission at a low frequency; Ti plasmid sequences which normally flank the right repeat greatly stimulate the process. To identify flanking sequences required for full right border activity, we tested the activity of a border repeat surrounded by different amounts of normal flanking sequences. Efficient T-DNA transmission required a conserved sequence (5' TAAPuTPy-CTGTPuT-TGTTTGTTTG 3') which lies to the right of the two known right border repeats. In either orientation, a synthetic oligonucleotide containing this conserved sequence greatly stimulated the activity of a right border repeat, and a deletion removing 15 bp from the right end of this sequence destroyed it stimulatory effect. Thus, wild-type T-DNA transmission required both the 23-bp right border repeat and a conserved flanking sequence which we call overdrive.     

Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from agrobacterium to the plant genome

We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid.     

Gene note. Complete nucleotide sequence of the T-DNA region of the plant tumour-inducing Agrobacterium tumefaciens Ti plasmid pTiC58

The complete nucleotide sequence has been determined of the T-DNA region from the plant tumour-inducing Agrobacterium tumefaciens nopaline Ti plasmid pTiC58. The T-DNA itself consists of 24 782 bp flanked by two direct 25 bp repeats, the border sequences. In addition, 3622 bp located at the left and 1070 bp at the right of the T-DNA borders were sequenced. Twenty-two open reading frames that code for proteins larger than 125 amino acids have been identified.Key words: Agrobacterium tumefaciens, sequence, T-DNA.      

Function of heterologous and pseudo border repeats in T region transfer via the octopine virulence system of Agrobacterium tumefaciens

The successful transfer of the Ti plasmid T region to the plant cell is mediated by its 24 bp border repeats. Processing of the T-region prior to transfer to the plant cell is started at the right border repeat and is stimulated by a transfer enhancer sequence called overdrive. Left and right border repeats differ somewhat in nucleotide sequence; moreover, the repeats of different Ti and Ri plasmids are slightly different. Our data indicate that these differences do not have a significant influence on border activity. However, the overdrive sequence is essential for the efficient transfer of a T region via an octopine transfer system. Our data suggest that an overdrive sequence must also be present next to the right border repeats of the nopaline Ti plasmid and the agropine of octopine and nopaline Ti plasmids express some differences in T-DNA processing activities. of cotopine and nopaline Ti plasmids express some differences in T-DNA processing activities.Furthermore, we demonstrate that certain pseudo border repeats, sequences that resemble the native 24 bp border repeat and naturally occur within the octopine Ti plasmid T-region, are able to mediate T region transfer to the plant cell, albeit with much reduced efficiency as compared to wild-type border repeats.     

Genetic analysis of integration mediated by single T-DNA borders.

Transformation of plant cells by the T-DNA of the Ti plasmid of Agrobacterium tumefaciens depends in part upon a sequence adjacent to the right T-DNA end. When this sequence is absent, the T-DNA is almost avirulent; when it is present, DNA between it and the left T-DNA border region becomes integrated in plants. To investigate further this process of DNA transfer and integration, we introduced the right border region and the nopaline synthase (nos) gene of plasmid pTiC58 into a variety of new positions around Ti plasmids. The border region functioned when separated from the remainder of the T-DNA by almost 50 kilobases. It also worked when placed outside of the T-DNA region where there were no known left-border sequences with which to interact. Indeed, the nos gene could be transferred to plants even when no other Ti plasmid sequences were present on the same plasmid. These results may indicate that the sequence requirements for the left borders are not as stringent as those for the right borders. In addition, mutants with an extra copy of the right border region within their T-DNA were found to transfer or integrate only parts of the bacterial T-DNA region. It is possible that abnormally placed T-DNA borders interfere with the normal process of DNA transfer, integration, or both.     

Deviating T-DNA transfer fromAgrobacterium tumefaciens to plants

We analyzed 29 T-DNA inserts in transgenicArabidopsis thaliana plants for the junction of the right border sequences and the flanking plant DNA. DNA sequencing showed that in most lines the right border sequences transferred had been preserved during integration, corroborating literature data. Surprisingly, in four independent transgenic lines a complete right border repeat was present followed by binary vector sequences. Cloning of two of these T-DNA inserts by plasmid rescue showed that in these lines the transferred DNA consisted of the complete binary vector sequences in addition to the T-region. On the basis of the structure of the transferred DNA we propose that in these lines T-DNA transfer started at the left-border repeat, continued through the vector part, passed the right border repeat, and ended only after reaching again this left-border repeat.     

T-DNA vector backbone sequences are frequently integrated into the genome of transgenic plants obtained by Agrobacterium-mediated transformation

Transgenic Arabidopsis and tobacco plants (125) derived from seven Agrobacterium-mediated transformation experiments were screened by polymerase chain reaction and DNA gel blot analysis for the presence of vector `backbone' sequences. The percentage of plants with vector DNA not belonging to the T-DNA varied between 20% and 50%. Neither the plant species, the explant type used for transformation, the replicon type nor the selection seem to have a major influence on the frequency of vector transfer. Only the border repeat sequence context could have an effect because T-DNA vector junctions were found in more than 50% of the plants of three different transformation series in which T-DNAs with octopine borders without inner border regions were used. Strikingly, many transgenic plants contain vector backbone sequences linked to the left T-DNA border as well as vector junctions with the right T-DNA border. DNA gel blots indicate that in most of these plants the complete vector sequence is integrated. We assume that integration into the plant genome of complete vector backbone sequences could be the result of a conjugative transfer initiated at the right border and subsequent continued copying at the left and right borders, called read-through. This model would imply that the left border is not frequently recognized as an initiation site for DNA transfer and that the right border is not efficiently recognized as a termination site for DNA transfer.     

Agrobacterium-mediated barley (Hordeum vulgare L.) transformation using green fluorescent protein as a visual marker and sequence analysis of the T-DNA∝barley genomic DNA junctions

Agrobacterium-mediated barley transformation promises many advantages compared to alternative gene transfer methods, but has so far been established in only a few laboratories. We describe a protocol that facilitates rapid establishment and optimisation of Agrobacterium-mediated transformation for barley by instant monitoring of the transformation success. The synthetic green fluorescent protein (sgfpS65T) reporter gene was introduced in combination with thehpt selectable marker gene into immature embryos of barley (Hordeum vulgare L.) by cocultivation with Agrobacterium tumefaciens strain AGLO harboring binary vector pYF133. Using green fluorescent protein (GFP) as a non-destructive visual marker allowed us to identify single-cell recipients of T-DNA at an early stage, track their fate and evaluate factors that affect T-DNA delivery. GFP screening was combined with a low level hygromycin selection. Consequently, transgenic plantlets ready to transfer to soil were obtained within 50 days of explant culture. Southern blot- and progeny segregation analyses revealed a single copy T-DNA insert in more than half of the transgenic barley plants. T-DNA/barley genomic DNA junctions were amplified and sequenced. The right T-DNA ends were highly conserved and clustered around the first 4 nucleotides of the right 25 bp border repeat, while the left T-DNA ends were more variable, located either in the left 25 bp border repeat or within 13 bp from the left repeat. T-DNAs were transferred from Agrobacterium to barley with exclusion of vector sequence suggesting a similar molecular T-DNA transfer mechanism as in dicotyledonous plants.     

Insights into recognition of the T-DNA border repeats as termination sites for T-strand synthesis by Agrobacterium tumefaciens

The recognition of the T-DNA left border (LB) repeat is affected by its surrounding sequences. Here, the LB regions were further characterized by molecular analysis of transgenic plants, obtained after Agrobacterium tumefaciens-mediated transformation with T-DNA vectors that had been modified in this LB region. At least the 24-bp LB repeat by itself was insufficient to terminate the T-strand synthesis. Addition of the natural inner and/or outer border regions to at least the LB repeat, even when present at a distance, enhanced the correct recognition of the LB repeat, reducing the number of plants containing vector backbone sequences. In tandem occurrence of both the octopine and nopaline LB regions with their repeats terminated the T-strand synthesis most efficiently at the LB, yielding a reproducibly high number of plants containing only the T-DNA. Furthermore, T-strand synthesis did not terminate efficiently at the right border (RB) repeat, which might indicate that signals in the outer RB region inhibit the termination of T-strand synthesis at the RB repeat.     

The promoter proximal region in the virD locus of Agrobacterium tumefaciens is necessary for the plant-inducible circularization of T-DNA

Summary The formation of crown gall tumours involves the transfer of the T-DNA region of the Ti plasmid from Agrobacterium to plant cells and its subsequent integration into plant chromosomes. When agrobacteria are incubated with plant protoplasts or exudates of plants, the T-DNA region is circularized by recombination or cleavage and rejoining between the 25 bp terminal repeats; the formation of circular T-DNAs is thought to be one step in T-DNA transfer (Koukolikova-Nicola et al. 1985; Machida et al. 1986). We previously showed that the virulence region of the Ti plasmid is required for T-DNA circularization. In the present paper, we examined the circularization event in agrobacteria harbouring octopine Ti plasmids with mutations in various loci of the virulence region. The results clearly demonstrate that the gene(s) encoded in the virD locus are necessary for T-DNA circularization. In particular, the gene(s) present in the region proximal to the virD promoter are essential. We propose that roduct(s) of this gene have recombinase or endonuclease activity which specifically recognizes the 25 bp terminal repeats of T-DNA.     

T-DNA integration patterns in transgenic tobacco plants

To investigate the various integration patterns of T-DNA generated by infection withAgrobacterium, we developed a vector (pRCV2) for the effective T-DNA tagging and applied it to tobacco (Nicotiana tabacum cv. Havana SR1). pRCV2 was constructed for isolating not only intact T-DNA inserts containing both side borders of T-DNA, but also for partial T-DNA inserts that comprise only the right or left side. We also designed PCR confirmation primer sets that can amplify in several important regions within pRCV2 to detect various unpredictable integration patterns. These can also be used for the direct inverse PCR. Leaf disks of tobacco were transformed withAgrobacterium tumefaciens LBA4404 harboring pRCV2. PCR and Southern analysis revealed the expected 584 bp product for thehpt gene as well as one of 600 bp for thegus gene in all transformants; one or two copies were identified for these integrated genes. Flanking plant genomic DNA sequences from the transgenic tobacco were obtained via plasmid rescue and then sequenced. Abnormal integration patterns in the tobacco genome were found in many transgenic lines. Of the 17 lines examined, 11 contained intact vector backbone; a somewhat larger deletion of the left T-DNA portion was encountered in 4 lines. Because nicking sites at the right border showed irregular patterns when the T-DNA was integrated, it was difficult to predict the junction regions between the vector and the flanking plant DNA.     

A T-DNA transfer stimulator sequence in the vicinity of the right border of pRi8196

An 8 bp sequence repeated 6 times is present to the right of the mannopine type pRi8196 T-DNA righ-border sequence. Experiments were designed to test whether these repeats have a role in T-DNA transfer. Several constructs in which different lengths of pRi8196 right-border region were linked to the cucumopine synthesis gene on anAgrobacterium-Escherichia coli shuttle vector were made. The recombinant plasmids were tested for their efficiency to act as a source of T-DNA in a binary system in which a wild-type Ri plasmid provided virulence and root-inducing functions. The T-DNA transfer efficiency of the constructs was assessed by computing the relative frequency of roots containing cucumopine. Depending on the Ri plasmid used as source of virulence functions, a high level of T-DNA transfer was observed only if 6 (pRi8196) or 5 (pRiA4) repeats were present. These results were confirmed by looking for single-stranded T-DNA molecules (T-strands) in bacteria induced for virulence. The repetition of the 8 bp unit was named T-DNA transfer stimulator sequence (TSS).     

Transgene integration in aspen: structures of integration sites and mechanism of T-DNA integration

To obtain insight into the mechanism of transferred DNA (T-DNA) integration in a long-lived tree system, we analysed 30 transgenic aspen lines. In total, 27 right T-DNA/plant junctions, 20 left T-DNA/plant junctions, and 10 target insertions from control plants were obtained. At the right end, the T-DNA was conserved up to the cleavage site in 18 transgenic lines (67%), and the right border repeat was deleted in nine junctions. Nucleotides from the left border repeat were present in 19 transgenic lines out of 20 cases analysed. However, only four (20%) of the left border ends were conserved to the processing end, indicating that the T-DNA left and right ends are treated mechanistically differently during the T-DNA integration process. Comparison of the genomic target sites prior to integration to the T-DNA revealed that the T-DNA inserted into the plant genome without any notable deletion of genomic sequence in three out of 10 transgenic lines analysed. However, deletions of DNA ranging in length from a few nucleotides to more than 500 bp were observed in other transgenic lines. Filler DNAs of up to 235 bp were observed on left and/or right junctions of six transgenic lines, which in most cases originated from the nearby host genomic sequence or from the T-DNA. Short sequence similarities between recombining strands near break points, in particular for the left T-DNA end, were observed in most of the lines analysed. These results confirm the well-accepted T-DNA integration model based on single-stranded annealing followed by ligation of the right border which is preserved by the VirD2 protein. However, a second category of T-DNA integration was also identified in nine transgenic lines, in which the right border of the T-DNA was partly truncated. Such integration events are described via a model for the repair of genomic double-strand breaks in somatic plant cells based on synthesis-dependent strand-annealing. This report in a long-lived tree system provides major insight into the mechanism of transgene integration.     

Genetic transformation of cocoa leaf cells using Agrobacterium tumefaciens

Leaf strips from cocoa tree (Theobroma cacao L.) clones ICS-16 and SIC-5 were cocultivated with the supervirulent Agrobacterium tumefaciens strain A281-Kan. A281-Kan contains a wild-type Ti plasmid and an additional plasmid, pGPTV-Kan, which confers kanamycin resistance to transformed plant cells after integration and expression of the neomycin phosphotransferase II (nptII) gene. Transformed cells were selected on callusing medium containing 100 g ml^-1 kanamycin. NptII assays confirmed that kanamycin-resistant cultures of ICS-16 and SIC-5 expressed the nptII gene, whereas control cultures did not. Genomic Southern blot analyses demonstrated single T-DNA insertions into ICS-16 and SIC-5. T-DNA/cocoa DNA border regions from transformed cultures were cloned and sequenced, revealing that in both transformed cell lines, the right T-DNA border was at the 5 end of the 25 bp right border repeat. Cocoa DNA probes from the T-DNA/cocoa DNA insertion sites were used in Southern blot analyses and showed that T-DNA from pGPTV-Kan had inserted into a unique region in ICS-16 and into a repetitive region in SIC-5. This study establishes that foreign genes can be inserted and expressed in cocoa using A. tumefaciens-mediated gene transfer.     

T-DNA is organized predominantly in inverted repeat structures in plants transformed with Agrobacterium tumefaciens C58 derivatives

Summary The detailed structural organization of DNA sequences transferred to the plant genome via Agrobacterium tumefaciens has been determined in 11 transgenic tomato plants that carry the transferred DNA (T-DNA) at a single genetic locus. The majority (seven) of these plants were found to carry multiple copies of T-DNA arranged in inverted repeat structures. Such a high frequency of inverted repeats among transgenotes has not been previously reported and appears to be characteristic of transformation events caused by C58/pGV3850 strains of Agrobacterium. The inverted repeats were found to be centered on either the left or the right T-DNA boundary and both types were observed at similar frequency. In several plants both types of inverted repeat were found to coexist in the same linear array of elements. Direct repeats were observed in two plants, each time at the end of an array of inverted repeat elements, and at a lower frequency than inverted repeats. The junctions between T-DNA elements and plant DNA sequences and the junctions between adjacent T-DNA elements were mapped in the same 11 plants, allowing the determination of the distribution of junction points at each end for both types of junction. Based on a total of 17 distinct junctions at the right end of T-DNA and 19 at the left end, the distribution of junction points was found to be much more homogeneous at the right end than at the left end. Left end junctions were found to be distributed over a 3 kb region of T-DNA with two thirds of the junctions within 217 bp of the left repeat. Two thirds of the right end junctions were found to lie within 11 bp of the right repeat with the rest more than 39 bp from the right repeat. T-DNA::plant DNA junctions and T-DNA::T-DNA inverted repeat junctions showed similar distributions of junction points at both right and left ends. The possibilities that T-DNA inverted repeats are unstable in plants and refractory to cloning in wild type Escherichia coli is discussed. Two distinct types of mechanisms for inverted repeat formation are contrasted, replication and ligation mechanisms.     

A plasmid rescue technique for the recovery of plant DNA disrupted by T-DNA insertion

Arabidopsis mutants generated by insertion of the T-DNA from Ti plasmid 3850∶1003 serve as a starting point for the isolation of novel genes. The disrupted plant DNA can be recovered using a plasmid rescue technique utilizing high efficiency electroporation. Rescued plasmids are resistant to ampicillin and contain an origin of replication from pBR322. Plasmids generated from either the left or right border of the T-DNA that carry flanking DNA sequences can be identified by analyzing the products of restriction enzyme digests on agarose gels. The plasmids with flanking sequences can then serve as a starting point for cloning plant sequences that share homology to the DNA at the point of T-DNA insertion.