Thermodynamic and kinetic basis for the relaxed DNA sequence specificity of "promiscuous" mutant EcoRI endonucleases

Promiscuous mutant EcoRI endonucleases produce lethal to sublethal effects because they cleave Escherichia coli DNA despite the presence of the EcoRI methylase. Three promiscuous mutant forms, Ala138Thr, Glu192Lys and His114Tyr, have been characterized with respect to their binding affinities and first-order cleavage rate constants towards the three classes of DNA sites: specific, miscognate (EcoRI*) and non-specific. We have made the unanticipated and counterintuitive observations that the mutant restriction endonucleases that exhibit relaxed specificity in vivo nevertheless bind more tightly than the wild-type enzyme to the specific recognition sequence in vitro, and show even greater preference for binding to the cognate GAATTC site over miscognate sites. Binding preference for EcoRI* over non-specific DNA is also improved. The first-order cleavage rate constants of the mutant enzymes are normal for the cognate site GAATTC, but are greater than those of the wild-type enzyme at EcoRI* sites. Thus, the mutant enzymes use two mechanisms to partially bypass the multiple fail-safe mechanisms that protect against cleavage of genomic DNA in cells carrying the wild-type EcoRI restriction-modification system: (a) binding to EcoRI* sites is more probable than for wild-type enzyme because non-specific DNA is less effective as a competitive inhibitor; (b) the combination of increased affinity and elevated cleavage rate constants at EcoRI* sites makes double-strand cleavage of these sites a more probable outcome than it is for the wild-type enzyme. Semi-quantitative estimates of rates of EcoRI* site cleavage in vivo, predicted using the binding and cleavage constants measured in vitro, are in accord with the observed lethal phenotypes associated with the three mutations.     

Residues of E. coli topoisomerase I conserved for interaction with a specific cytosine base to facilitate DNA cleavage

Bacterial and archaeal topoisomerase I display selectivity for a cytosine base 4 nt upstream from the DNA cleavage site. Recently, the solved crystal structure of Escherichia coli topoisomerase I covalently linked to a single-stranded oligonucleotide revealed that R169 and R173 interact with the cytosine base at the −4 position via hydrogen bonds while the phenol ring of Y177 wedges between the bases at the −4 and the −5 position. Substituting R169 to alanine changed the selectivity of the enzyme for the base at the −4 position from a cytosine to an adenine. The R173A mutant displayed similar sequence selectivity as the wild-type enzyme, but weaker cleavage and relaxation activity. Mutation of Y177 to serine or alanine rendered the enzyme inactive. Although mutation of each of these residues led to different outcomes, R169, R173 and Y177 work together to interact with a cytosine base at the −4 position to facilitate DNA cleavage. These strictly conserved residues might act after initial substrate binding as a Molecular Ruler to form a protein–DNA complex with the scissile phosphate positioned at the active site for optimal DNA cleavage by the tyrosine hydroxyl nucleophile to facilitate DNA cleavage in the reaction pathway.     

Role of the protein in the DNA sequence specificity of the cleavage site stabilized by the camptothecin topoisomerase IB inhibitor: a metadynamics study

Camptothecin (CPT) is a topoisomerase IB (TopIB) selective inhibitor whose derivatives are currently used in cancer therapy. TopIB cleaves DNA at any sequence, but in the presence of CPT the only stabilized protein–DNA covalent complex is the one having a thymine in position −1 with respect to the cleavage site. A metadynamics simulation of two TopIB–DNA–CPT ternary complexes differing for the presence of a thymine or a cytosine in position −1 indicates the occurrence of two different drug’s unbinding pathways. The free-energy difference between the bound state and the transition state is large when a thymine is present in position −1 and is strongly reduced in presence of a cytosine, in line with the different drug stabilization properties of the two systems. Such a difference is strictly related to the changes in the hydrogen bond network between the protein, the DNA and the drug in the two systems, indicating a direct role of the protein in determining the specificity of the cleavage site sequence stabilized by the CPT. Calculations carried out in presence of one compound of the indenoisoquinoline family (NSC314622) indicate a comparable energy difference between the bound and the transition state independently of the presence of a thymine or a cytosine in position −1, in line with the experimental results.     

Characterization of an altered DNA catalysis of a camptothecin-resistant eukaryotic topoisomerase I.

We investigated topoisomerase I activity at a specific camptothecin-enhanced cleavage site by use of a partly double-stranded DNA substrate. The cleavage site belongs to a group of DNA topoisomerase I sites which is only efficiently cleaved by wild-type topoisomerase I (topo I-wt) in the presence of camptothecin. With a mutated camptothecin-resistant form of topoisomerase I (topo I-K5) previous attempts to reveal cleavage activity at this site have failed. On this basis it was questioned whether the mutant enzyme has an altered DNA sequence recognition or a changed rate of catalysis at the site. Utilizing a newly developed assay system we demonstrate that topo I-K5 not only recognizes and binds to the strongly camptothecin-enhanced cleavage site but also has considerable cleavage/religation activity at this particular DNA site. Thus, topo I-K5 has a 10-fold higher rate of catalysis and a 10-fold higher affinity for DNA relative to topo I-wt. Our data indicate that the higher cleavage/religation activity of topo I-K5 is a result of improved DNA binding and a concomitant shift in the equilibrium between cleavage and religation towards the religation step. Thus, a recently identified point mutation which characterizes the camptothecin-resistant topo I-K5 has altered the enzymatic catalysis without disturbing the DNA sequence specificity of the enzyme.     

The role of lysine 532 in the catalytic mechanism of human topoisomerase I

Based on co-crystal structures of human topoisomerase I with bound DNA, Lys(532) makes a minor groove contact with the strongly preferred thymidine residue at the site of covalent attachment (-1 position). Replacement of Lys(532) with either arginine or alanine has essentially no effect on the sequence preference of the enzyme, indicating that this interaction is not required for the preference for a T at the -1 position. Although both the cleavage and religation activities of the K532R mutant enzyme are reduced, cleavage is reduced to a greater extent than religation. The reverse is true for the K532A mutant enzyme with religation so impaired that the nicked intermediate accumulates during plasmid relaxation assays. Consistent with the shift in the cleavage religation equilibrium toward cleavage for the K532A mutant enzyme, expression of the mutant enzyme in Saccharomyces cerevisiae is cytotoxic, and thus this mutant enzyme mimics the effects of the anticancer drug camptothecin. Cleavage assays with the mutant enzymes using an oligonucleotide containing a 5'-bridging phosphorothiolate indicate that Lys(532) functions as a general acid during cleavage to protonate the leaving 5'-oxygen. It is possible that the contact with the -1 base is important during catalysis to provide positional rigidity to the active site. The corresponding residues in the vaccinia virus topoisomerase and the tyrosine recombinases may have similar critical roles in catalysis.     

Induction of cleavage in topoisomerase I c-DNA by topoisomerase I enzymes from calf thymus and wheat germ in the presence and absence of camptothecin.

In this study, we further examined the sequence selectivity of camptothecin in mammalian topoisomerase I cDNA from human and Chinese hamster. In the absence of camptothecin, almost all the bases at the 3'-terminus of cleavage sites are T for calf thymus and wheat germ topoisomerase I. In addition, wheat germ topoisomerase I exhibits preference for C (or not T) at -3 and for T at -2 position. As for camptothecin-stimulated cleavage with topoisomerase I, G (or not T) at +1 is an additional strong preference. This sequence selectivity of camptothecin is similar to that previously found in SV40 DNA, suggesting that camptothecin preferentially interacts with topoisomerase I-mediated cleavage sites where G is the base at the 5'-terminus. These results support the stacking model of camptothecin (Jaxel et al. (1991) J. Biol. Chem. 266, 20418-20423). Comparison of calf thymus and wheat germ topoisomerase I-mediated cleavage sites in the presence of camptothecin shows that many major cleavage sites are similar. However, the relative intensities are often different. One of the differences was attributable to a bias at position -3 where calf thymus topoisomerase I prefers G and wheat germ topoisomerase I prefers C. This difference may explain the unique patterns of cleavage sites induced by the two enzymes. Sequencing analysis of camptothecin-stimulated cleavage sites in the surrounding regions of point mutations in topoisomerase I cDNA, which were found in camptothecin-resistant cell lines, reveals no direct relationship between DNA cleavage sites in vitro and mutation sites.     

Effect of local DNA sequence on topoisomerase I cleavage in the presence or absence of camptothecin.

In order to investigate the mechanism of topoisomerase I inhibition by camptothecin, we studied the induction of DNA cleavage by purified mammalian DNA topoisomerase I in a series of oligonucleotides and analyzed the DNA sequence locations of preferred cleavage sites in the SV40 genome. The oligonucleotides were derived from the sequence of the major camptothecin-induced cleavage site in SV40 DNA (Jaxel, C., Kohn, K. W., and Pommier, Y. (1988) Nucleic Acids Res. 16, 11157 to 11170) with the cleaved bond in their center. DNA length was critical since cleavage was detectable only in 30 and 20 base pair-(bp) oligonucleotides, but not in a 12-bp oligonucleotide. Cleavage was at the same position in the oligonucleotides as in SV40 DNA. Its intensity was greater in the 30- than in the 20-bp oligonucleotide, indicating that sequences more than 10 bp away from the cleavage site may influence intensity. Camptothecin-induced DNA cleavage required duplex DNA since none of the single-stranded oligonucleotides were cleaved. Analysis of base preferences around topoisomerase I cleavage sites in SV40 DNA indicated that camptothecin stabilized topoisomerase I preferentially at sites having a G immediately 3' to the cleaved bond. Experiments with 30-bp oligonucleotides showed that camptothecin produced most intense cleavage in a complementary duplex having a G immediately 3' to the cleavage site. Weaker cleavage was observed in a complementary duplex in which the 3'G was replaced with a T. The identity of the 3' base, however, did not affect topoisomerase I-induced DNA cleavage in the absence of drug. These results indicate that camptothecin traps preferentially a subset of the enzyme cleavage sites, those having a G immediately 3' to the cleaved bond. This strong preference suggests that camptothecin binds reversibly to the DNA at topoisomerase I cleavage sites, in analogy to a model previously proposed for inhibitors of topoisomerase II (Capranico, G., Kohn, K.W., and Pommier, Y. (1990) Nucleic Acids Res. 18, 6611-6619).     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Conformational properties of topoisomerase II inhibitors and sequence specificity of DNA cleavage

The sequence specificity of topoisomerase-II-mediated DNA cleavage, stimulated by 2-methyl-9-hydroxy ellipticinium and 4′, 5′,7-trihydroyflavone (genistein) was investigated by sequencing analysis of DNA cleavage sites and molecular modeling techniques. The former drug exhibits a marked preference for a T base at the position immediately preceding the cleavage site (?1). The latter shares the preference for the same base, with an additional preference for a thymine at position +1. The cleavage intensity patterns for the two drugs differ considerably. From a conformational point of view, ellipticinium and genistein exhibit similar overall shape and dimensions. However, the fused ring system in the former generates a planar structure whereas the single bond, connecting the two aromatic portions in the latter, allows internal rotation. The most stable conformation of genistein corresponds to a deviation of about 40° from planarity. A computer-assisted analysis was carried out to compare the steric and electrostatic properties of the two compounds. Two types of preferred (energetically almost degenerate) alignment for the two molecules were found. One corresponds to overlapping of the 9-hydroxyl containing ring of ellipticinium with the 4′-hydroxyphenyl moiety of genistein, the other envisages the same moiety of ellipticine superimposed to the hydroxyl-benzopyrone portion of genistein. The structural similarities of the test drugs might account for the common preference for stimulation of DNA cleavage at position +1, whereas the different possible arrangements of genistein in the cleavable complex could explain both the additional +1 specificity exhibited by this compound and the differences in cleavage intensity patterns observed in comparison to ellipticinium.     

Clerocidin interacts with the cleavage complex of Streptococcus pneumoniae topoisomerase IV to induce selective irreversible DNA damage

Clerocidin (CL), a diterpenoid natural product, alkylates DNA through its epoxide moiety and exhibits both anticancer and antibacterial activities. We have examined CL action in the presence of topoisomerase IV from Streptococcus pneumoniae. CL promoted irreversible enzyme-mediated DNA cleavage leading to single- and double-stranded DNA breaks at specific sites. Reaction required the diterpenoid function: no cleavage was seen using a naphthalene-substituted analogue. Moreover, drug-induced DNA breakage was not observed using a mutant topoisomerase IV (ParC Y118F) unable to form a cleavage complex with DNA. Sequence analysis of 102 single-stranded DNA breaks and 79 double-stranded breaks revealed an overwhelming preference for G at the −1 position, i.e. immediately 5′ of the enzyme DNA scission site. This specificity contrasts with that of topoisomerase IV cleavage with antibacterial quinolones. Indeed, CL stimulated DNA breakage by a quinolone-resistant topoisomerase IV (ParC S79F). Overall, the results indicate that topoisomerase IV facilitates selective irreversible CL attack at guanine and that its cleavage complex differs markedly from that of mammalian topoisomerase II which promotes both irreversible and reversible CL attack at guanine and cytosine, respectively. The unique ability to form exclusively irreversible DNA breaks suggests topoisomerase IV may be a key intracellular target of CL in bacteria.     

Structural basis for sequence-dependent DNA cleavage by nonspecific endonucleases

Nonspecific endonucleases hydrolyze DNA without sequence specificity but with sequence preference, however the structural basis for cleavage preference remains elusive. We show here that the nonspecific endonuclease ColE7 cleaves DNA with a preference for making nicks after (at 3′O-side) thymine bases but the periplasmic nuclease Vvn cleaves DNA more evenly with little sequence preference. The crystal structure of the ‘preferred complex’ of the nuclease domain of ColE7 bound to an 18 bp DNA with a thymine before the scissile phosphate had a more distorted DNA phosphate backbone than the backbones in the non-preferred complexes, so that the scissile phosphate was compositionally closer to the endonuclease active site resulting in more efficient DNA cleavage. On the other hand, in the crystal structure of Vvn in complex with a 16 bp DNA, the DNA phosphate backbone was similar and not distorted in comparison with that of a previously reported complex of Vvn with a different DNA sequence. Taken together these results suggest a general structural basis for the sequence-dependent DNA cleavage catalyzed by nonspecific endonucleases, indicating that nonspecific nucleases could induce DNA to deform to distinctive levels depending on the local sequence leading to different cleavage rates along the DNA chain.     

On the DNA cleavage mechanism of Type I restriction enzymes

Although the DNA cleavage mechanism of Type I restriction–modification enzymes has been extensively studied, the mode of cleavage remains elusive. In this work, DNA ends produced by EcoKI, EcoAI and EcoR124I, members of the Type IA, IB and IC families, respectively, have been characterized by cloning and sequencing restriction products from the reactions with a plasmid DNA substrate containing a single recognition site for each enzyme. Here, we show that all three enzymes cut this substrate randomly with no preference for a particular base composition surrounding the cleavage site, producing both 5′- and 3′-overhangs of varying lengths. EcoAI preferentially generated 3′-overhangs of 2–3 nt, whereas EcoKI and EcoR124I displayed some preference for the formation of 5′-overhangs of a length of ~6–7 and 3–5 nt, respectively. A mutant EcoAI endonuclease assembled from wild-type and nuclease-deficient restriction subunits generated a high proportion of nicked circular DNA, whereas the wild-type enzyme catalyzed efficient cleavage of both DNA strands. We conclude that Type I restriction enzymes require two restriction subunits to introduce DNA double-strand breaks, each providing one catalytic center for phosphodiester bond hydrolysis. Possible models for DNA cleavage are discussed.     

Yeast redoxyendonuclease, a DNA repair enzyme similar to Escherichia coli endonuclease III

A DNA repair endonuclease (redoxyendonuclease) was isolated from bakers' yeast (Saccharomyces cerevisiae). The enzyme has been purified by a series of column chromatography steps and cleaves OsO4-damaged, double-stranded DNA at sites of thymine glycol and heavily UV-irradiated DNA at sites of cytosine, thymine, and guanine photoproducts. The base specificity and mechanism of phosphodiester bond cleavage for the yeast redoxyendonuclease appear to be identical with those of Escherichia coli endonuclease III when thymine glycol containing, end-labeled DNA fragments of defined sequence are employed as substrates. Yeast redoxyendonuclease has an apparent molecular size of 38,000-42,000 daltons and is active in the absence of divalent metal cations. The identification of such an enzyme in yeast may be of value in the elucidation of the biochemical basis for radiation sensitivity in certain yeast mutants.     

Mutation of a conserved serine residue in a quinolone-resistant type II topoisomerase alters the enzyme-DNA and drug interactions

A Ser740 --> Trp mutation in yeast topoisomerase II (top2) and of the equivalent Ser83 in gyrase results in resistance to quinolones and confers hypersensitivity to etoposide (VP-16). We characterized the cleavage complexes induced by the top2(S740W) in the human c-myc gene. In addition to resistance to the fluoroquinolone CP-115,953, top2(S740W) induced novel DNA cleavage sites in the presence of VP-16, azatoxin, amsacrine, and mitoxantrone. Analysis of the VP-16 sites indicated that the changes in the cleavage pattern were reflected by alterations in base preference. C at position -2 and G at position +6 were observed for the top2(S740W) in addition to the previously reported C-1 and G+5 for the wild-type top2. The VP-16-induced top2(S740W) cleavage complexes were also more stable. The most stable sites had strong preference for C-1, whereas the most reversible sites showed no base preference at positions -1 or -2. Different patterns of DNA cleavage were also observed in the absence of drug and in the presence of calcium. These results indicate that the Ser740 --> Trp mutation alters the DNA recognition of top2, enhances its DNA binding, and markedly affects its interactions with inhibitors. Thus, residue 740 of top2 appears critical for both DNA and drug interactions.     

Evolution of I-SceI homing endonucleases with increased DNA recognition site specificity

Elucidating how homing endonucleases undergo changes in recognition site specificity will facilitate efforts to engineer proteins for gene therapy applications. I-SceI is a monomeric homing endonuclease that recognizes and cleaves within an 18-bp target. It tolerates limited degeneracy in its target sequence, including substitution of a C:G₊₄ base pair for the wild-type A:T₊₄ base pair. Libraries encoding randomized amino acids at I-SceI residue positions that contact or are proximal to A:T₊₄ were used in conjunction with a bacterial one-hybrid system to select I-SceI derivatives that bind to recognition sites containing either the A:T₊₄ or the C:G₊₄ base pairs. As expected, isolates encoding wild-type residues at the randomized positions were selected using either target sequence. All I-SceI proteins isolated using the C:G₊₄ recognition site included small side-chain substitutions at G100 and either contained (K86R/G100T, K86R/G100S and K86R/G100C) or lacked (G100A, G100T) a K86R substitution. Interestingly, the binding affinities of the selected variants for the wild-type A:T₊₄ target are 4- to 11-fold lower than that of wild-type I-SceI, whereas those for the C:G₊₄ target are similar. The increased specificity of the mutant proteins is also evident in binding experiments in vivo. These differences in binding affinities account for the observed ∼36-fold difference in target preference between the K86R/G100T and wild-type proteins in DNA cleavage assays. An X-ray crystal structure of the K86R/G100T mutant protein bound to a DNA duplex containing the C:G₊₄ substitution suggests how sequence specificity of a homing enzyme can increase. This biochemical and structural analysis defines one pathway by which site specificity is augmented for a homing endonuclease.     

Sequence-dependent enhancement of hydrolytic deamination of cytosines in DNA by the restriction enzyme PspGI

Hydrolytic deamination of cytosines in DNA creates uracil and, if unrepaired, these lesions result in C to T mutations. We have suggested previously that a possible way in which cells may prevent or reduce this chemical reaction is through the binding of proteins to DNA. We use a genetic reversion assay to show that a restriction enzyme, PspGI, protects cytosines within its cognate site, 5′-CCWGG (W is A or T), against deamination under conditions where no DNA cleavage can occur. It decreases the rate of cytosine deamination to uracil by 7-fold. However, the same protein dramatically increases the rate of deaminations within the site 5′-CCSGG (S is C or G) by ~15-fold. Furthermore, a similar increase in cytosine deaminations is also seen with a catalytically inactive mutant of the enzyme showing that endonucleolytic ability of the protein is dispensable for its mutagenic action. The sequences of the mutants generated in the presence of PspGI show that only one of the cytosines in CCSGG is predominantly converted to thymine. Our results are consistent with PspGI ‘sensitizing’ the cytosine in the central base pair in CCSGG for deamination. Remarkably, PspGI sensitizes this base for damage despite its inability to form stable complexes at CCSGG sites. These results can be explained if the enzyme has a transient interaction with this sequence during which it flips the central cytosine out of the helix. This prediction was validated by modeling the structure of PspGI–DNA complex based on the structure of the related enzyme Ecl18kI which is known to cause base-flipping.     

Profile of the DNA recognition site of the archaeal homing endonuclease I-DmoI.

I- Dmo I is a homing enzyme of the LAGLI-DADG type that recognizes up to 20 bp of DNA and is encoded by an archaeal intron of the hyperthermophilic archaeon Desulfurococcus mobilis . A combined mutational and DNA footprinting approach was employed to investigate the specificity of the I- Dmo I-substrate interaction. The results indicate that the enzyme binds primarily to short base paired regions that border the sites of DNA cleavage and intron insertion. The minimal substrate spans no more than 15 bp and while sequence degeneracy is tolerated in the DNA binding regions, the sequence and size of the cleavage region is highly conserved. The enzyme has a slow turnover rate and cuts the coding strand with a slight preference over the non-coding strand. Complex formation produces some distortion of the DNA double helix within the cleavage region. The data are compatible with the two DNA-binding domains of I- Dmo I bridging the minor groove, where cleavage occurs, and interacting within the major groove on either side, thereby stabilizing a distorted DNA double helix. This may provide a general mode of DNA interaction at least for the LAGLIDADG-type homing enzymes.     

Thermodynamic and Structural Basis for Relaxation of Specificity in Protein–DNA Recognition

As a novel approach to the structural and functional properties that give rise to extremely stringent sequence specificity in protein–DNA interactions, we have exploited “promiscuous” mutants of EcoRI endonuclease to study the detailed mechanism by which changes in a protein can relax specificity. The A138T promiscuous mutant protein binds more tightly to the cognate GAATTC site than does wild-type EcoRI yet displays relaxed specificity deriving from tighter binding and faster cleavage at EcoRI* sites (one incorrect base pair). AAATTC EcoRI* sites are cleaved by A138T up to 170-fold faster than by wild-type enzyme if the site is abutted by a 5′-purine-pyrimidine (5′-RY) motif. When wild-type protein binds to an EcoRI* site, it forms structurally adapted complexes with thermodynamic parameters of binding that differ markedly from those of specific complexes. By contrast, we show that A138T complexes with 5′-RY-flanked AAATTC sites are virtually indistinguishable from wild-type-specific complexes with respect to the heat capacity change upon binding (?C°_P), the change in excluded macromolecular volume upon association, and contacts to the phosphate backbone. While the preference for the 5′-RY motif implicates contacts to flanking bases as important for relaxed specificity, local effects are not sufficient to explain the large differences in ?C°_P and excluded volume, as these parameters report on global features of the complex. Our findings therefore support the view that specificity does not derive from the additive effects of individual interactions but rather from a set of cooperative events that are uniquely associated with specific recognition.     

Determination of the recognition sequence of Mycobacterium smegmatis topoisomerase I on mycobacterial genomic sequences

Mycobacterium smegmatis topoisomerase I has several distinctive features. The absence of the zinc finger motif found in other prokaryotic type I topoisomerases and the ability of the enzyme to recognise single-stranded and duplex DNA are unique characteristics of the enzyme. We have mapped the strong topoisomerase sites of the enzyme on genomic DNA sequences from Mycobacterium tuberculosis and M.smegmatis. The enzyme does not nick DNA in random fashion and DNA cleavage occurred at a few specific sites. Mapping of these sites revealed conservation of a pentanucleotide motif CG/TCT↓T at the cleavage site (↓ represents the cleavage site). The enzyme binds and cleaves consensus oligonucleotides having this sequence motif. The protein exhibits a very high preference for C or a G residue at the +2 position with respect to the cleavage site. Based on earlier and the present studies we propose that the enzyme functions in vivo mainly at these specific sites to carry out topological reactions.     

Mechanism of action of Micrococcus luteus gamma-endonuclease

Micrococcus luteus extracts contain gamma-endonuclease, a Mg2+-independent endonuclease that cleaves gamma-irradiated DNA. This enzyme has been purified approximately 1000-fold, and the purified enzyme was used to study its substrate specificity and mechanism of action. gamma-Endonuclease cleaves DNA containing either thymine glycols, urea residues, or apurinic sites but not undamaged DNA or DNA containing reduced apurinic sites. The enzyme has both N-glycosylase activity that releases thymine glycol residues from OsO4-treated DNA and an associated apurinic endonuclease activity. The location and nature of the cleavage site produced has been determined with DNA sequencing techniques. gamma-Endonuclease cleaves DNA containing thymine glycols or apurinic sites immediately 3' to the damaged or missing base. Cleavage results in a 5'-phosphate terminus and a 3' baseless sugar residue. Cleavage sites can be converted to primers for DNA polymerase I by subsequent treatment with Escherichia coli exonuclease III. The mechanism of action of gamma-endonuclease and its substrate specificity are very similar to those identified for E. coli endonuclease III.