Nontemplate Polymerization of Free Nucleotides Into Genetic Elements by Thermophilic DNA Polymerase in vitro

DNA synthesis is the cornerstone of all life forms and is required to replicate and restore the genetic information. Usually, DNA synthesis is carried out only by DNA polymerases semiconservatively to copy preexisting DNA templates. We report here that DNA strands were synthesized ab initio in the absence of any DNA or RNA template by thermophilic DNA polymerases at (a) a constant high temperature (74°C), (b) alternating temperatures (94°C/60°C/74°C), or (c) physiological temperatures (37°C). The majority of the ab initio synthesized DNA represented short sequence blocks, repeated sequences, intergenic spacers, and other unknown genetic elements. These results suggest that novel DNA elements could be synthesized in the absence of a nucleic acid template by thermophilic DNA polymerases in vitro. Biogenesis of genetic information by thermophilic DNA polymerase-mediated nontemplate DNA synthesis may explain the origin of genetic information and could serve as a new way of biosynthesis of genetic information that may have facilitated the evolution of life.

Supplemental materials are available for this article. Go to the publisher's online edition of Nucleosides, Nucleotides, and Nucleic Acids to view the free supplemental file.     

Creation of genetic information by DNA polymerase of the thermophilic bacterium Thermus thermophilus.

Genetic information encoded in a template of a genome is replicated in a complementary way by DNA polymerase or RNA polymerase with high fidelity; no creation of information occurs in this reaction unless an error occurs. We report here that DNA polymerase of the thermophilic bacterium Thermus thermophilus can synthesize up to 200 kb linear double-stranded DNA in vitro in the complete absence of added primer and template DNAs, indicating that genetic information is actively created by protein. This ab initio DNA synthesis occurs at 74 degrees C and requires magnesium ion. There is a lag time of approximately 1 h and then the reaction proceeds linearly. The synthesized DNAs have a variety of sequences; they are mostly tandem repetitive sequences, e.g. (CATGTATA) n , (TGTATGTATACATACATA) n and (TATACGTA) n . Some degenerate sequences of these basic repeat units are also found. The similar repetitive sequences are found in many natural genes. These results, together with similar results found using DNA polymerase of archaeon Thermococcus litoralis , suggest that creative, non-replicative synthesis of DNA by protein was a driving force for diversification of genetic information at a certain stage of the evolution of life on the early earth.     

Creation of genetic information by DNA polymerase of the archaeon Thermococcus litoralis: influences of temperature and ionic strength.

DNA polymerase of the archaeon Thermococcus litoralis can synthesize a long stretch of linear double-stranded DNA in the complete absence of added primer and template DNAs. This finding suggests that genetic information can potentially be created by protein. We report here the effects of temperature, ionic strength and pH on this ab initio DNA synthesis by the protein in vitro . When the temperature of the reaction was changed, the sequence of the product DNA changed markedly. For instance, the reaction products were (TAAT) n at 69 degrees C, (TATCCGGA) n at 84 degrees C and (TATCGCGATAGCGATCGC) n at 89 degrees C. The ionic strength of the reaction condition also affected the sequence: it was (TATCTAGA) n with 0 mM KCl, (TATATACG) n with 50 mM KCl and (TATAGTTATAAC) n with 100 mM KCl at 74 degrees C. When the pH of the reaction condition was changed from 6.8 to 10.8, the size of the product DNA decreased, but its sequence did not. These results demonstrate that DNA synthesized ab initio by DNA polymerase of T.litoralis is markedly influenced by the reaction conditions. The results also suggest that genetic information that might have been created by protein on the early earth is strongly influenced by environmental factors.     

Cooperation between catalytic and DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases

We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases.     

Coordinated leading and lagging strand synthesis during SV40 DNA replication in vitro requires PCNA

Proliferating cell nuclear antigen (PCNA) is a cell cycle and growth regulated protein required for replication of SV40 DNA in vitro. Its function was investigated by comparison of the replication products synthesized in its presence or absence. In the completely reconstituted replication system that contains PCNA, DNA synthesis initiates at the origin and proceeds bidirectionally on both leading and lagging strands around the template DNA to yield duplex, circular daughter molecules. In contrast, in the absence of PCNA, early replicative intermediates containing short nascent strands accumulate. Replication forks continue bidirectionally from the origin, but surprisingly, only lagging strand products are synthesized. Thus two stages of DNA synthesis have been defined, with the second stage requiring PCNA for coordinated leading and lagging strand synthesis at the replication fork. We suggest that during eukaryotic chromosome replication there is a switch to a PCNA-dependent elongation stage that requires two distinct DNA polymerases.     

A DNA polymerase from a thermoacidophilic archaebacterium: evolutionary and technological interests

The archaebacteria constitute a group of prokaryotes with an intermediate phylogenetic position between eukaryotes and eubacteria. The study of their DNA polymerases may provide valuable information about putative evolutionary relationships between prokaryotic and eukaryotic DNA polymerases. As a first step towards this goal, we have purified to near homogeneity a DNA polymerase from the thermoacidophilic archaebacterium Sulfolobus acidocaldarius. This enzyme is a monomeric protein of 100 kDa which can catalyze DNA synthesis using either activated calf thymus DNA or oligonucleotide-primed single-stranded DNA as a template. The activity is optimal at 70 degrees C and the enzyme is thermostable up to 80 degrees C; however, it can still polymerize up to 200 nucleotides at 100 degrees C. These remarkable thermophilic properties and thermostability permit examination of the mechanism of DNA synthesis under conditions of decreased stability of the DNA helix. Furthermore, these properties make S. acidocaldarius DNA polymerase a very efficient enzyme to be used in DNA amplification by the recently developed polymerase chain reaction method (PCR) as well as in the Sanger DNA sequencing technique.     

Thermostable DNA polymerases can perform translesion synthesis using 8-oxoguanine and tetrahydrofuran-containing DNA templates

The translesion synthesis (TLS) capacity of the thermostable DNA polymerases Taq, Tte and Tte-seq utilizing a synthetic abasic site, tetrahydrofuran (THF), and an 8-oxoguanine-containing DNA template was investigated. Measurements with human DNA polymerase beta were used as a "positive control". Thermostable DNA polymerases were observed to perform TLS with different specificities on both substrates. With a THF-containing template, dGMP was preferentially inserted by all the DNA polymerases. In the presence of Mn(II) as a cofactor, all the polymerases incorporated dCMP opposite 8-oxoguanine whereas, in the presence of Mg(II) ions, dAMP was incorporated. It was found that none of the thermophilic DNA polymerases utilized dTTP with either an 8-oxoguanine or a THF-containing template. In all cases, DNA duplex containing THF as damage was processed to full length less effectively than DNA duplex containing 8-oxoguanine.     

Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease

We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.     

Strand annealing and terminal transferase activities of a B-family DNA polymerase

DNA replication polymerases have the inherent ability to faithfully and rapidly copy a DNA template according to precise Watson-Crick base pairing. The primary B-family DNA replication polymerase (Dpo1) in the hyperthermophilic archaeon, Sulfolobus solfataricus, is shown here to possess a remarkable DNA stabilizing ability for maintaining weak base pairing interactions to facilitate primer extension. This thermal stabilization by Dpo1 allowed for template-directed synthesis at temperatures more than 30 °C above the melting temperature of naked DNA. Surprisingly, Dpo1 also displays a competing terminal deoxynucleotide transferase (TdT) activity unlike any other B-family DNA polymerase. Dpo1 is shown to elongate single-stranded DNA in template-dependent and template-independent manners. Experiments with different homopolymeric templates indicate that initial deoxyribonucleotide incorporation is complementary to the template. Rate-limiting steps that include looping back and annealing to the template allow for a unique template-dependent terminal transferase activity. The multiple activities of this unique B-family DNA polymerase make this enzyme an essential component for DNA replication and DNA repair for the maintenance of the archaeal genome at high temperatures.     

Factors affecting fidelity of DNA synthesis during PCR amplification of d(C-A)n.d(G-T)n microsatellite repeats.

The susceptibility of microsatellite DNA sequences to insertions and deletions in vivo makes them useful for genetic mapping and for detecting genomic instability in tumors. An in vitro manifestation of this instability is the production of undesirable frameshift products during amplification of (dC-dA)n x (dG-dT)n microsatellites in the polymerase chain reaction (PCR). These products differ from the primary product by multiples of 2 nucleotides. We have tested the hypothesis that factors known to affect the fidelity of DNA synthesis may affect (dC-dA)n x (dG-dT)n frameshifting during the PCR. Neither modifications of pH, dNTP concentration, and Mg++ concentration using Amplitaq, nor the use of thermophilic DNA polymerases including UITma, Pfu, Vent and Deep Vent significantly decreased the production of frameshift products during amplification. However, 3'-->5' exonuclease activity in thermophilic DNA polymerases inhibited the accumulation of PCR products containing non-templated 3' terminal nucleotides. Most interestingly, extension temperatures of 37 degrees C during amplification using the thermolabile DNA polymerases Sequenase 1.0, Sequenase 2.0, and 3'-->5' exonuclease-deficient Klenow fragment greatly decreased the production of frameshift products. This method can improve the resolution of heterozygous or mutant (dC-dA)n x (dG-dT)n alleles differing in size by one or two repeat units.     

Role of yeast Rad5 and its human orthologs,HLTF and SHPRH in DNA damage tolerance

In the yeast Saccharomyces cerevisiae, the Rad6–Rad18 DNA damage tolerance pathway constitutes a major defense system against replication fork blocking DNA lesions. The Rad6–Rad18 ubiquitin-conjugating/ligase complex governs error-free and error-prone translesion synthesis by specialized DNA polymerases, as well as an error-free Rad5-dependent postreplicative repair pathway. For facilitating replication through DNA lesions, translesion synthesis polymerases copy directly from the damaged template, while the Rad5-dependent damage tolerance pathway obtains information from the newly synthesized strand of the undamaged sister duplex. Although genetic data demonstrate the importance of the Rad5-dependent pathway in tolerating DNA damages, there has been little understanding of its mechanism. Also, the conservation of the yeast Rad5-dependent pathway in higher order eukaryotic cells remained uncertain for a long time. Here we summarize findings published in recent years regarding the role of Rad5 in promoting error-free replication of damaged DNA, and we also discuss results obtained with its human orthologs, HLTF and SHPRH.     

Highly accurate synthesis of the fully 2′-fluoro-modified oligonucleotide by Therminator DNA polymerases

Oligonucleotides composed of natural nucleotides are inapplicable for biotechnical and therapeutic use due to its instability under biological conditions. Therminator DNA polymerases, mutant DNA polymerases of thermophilic marine archaea, show that they can efficiently synthesize fully 2′-fluoro-modified (2′F-) oligonucleotides. Furthermore, the sequence analysis reveals that the oligonucleotide sequence is highly accurate, especially the fidelity of a 2′F-oligonucleotide synthesized by Therminator II is more accurate than that of natural RNA synthesized by conventional RNA polymerase. These finding would be helpful for the synthesis of chemically modified oligonucleotides, for the use of biotechnical or medical applications.     

Xeroderma pigmentosum variant and error-prone DNA polymerases

Replicative DNA synthesis is a faithful event which requires undamaged DNA and high fidelity DNA polymerases. If unrepaired damage remains in the template DNA during replication, specialised low fidelity DNA polymerases synthesises DNA past lesions (translesion synthesis, TLS). Current evidence suggests that the polymerase switch from replicative to translesion polymerases might be mediated by post-translational modifications involving ubiquitination processes. One of these TLS polymerases, polymerase eta carries out TLS past UV photoproducts and is deficient in the variant form of xeroderma pigmentosum (XP-V). The dramatic proneness to skin cancer of XP-V individuals highlights the importance of this DNA polymerase in cancer avoidance. The UV hypermutability of XP-V cells suggests that, in the absence of a functional poleta, UV-induced lesions are bypassed by inaccurate DNA polymerase(s) which remain to be identified.     

Assembly of DNA polymerase delta and epsilon holoenzymes depends on the geometry of the DNA template.

To study in details the assembly of DNA polymerases delta and epsilon holoenzymes a circular double-stranded DNA template containing a gap of 45 nucleotides was constructed. Both replication factor C and proliferating cell nuclear antigen were absolutely required and sufficient for assembly of DNA polymerase delta holoenzyme complex on DNA. On such a circular DNA substrate replication protein A (or E. coli single-strand DNA binding protein) was neither required for assembly of DNA polymerase delta holoenzyme complex nor for the gap-filling reaction. A circular structure of the DNA substrate was found to be absolutely critical for the ability of auxiliary proteins to interact with DNA polymerases. The linearization of the circular DNA template resulted in three dramatic effects: (i) DNA synthesis by DNA polymerase delta holoenzyme was abolished, (ii) the inhibition effect of replication factor C and proliferating cell nuclear antigen on DNA polymerase alpha was relieved and (iii) DNA polymerase epsilon could not form any longer a holoenzyme with replication factor C and proliferating cell nuclear antigen. The comparison of the effect of replication factor C and proliferating cell nuclear antigen on DNA polymerases alpha, delta and epsilon indicated that the auxiliary proteins appear to form a mobile clamp, which can easily slide along double-stranded DNA.     

Initiation of enzymatic DNA synthesis by yeast RNA polymerase I.

In vitro DNA synthesis by yeast DNA polymerase I can be initiated by partially purified yeast RNA polymerases in the presence or absence of rNTPs. Homogeneous yeast RNA polymerase I initiates DNA synthesis by yeast DNA polymerase I on single-stranded DNA templates only in the presence of all four rNTPs. A protein capable of initiating enzymatic DNA synthesis on single-stranded DNA in the absence of rNTPs has also been separated from partially purified yeast RNA polymerase I fractions. Analysis of the RNA polymerase I initiated replication products of phage fd DNA on alkaline sucrose gradients showed noncovalent linkage between the newly synthesized DNA and the template. Isopycnic analyses of the ribonucleotide initiated fd DNA replication products demonstrated covalent linkage between the initiator RNA and newly synthesized DNA. Results from 32P-transfer experiments confirmed the covalent linkage between RNA and DNA chains and showed the presence of all four ribo- and deoxyribonucleotides at the RNA--DNA junctions. The ribonucleotide found most frequently at the RNA--DNA junction is uridylate and the purine deoxynucleotides occur more frequently than pyrimidine deoxynucleotides.     

Three DNA polymerases of rat ascites hepatoma cells: properties of the enzymes and effect of RNA synthesis on the reactions.

Three different DNA polymerases have been isolated from rat ascites hepatoma cells [1--3]. The molecular weight of a DNA polymerase (polymerase C) purified from the soluble fraction of the cells was estimated to be 142 000 by sedimentation on a sucrose gradient, while the molecular weights of two DNA polymerases (polymerase P-1 and P-2) purified from nuclear membrane-chromatin fraction were estimated to be 117 000 and 44 000, respectively, by the same method. Under certain conditions, the poly (dT) strand of poly[(dA)-(dT)] was copied well by the polymerases, especially by the nuclear polymerases. Poly (dC) was a good template for the high molecular weight DNA polymerases C and P-1, but poly(dT) and poly(dA) were not effective templates. By addition of complementary oligoribonucleotides, the single-stranded deoxypolymers were copied by the high molecular weight polymerases C and P-1. When single-stranded fd phage DNA was used as template, the polymerization reactions by the high molecular weight polymerases were stimulated by the concomitant synthesis of RNA. This indicates that the oligoribonucleotide acts as a primer in these reactions.     

Examining the potential role of DNA polymerases eta and zeta in triplet repeat instability in yeast

Triplet repeats undergo frequent mutations in human families afflicted with certain neurodegenerative diseases and also in model organisms. Although the molecular mechanisms of triplet repeat instability are still being identified, it is likely that aberrant DNA synthesis plays an important role. Many DNA polymerases stall at triplet repeat sequences, probably due to the adoption of unusual DNA secondary structures. One possible mechanism to explain triplet repeat contractions is that a triplet repeat hairpin on the template strand inhibits replicative polymerases and that one or more bypass polymerases are recruited for synthesis past the hairpin. If the translesion synthesis is mutagenic, contractions can be generated. To address this possibility, Saccharomyces cerevisiae strains lacking either pol zeta (rev7), pol eta (rad30), or both were tested for trinucleotide repeat (TNR) contractions using three separate, sensitive genetic assays. If these bypass polymerases are important for mutagenesis, then the mutants should show a reduction in the contraction rate. Two genetic tests for triplet repeat contractions showed no significant change for the mutants compared to wild type. A third assay showed a five-fold reduction in contraction rates due to pol eta ablation. Despite this modest decrease, the overall contraction rate was still high, indicating that many deletions still occur in the absence of both polymerases. Expansion rates were also unaffected in the mutant strains. These results indicate that, in yeast, pol eta and pol zeta most likely have little role in triplet repeat mutagenesis.