Ribosomal RNA cistrons in Euglena gracilis

Euglena gracilis chloroplasts contain about 12 fg DNA of average density 1.686 g cm^?3 and 1.7 pg RNA. The large (1.1 × 10⁶ mol. wt) and small (0.56 × 10⁶ mol. wt) ribosomal RNA components are coded for by separate cistrons, both of which band at a density of 1.696 g cm^?3 in a CsCl gradient. About 6% of the chloroplast DNA codes for rRNA indicating that there are 240 cistrons for rRNA in each chloroplast or about three to six cistrons per chloroplast genome. Similar studies with rRNA from cytoplasmic ribosomes indicate that the cistrons for cytoplasmic rRNA band at a density of 1.716 g cm^?3, denser than that of the main-band DNA, and that there are 1000 cistrons for cytoplasmic rRNA per cell. Fractionation of E. gracilis DNA on CsCl gradients and subsequent hybridization experiments, as well as melting curves of DNA-RNA hybrids, show that chloroplast rRNA does not anneal specifically with either the cistrons for cytoplasmic rRNA or any DNA in the dark-grown cell, in contrast to those results found in some higher plants.     

Changing proportions of DNA components in Euglena gracilis

The ratios of satellite deoxyribonucleic acid components to chromosomal deoxyribonucleic acid in Euglena gracilis Z were measured by analytical density gradient ultracentrifugation. Chloroplast deoxyribonucleic acid with a buoyant density of 1.685 g/cm³ exhibited a constant ratio to chromosomal deoxyribonucleic acid during exponential growth and increased twofold as the culture reached the end of the exponential growth phase. The quantity of a satellite deoxyribonucleic acid with a buoyant density of 1.691 g/cm³ was not sufficient to measure the ratio to chromosomal deoxyribonucleic acid during exponential growth but increased to approximately equal the quantity of chloroplast deoxyribonucleic acid as the culture approached the end of the exponential growth phase. The quantity of a deoxyribonucleic acid component with a buoyant density of 1.700 g/cm³ was not sufficient to measure the ratio to chromosomal deoxyribonucleic acid during exponential growth but represented approximately one-third of the total deoxyribonucleic acid as the culture entered the stationary phase of growth.     

RNA:RNA interactions in the large subunit ribosomal RNA of Euglena gracilis

In Euglena gracilis, the cytoplasmic large subunit (LSU) rRNA is composed of 14 discrete small RNA species that must somehow interact in the functional ribosome. We have isolated native complexes of Euglena rRNA and show here that the largest of these complexes contains eight of the 14 LSU rRNA species. Several of these small rRNA species are able to associate in vitro to reform an isolated domain of LSU rRNA structure.     

Transfer RNA genes of Euglena gracilis chloroplast DNA

Summary Transfer RNA genes have been mapped to at least nine different loci on the physical map of the Euglena gracilis chloroplast genome. One of these loci in the ribosomal RNA operons is present three times per genome. The DNA sequences of six of the nine different loci, containing 21 different tRNA genes, have been determined. Genes corresponding to the amino acids Ala, Arg, Asn, Cys, Gln, Gly (2), Glu, His, Ile, Leu (2), Met (2), Phe, Ser, Thr, Trp, Tyr, Val, and one unassigned species have been identified. All genes except one are found in clusters of 2–6 genes. None of the known genes contains introns, nor codes for the 3-CCA terminus. In addition to these genes, two pseudo tRNA genes are present in the rDNA leader region.     

Analysis of the RNA of Euglena gracilis on polyacrylamide gels

Summary Five peaks of RNA from bleached Euglena gracilis are resolved by polyacrylamide-gel electrophoresis. The extraction of these RNA's and their subsequent resolution on gels is dependent upon pH and the presence of an RNase inhibitor (e.g., macaloid). Careful control of ionic strength also appears necessary. Inorganic phosphate is incorporated first by low molecular weight RNA, then by a high molecular weight RNA (hRNA) and a peak with a sedimentation coefficient of 13S, and then by rRNA.The electrophoretic pattern of RNA from Astasia longa is similar to that of bleached Euglena whereas that from wild-type Euglena is more complex and presumably reflects the presence of chloroplast RNA's in these latter cells.     

Euglena gracilis Chloroplast DNA Codes for Polyadenylated RNA

Polyadenylated RNA, isolated from total cellular RNA of photoautotrophically grown Euglena gracilis, comprised 2.1% of the total cellular RNA and contained 6.2% polyadenylic acid. Polyadenylated RNA, labeled in vitro with ¹²⁵I, hybridized at saturating levels to an average 7.7% of the chloroplast DNA. In the presence of excess chloroplast rRNA, hybridization of polyadenylated RNA was reduced, but was still observed at a level corresponding to 2.8% of the chloroplast DNA. Polyadenylic acid was not detected in mRNA prepared from chloroplast polyribosomes, indicating a level of less than 0.1% polyadenylic acid in mature chloroplast mRNA. Of the total RNA isolated from cytoplasmic polyribosomes, 2.0% contained polyadenylic acid. This latter polyadenylated RNA did not hybridize to chloroplast DNA.     

Chloroplast ribosomal RNA genes in the chloroplast DNA of Euglena gracilis

Euglena chloroplast DNA has a buoyant density in CsCI of 1.686. Shearing this DNA produces a satellite band at density 1.700. The satellite, easily lost during preparative CsCI gradient centrifugation of chloroplast DNA, contains the genes for chloroplast ribosomal RNA. Pure Euglena chloroplast DNA is shown to contain one set of ribosomal RNA genes for each 90 × 10⁶ daltons of DNA.     

Characterization of cytoplasmic and chloroplast ribosomal proteins of Euglena gracilis.

Active cytoplasmic ribosone subunits 41 and 62S were prepared by treatment with 0.1 mM puromycin in the presence of 265 mM KCl. Active chloroplast subunits 32 and 49S were obtained after dialysis of chloroplast ribosomal preparations against 1 mM Mg(2+)-containing buffer. Proteins from these different ribosomal particles were mapped by two-dimensional gel electrophoresis in the presence of urea. The 41S small cytoplasmic ribosomal subunit contains 33-36 proteins, the 62S large cytoplasmic ribosomal subunit contains 37-43, the 32S small chloroplast ribosomal subunit contains 22-24, and the 49ts large chloroplast ribosomal subunit contains 30-34 proteins. Since some proteins are lost during dissociation of monosomes into subunits, the 89S cytoplasmic monosome would have 73-83 proteins and the 68S chloroplast monosome, 56-60. The amino acid composition of ribosomal proteins shows differences between chloroplast and cytoplasmic ribosomes.     

The bacterial-like lactate shuttle components from heterotrophic Euglena gracilis

The structural and kinetic analyses of the components of the lactate shuttle from heterotrophic Euglena gracilis were carried out. Mitochondrial membrane-bound, NAD(+)-independent d-lactate dehydrogenase (d-iLDH) was purified by solubilization with CHAPS and heat treatment. The active enzyme was a 62-kDa monomer containing non-covalently bound FAD as cofactor. d-iLDH was specific for d-lactate and it was able to reduce quinones of different redox potential values. Oxalate and l-lactate were mixed-type inhibitors of d-iLDH. Mitochondrial l-iLDH also catalyzed the reduction of quinones, but it was inactivated during the extraction with detergents. Both l-iLDH and d-iLDH were inhibited by the specific flavoprotein-inhibitor diphenyleneiodonium, suggesting that l-iLDH was also a flavoprotein. Affinity chromatography revealed that the E. gracilis cytosolic fraction contained two types of NAD(+)-dependent LDH specific for the generation of d- and l-lactate (d-nLDH and l-nLDH, respectively). These two enzymes were tetramers of 126-132 kDa and showed an ordered bi-bi kinetic mechanism. Kinetic properties were different in both enzymes. Pyruvate reduction by d-nLDH was inhibited by its two products; the d-lactate oxidation was 40-fold lower than forward reaction. l-lactate oxidation by l-nLDH was not detected, whereas pyruvate reduction was activated by fructose-1, 6-bisphosphate, K(+) or NH(4)(+). Interestingly, membrane-bound l- and d-lactate dehydrogenases with quinone reductase activity have been only detected in bacteria, whereas the activity of soluble d-nLDH has been identified in bacteria and some yeast. Also, FBP-activated l-nLDH has been found solely in lactic bacteria. Based on their similar kinetic and structural characteristics, a possible common origin among bacterial and E. gracilis lactic dehydrogenase enzymes is discussed.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Heteroxanthin in Euglena gracilis

Summary 1. From a large scale preparation of Euglena gracilis, strain Z, besides the acetylenic pigments diatoxanthin and diadinoxanthin and the allene neoxanthin, an additional acetylenic xanthophyll has been isolated. 2. Mass and IR spectra and chemical reactions showed typical patterns of heteroxanthin from Vaucheria. 3. The pigment was transformed into diadinochrome-isomers with acidified acetone. 4. A partial synthesis of heteroxanthin from diadinoxanthin by LiAlH₄-reduction is described, confirming the structure proposed by Strain. 5. The identity of heteroxanthin with the trollein—like pigment described for Euglena is discussed.     

Proteolysis in Euglena gracilis

Endoproteolytic activities (EC 3.4.22. and 23.) of cell-free extracts of Euglena gracilis, measured by autolysis and azocaseinolysis, vary considerably during the culture growth cycle. They are high in the lag phase, drop sharply up to the mid-logarithmic phase, and then rise again reaching the initial high levels in the stationary phase. This pattern has been observed for both the soluble and the particulate proteolytic activities of four cell types differing with regard to the developmental state of the chloroplast: dark-grown, light-induced, and light-grown wild-type cells, as well as light-grown apoplastic W₃BUL mutant cells, all on a glucose-based medium. Therefore, the activity of the main intracellular proteinases is neither directly nor indirectly light-regulated, but seems to be controlled by the availability of nutrients. Endogenous inhibitors of proteinases could not be detected. Cysteine proteinase activity has been found in the soluble and the particulate fractions, but aspartic proteinase activity in the latter ones only. Different cysteine proteinases may be present in the two fractions, during the different growth phases, and in the four cell types studied.Abbreviations CBB Coomassie Brilliant Blue G-250 - DFP diisopropyl fluorophosphate - EDTA disodium ethylendiaminetetraacetic acid - E-64 l-transepoxysuccinyl-leucyl-amido(4-guanidino)butane - Iog phase logarithmic growth phase - MET 2-mercaptoethanol - PMSF phenylmethylsulfonyl fluoride - Z benzyloxycarbonyl Paper I of this series is Krauspe and Scheer (1986). A preliminary publication appeared (Krauspe et al. 1982)     

Comparative base compositions of chloroplast and cytoplasmic tRNAPhe''s from Euglena gracilis.

The nucleoside compositions of chloroplast and cytoplasmic tRNAPhe's from Euglena gracilis have been determined. The modified nucleoside compositions of these two tRNAs indicate that tRNAPheChl is more similar to procaryotic (E. coli) tRNAPhe than to either the Euglena cytoplasmic tRNAPhe or other eucaryotic cytoplasmic tRNAPhe's.     

Antimutagenicity in Euglena gracilis

The genotoxic effect of N-methyl-N′-nitro-N-nitrosoguanidine (MNNG) and furadantine (Fu) was significantly decreased by standard antimutagens (ascorbic acid, α-tocopherol, chlorophyllin and sodium selenite) in the unicellular flagellate Euglena gracilis. The effects of these compounds were verified also by a bacterial test in which three strains of Salmonella typhimurium, TA97, TA100 and TA102, were used. The above compounds were antimutagenic in strains of bacteria used, except for chlorophyllin which had no effect on strain TA102.