Two distinct recognition signals define the site of endonucleolytic cleavage at the 5''-end of yeast 18S rRNA.

Three of the four eukaryotic ribosomal RNA molecules (18S, 5.8S and 25-28S rRNA) are transcribed as a single precursor, which is subsequently processed into the mature species by a complex series of cleavage and modification reactions. Early cleavage at site A1 generates the mature 5'-end of 18S rRNA. Mutational analyses have identified a number of upstream regions in the 5' external transcribed spacer (5' ETS), including a U3 binding site, which are required in cis for processing at A1. Nothing is known, however, about the requirement for cis-acting elements which define the position of the 5'-end of the 18S rRNA or of any other eukaryotic rRNA. We have introduced mutations around A1 and analyzed them in vivo in a genetic background where the mutant pre-rRNA is the only species synthesized. The results indicate that the mature 5'-end of 18S rRNA in yeast is identified by two partially independent recognition systems, both defining the same cleavage site. One mechanism identifies the site of cleavage at A1 in a sequence-specific manner involving recognition of phylogenetically conserved nucleotides immediately upstream of A1 in the 5' ETS. The second mechanism specifies the 5'-end of 18S rRNA by spacing the A1 cleavage at a fixed distance of 3 nt from the 5' stem-loop/pseudoknot structure located within the mature sequence. The 5' product of the A1 processing reaction can also be identified, showing that, in contrast to yeast 5.8S rRNA, the 5'-end of 18S rRNA is generated by endonucleolytic cleavage.     

3'-end processing and kinetics of 5'-end joining during retroviral integration in vivo.

Retroviral replication depends on integration of viral DNA into a host cell chromosome. Integration proceeds in three steps: 3'-end processing, the endonucleolytic removal of the two terminal nucleotides from each 3' end of the viral DNA; strand transfer, the joining of the 3' ends of viral DNA to host DNA; and 5'-end joining (or gap repair), the joining of the 5' ends of viral DNA to host DNA. The 5'-end joining step has never been investigated, either for retroviral integration or for any other transposition process. We have developed an assay for 5'-end joining in vivo and have examined the kinetics of 5'-end joining for Moloney murine leukemia virus (MLV). The interval between 3'-end and 5'-end joining is estimated to be less than 1 h. This assay will be a useful tool for examining whether viral or host components mediate 5'-end joining. MLV integrates its DNA only after its host cell has completed mitosis. We show that the extent of 3'-end processing is the same in unsynchronized and aphidicolin-arrested cells. 3'-end processing therefore does not depend on mitosis.     

DNA substrate requirements for stable joint molecule formation by the RecA and single-stranded DNA-binding proteins of Escherichia coli

In reactions between linear single-stranded DNAs (ssDNAs) and circular double-stranded DNAs (dsDNAs), stable joint molecule formation promoted by the recA protein (RecA) requires negative superhelicity, a homologous end, and an RecA-ssDNA complex. Linear ssDNAs with 3'-end homology react more efficiently than linear ssDNAs with 5'-end homology. This 3'-end preference is explained by the finding that 3'-ends are more effectively coated by RecA than 5'-ends, as judged by exonuclease VII protection, and are thus more reactive. The ability of linear ssDNAs with 5'-end homology to react is improved by the presence of low concentrations of exonuclease VII. In reactions between ssDNAs and linear dsDNAs with end homology, stable joint molecule formation occurs more efficiently when the homology is at the 3'-end rather than at the 5'-end of the complementary strand. In addition, linear dsDNAs with homology at the 3'-end of the complementary strand react more efficiently with linear ssDNAs with 3'-end homology than with linear ssDNAs with 5'-end homology. The ability of linear ssDNAs with 5'-end homology to react, in the absence of single-stranded DNA-binding protein, is improved by adding 33-46 nucleotides of heterologous sequence to the 5'-end of the linear ssDNA. The poor reactivity of linear ssDNAs with 5'-end homology is explained by a lack of RecA at the 5'-ends of linear ssDNAs, which is a consequence of the polar association and dissociation of RecA.     

Sequence determination of rat U5 RNA using a chemical modification procedure for counteracting sequence compression

Using post-labeling techniques, the nucleotide sequence of a major species of U5 RNA isolated from rat liver was determined to be: XpppAmUmACUCUGGUUUCUCUUCAGAUCGUAUAAAUCUUUCGmCCUUmUpsiACmNAAAGAUpsiUCCGUGGAGAGGA ACAACUCUGAGUCUUAAACCAAUUUUUUGAGGCCUUGUCUUGA(G)CAAGGCUOH. The 5'-end of the RNA is blocked with a cap structure. In addition to the modified nucleotides around the 5'-end (XpppAmUmA), U5 RNA contains Gm at position 38, Um at position 42, psi at position 44, Cm at position 46, N at position 47, and psi at position 54 as modified nucleotides. U5 RNA is present as a mixture of several species with microheterogeneity, whose lengths are 117, 118, or 119 nucleotides. The major species, with 117 nucleotides, comprised approximately 60% of the total U5 RNA. A region near the 3'-end forms a stable second structure, which causes sequence compression on electrophoresis in polyacrylamide gel. To surmount with this obstacle, we developed a chemical modification procedure with sodium bisulfite prior to partial hydrolysis in formamide, which allows denaturation of the secondary structure in polyacrylamide gel containing 7 M urea. The procedure provides a good system for checking RNA sequences determined by electrophoresis in polyacrylamide gel which might have apparent deletions on account of sequence compression.     

Tissue-specific methylation patterns and expression of the human apolipoprotein AI gene.

To better understand the tissue-specific expression of the human apolipoprotein (apo)AI gene, we performed a detailed analysis of the pattern of methylation of the gene in various human adult and embryonic tissues and in tissues of transgenic mice harboring the human apo-AI gene. In addition, the gene was analyzed also in liver and intestine-derived human cell lines (HepG2 and Caco2, respectively). Using methyl-sensitive restriction enzymes (HpaII, HhaI, and SmaI) and the appropriate radioactive probes, we were able to determine separately the status of methylation of the 5'-end, the body of the gene, and 3'-end flanking sequences. The apo-AI gene in tissues that express the gene was undermethylated at the 5'-end. However, the 5'-end of the gene in sperm and in all adult tissues that do not express the gene was heavily methylated. The body of the gene which contains a CpG island and the 3'-end flanking sequences were, in general, hypomethylated except for specific sites that showed partial methylation. In contrast, while the gene showed tissue-specific expression already in a 12-week-old embryo, the 5'-end was invariably hypomethylated in all tissues of the embryo. A human apo-AI transgene has recently been shown to be active exclusively in the liver, while the endogenous gene is expressed in both liver and intestine (6). We show here that the 5'-end of the apo-AI transgene was methylated in all tissues of the mouse (including intestine) except liver. The results presented here demonstrate a clear correlation between hypomethylation of the 5'-end and activity of the apo-AI gene. However, the observed methylation pattern of the gene in embryonic tissues suggests that tissue-specific expression precedes formation of the tissue-specific methylation pattern.     

Sequence,chemical, and structural variation of small interfering RNAs and short hairpin RNAs and the effect on mammalian gene silencing

Small interfering RNAs (siRNAs) induce sequence-specific gene silencing in mammalian cells and guide mRNA degradation in the process of RNA interference (RNAi). By targeting endogenous lamin A/C mRNA in human HeLa or mouse SW3T3 cells, we investigated the positional variation of siRNA-mediated gene silencing. We find cell-type-dependent global effects and cell-type-independent positional effects. HeLa cells were about 2-fold more responsive to siRNAs than SW3T3 cells but displayed a very similar pattern of positional variation of lamin A/C silencing. In HeLa cells, 26 of 44 tested standard 21-nucleotide (nt) siRNA duplexes reduced the protein expression by at least 90%, and only 2 duplexes reduced the lamin A/C proteins to <50%. Fluorescent chromophores did not perturb gene silencing when conjugated to the 5'-end or 3'-end of the sense siRNA strand and the 5'-end of the antisense siRNA strand, but conjugation to the 3'-end of the antisense siRNA abolished gene silencing. RNase-protecting phosphorothioate and 2'-fluoropyrimidine RNA backbone modifications of siRNAs did not significantly affect silencing efficiency, although cytotoxic effects were observed when every second phosphate of an siRNA duplex was replaced by phosphorothioate. Synthetic RNA hairpin loops were subsequently evaluated for lamin A/C silencing as a function of stem length and loop composition. As long as the 5'-end of the guide strand coincided with the 5'-end of the hairpin RNA, 19-29 base pair (bp) hairpins effectively silenced lamin A/C, but when the hairpin started with the 5'-end of the sense strand, only 21-29 bp hairpins were highly active.     

Template requirement and initiation site selection by hepatitis C virus polymerase on a minimal viral RNA template

RNA-dependent RNA polymerase, NS5B protein, catalyzes replication of viral genomic RNA, which presumably initiates from the 3'-end. We have previously shown that NS5B can utilize the 3'-end 98-nucleotide (nt) X region of the hepatitis C virus (HCV) genome as a minimal authentic template. In this study, we used this RNA to characterize the mechanism of RNA synthesis by the recombinant NS5B. We first showed that NS5B formed a complex with the 3'-end of HCV RNA by binding to both the poly(U-U/C)-rich and X regions of the 3'-untranslated region as well as part of the NS5B-coding sequences. Within the X region, NS5B bound stem II and the single-stranded region connecting stem-loops I and II. Truncation of 40 nt or more from the 3'-end of the X region abolished its template activity, whereas X RNA lacking 35 nt or less from the 3'-end retained template activity, consistent with the NS5B-binding site mapped. Furthermore, NS5B initiated RNA synthesis from a specific site within the single-stranded loop I. All of the RNA templates that have a double-stranded stem at the 3'-end had the same RNA initiation site. However, the addition of single-stranded nucleotides to the 3'-end of X RNA or removal of double-stranded structure in stem I generated RNA products of template size. These results indicate that HCV NS5B initiates RNA synthesis from a single-stranded region closest to the 3'-end of the X region. These results have implications for the mechanism of HCV RNA replication and the nature of HCV RNA templates in the infected cells.     

Rat1p and Rai1p function with the nuclear exosome in the processing and degradation of rRNA precursors

Exoribonucleases function in the processing and degradation of a variety of RNAs in all organisms. These enzymes play a particularly important role in the maturation of rRNAs and in a quality-control pathway that degrades rRNA precursors upon inhibition of ribosome biogenesis. Strains with defects in 3'-5' exoribonucleolytic components of the RNA processing exosome accumulate polyadenylated precursor rRNAs that also arise in strains with ribosome biogenesis defects. These findings suggested that polyadenylation might target pre-rRNAs for degradation by the exosome. Here we report experiments that indicate a role for the 5'-3' exoribonuclease Rat1p and its associated protein Rai1p in the degradation of poly(A)(+) pre-rRNAs. Depletion of Rat1p enhances the amount of poly(A)(+) pre-rRNA that accumulates in strains deleted for the exosome subunit Rrp6p and decreases their 5' heterogeneity. Deletion of RAI1 results in the accumulation of poly(A)(+) pre-rRNAs, and inhibits Rat1p-dependent 5'-end processing and Rrp6p-dependent 3'-end processing of 5.8S rRNA. RAT1 and RAI1 mutations cause synergistic growth defects in the presence of rrp6-Delta, consistent with the interdependence of 5'-end and 3'-end processing pathways. These findings suggest that Rai1p may coordinate the 5'-end and 3'-end processing and degradation activities of Rat1p and the nuclear exosome.     

Effects of chaperones on mRNA stability and gene expression in Escherichia coli

Effects of chaperones on mRNA stability and gene expression were studied in order to develop an efficient Escherichia coli expression system that can maximize gene expression. The stability of mRNA was modulated by introducing various secondary structures at the 5'-end of mRNA. Four vector systems providing different 5'-end structures were constructed, and genes encoding GFPuv and endoxylanase were cloned into the four vector systems. Primer extension assay revealed different mRNA half-lives depending on the 5'-end secondary structures of mRNA. In addition to the stem-loop structure at the 5'-end of mRNA, coexpression of dnaK-dnaJ-grpE or groEL-groES, representative heat-shock genes in E. coli, increased the mRNA stability and the level of gene expression further, even though the degree of stabilization was varied. Our work suggests that some of the heat-shock proteins can function as mRNA stabilizers as well as protein chaperones.     

Assignment of chromosomal locus and evidence for alternatively spliced mRNAs of a human sperm membrane protein (hSMP-1).

The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.     

The role of the Brr5/Ysh1 C-terminal domain and its homolog Syc1 in mRNA 3'-end processing in Saccharomyces cerevisiae

The cleavage/polyadenylation factor (CPF) of Saccharomyces cerevisiae is thought to provide the catalytic activities of the mRNA 3'-end processing machinery, which include endonucleolytic cleavage at the poly(A) site, followed by synthesis of an adenosine polymer onto the new 3'-end by the CPF subunit Pap1. Because of similarity to other nucleases in the metallo-beta-lactamase family, the Brr5/Ysh1 subunit has been proposed to be the endonuclease. The C-terminal domain of Brr5 lies outside of beta-lactamase homology, and its function has not been elucidated. We show here that this region of Brr5 is necessary for cell viability and mRNA 3'-end processing. It is highly homologous to another CPF subunit, Syc1. Syc1 is not essential, but its removal improves the growth of other processing mutants at restrictive temperatures and restores in vitro processing activity to cleavage/ polyadenylation-defective brr5-1 extract. Our findings suggest that Syc1, by mimicking the essential Brr5 C-terminus, serves as a negative regulator of mRNA 3'-end formation.     

A simple method for 3'-labeling of RNA.

We describe a simple method for 3'-end labeling RNAs of known sequence. A short DNA template is designed to anneal to the 3'-end of the RNA, with a two nucleotide 5' overhang of 3'-TA-5', 3'-TG-5' or 3'-TC-5'. The Klenow fragment of DNA polymerase I can then cleanly and efficiently extend the 3'-end of the RNA by the incorporation of a single alpha-32P-labeled dATP residue. This method can be used to label one RNA in a mixture of RNAs, or to label 5'-blocked RNAs such as mRNA.     

A new technique to prevent self-ligation of DNA

The most widely used technique for preventing self-ligation (self-circularization and concatenation) of DNA is dephosphorylation of the 5'-end, which stops DNA ligase from catalyzing the formation of phosphodiester bonds between the 3'-hydroxyl and 5'-phosphate residues at the DNA ends. The 5'-dephosphorylation technique cannot be applied to both DNA species to be ligated and thus, the untreated DNA species remains capable of self-ligation. To prevent this self-ligation, we replaced the 2'-deoxyribose at the 3'-end of the untreated DNA species with a 2',3'-dideoxyribose. Self-ligation was prevented at the replaced 3'-end, while the 5'-phosphate remaining at the 5'-end permitted ligation with the 3'-hydroxyl end of the 5'-dephosphorylated DNA strand. We successfully applied this 3'-replacement technique to gene cloning, adapter-mediated polymerase chain reaction and messenger RNA fingerprinting. The 3'-replacement technique is simple and not restricted by sequence or conformation of the DNA termini and is thus applicable to a wide variety of methods involving ligation.     

Accessible 5'-end of CpG-containing phosphorothioate oligodeoxynucleotides is essential for immunostimulatory activity

In our ongoing efforts to decipher the sequence and structural requirements in the flanking region of the CpG motif in phosphorothioate oligodeoxynucleotides (PS-oligos), we have examined the requirement of free 5'- and 3'-ends of PS-oligos on immune stimulation. Our model studies using 3'-3'-linked (containing two free 5'-ends) and 5'-5'-linked (containing two free 3'-ends) CpG-containing PS-oligos demonstrate that immunostimulatory activity is significantly reduced when the 5'-end of the PS-oligo is not accessible, rather than the 3'-end, suggesting that the 5'-end plays a critical role in immunostimulatory activity.