A Novel Method for the Synthesis of ddA and F-ddA Via Regioselective 2′-O-Deacetylation of 9-(2,5-DI-O-Acetyl-3-bromo-3-deoxy-β-D-xylofuranosyl)adenine

Abstract

Regioselective 2′-O-deacetylation of 9-(2,5-di-O-acetyl-3-bromo-3-deoxy-β-D-xylofuranosyl)adenine (1) is achieved by treatment of 1 with β-cyclodextrin (β-CyD) / aq. NaHCO₃ or N₂H₄·H₂O / EtOH. The 9-(5-O-Acetyl-3-bromo-3-deoxy-β-D-xylo-furanosyl)adenine (2) obtained is a common intermediate for the synthesis of 2′,3′-dideoxy-adenosine (ddA) (7) and 9-(2-fluoro-2,3-dideoxy-β-D-threo-pentofuranosyl)-adenine (F-ddA) (9).     

Nucleosides and Nucleotides. 139. Stereoselective Synthesis of (2′S)-2′-C-Alkyl-2′-deoxyuridines

Abstract

A synthetic method for (2′S)-2′-C-alkyl-2′-deoxyuridines (9) has been described. Catalytic hydrogenation of 1-[2-C-alkynyl-2-O-methoxalyl-3,5-O-TIPDS-β-D-arabino-pentofuranosyl]uracils (5) gave 1-[2-C-(2-alkyl)-2-O-methoxalyl-3,5-O-TIPDS-β-D-arabino-pentofuranosyl]uracils (4) as a major product, which were then subjected to the radical deoxygenation, affording (2′S)-2′-alkyl-2′-deoxy-3′,5′-O-TIPDS-uridines (7) along with a small amount of their 2′R epimers.

     

Nucleosides. LIV1 Synthesis and Properties of 3′-Azido- and 2′,3′-Dideoxy-6,7-diphenyllumazine Nucleosides

Abstract

The best approach for the synthesis of1-(3-azido-2,3-dideoxy-β-D-erythro-pento-furanosyl)lumazine (5) and its 6,7-dimethyl- (4) and 6,7-diphenyl derivatives (3) has been found in the interconversion of the corresponding 1-(2-deoxy- β-threo-pentofuranosyl)-lumazines. Monomethoxytritylation at the 5′-position (1 7, 3 4, 4 9) followed by mesylation at the 3′-OH group and subsequent nucleophilic displacement by lithium azide afforded 1 9, 2 9 and 4 7 which were deprotected by acid treatment to give 3–5 in good yields. The syntheses of 1-(2,3-dideoxy-β-D-glycero-pentofuranosyl)-6,7-diphenyllumazine (6) and its 6,7-dimethyl derivative (7) were achieved from 1-(2-deoxy-β-D-erythro-pentofuranosyl)-6,7-diphenyllumazine and the corresponding 6,7-dimethyllumazine (2 6) via their 5′-O-p-toluoyl- (2 0, 3 0), and 3′-deoxy-3′-iodo derivatives (2 4, 3 1) to form, after radical dehalogenation and final deprotection, 6 and 7. The newly synthesized lumazine nucleosides have been characterized by elemental analyses, UV-and NMR spectra.     

Design and Synthesis of Triazole-Linked xylo-Nucleoside Dimers

Three triazole-linked nonionic xylo-nucleoside dimers T^L-t-T^xL, T^L-t-A^BzxL and T^L-t-C^BzxL have been synthesized for the first time by Cu(I) catalyzed azide-alkyne [3 + 2] cycloaddition reaction (CuAAC) of 1-(3′-azido-3′-deoxy-2′-O,4′-C-methylene-β-D-ribo-furanosyl)thymine with different alkynes, i.e., 1-(5′-deoxy-5′-C-ethynyl-2′-O,4′-C-methylene-β-D-xylofuranosyl)thymine, 9-(5′-deoxy-5′-C-ethynyl-2′-O,4′-C-methylene-β-D-xylo-furanosyl)-N6-benzoyladenine and 1-(5′-deoxy-5′-C-ethynyl-2′-O,4′-C-methylene-β-D-xylofuranosyl)-N4-benzoylcytosine in 90%–92% yields. Among the two Cu(I) reagents, CuSO₄.5H₂O-sodium ascorbate in THF:^tBuOH:H₂O (1:1:1) and CuBr.SMe₂ in THF used for cycloaddition (click) reaction, the former one was found to be better yielding than the latter one.     

9-(2-Deoxy-ß-D-xylofuranosyl)adenine and 1-(2-Deoxy-ß-D-xylofuranosyl)thymine: Phosphorylation and Stability

Abstract

Phosphorylation of 1-(2-deoxy-β-D-xylofuranosyl)thymine (1) or 9-(2-deoxy-β-D-xylofuranosyl)adenine (3) with phosphoryl chloride gives the cyclic 3′,5′-phosphates (2 and 4a) but not the 5′-monophosphates 8a or 8b. The latter are obtained by phosphorylation of the 3′-0-benzoylated 2′-deoxy-β-D-xylonucleosides (7a, b) and subsequent base-catalyzed removal of the benzoyl groups. Compound 3, as the parent dA, depurinates in acidic medium, a reaction which is facilitated in the case of the N⁶-benzoyl derivative 9b and reduced after the introduction of an amidine protecting group. N-Glycosylic bond hydrolysis of 2′-deoxy-β-D-xylofuranosyl nucleosides is enhanced by a factor of two compared to 2′-deoxy-β-D-ribofuranosyl nucleosides.     

Nucleosides and Nucleotides. 125. Synthesis and Biological Evaluation of 2′,3′-Dideoxy-3′-fluoro-2′-methylidene Pyrimidine Nucleosides

Abstract

Reaction of 2′-deoxy-2′-methylidene-5′-O-trityluridine (1) with diethylamino-sulfur trifluoride (DAST) in CH₂Cl₂ resulted in the formation of a mixture of (3′R)-2′,3′-dideoxy-3′-fluoro-2′-methylidene derivative 3 and 2′,3′-didehydro-2′,3′-dideoxy-2′-fluoromethyl derivative 4 (3:4 = 1:1.5) in 65% yield. A similar treatment of 1-(2-deoxy-2-methylidene-5-O-trityl-β-D-threo-pentofuranosyl)uracil (19) with DAST in CH₂Cl₂ afforded (3′S)-2′,3′-dideoxy-3′-fluoro-2′-methylidene derivatives 20 and 4 in 38% and 17% yields respectively. Transformation of the uracil nucleosides 4, 12, and 20 into cytosines followed by deprotection furnished the corresponding cytidine derivatives 29, 18, and 25, respectively. The corresponding thymidine congener 27 was also synthesized in a similar manner. All of the newly synthesized nucleosides were evaluated for their inhibitory activities against HIV and for their antiproliferative activities against L1210 and KB cells.     

Formation of an Unexpected 2-Deoxy-α-D-Threo-Pentofuranosyl Azide by Reaction of O2,3′-Anhydro-5′-O-trityl-2′-deoxycytidine with Lithium Azide

Abstract

Reaction of 0²,3′-anhydro-5′-0-trityl-2′-deoxycytidine (1) with LiN₃s in DMF resulted in the formation of 1-(3-azido-2,3-dideoxy-5-0-trityl-β-D-erythro-pentofuranosyl) cytosine (2) and 3-0-(4-amino-1,3-pyrimidin-2-yl)-5-0-trityl-2-deoxy-α-D-threo-pentofuranosyl azide (3) (2:3 = 1:1) in 88% yield. Compound 3 was deprotected with 80% aqueous AcOH yielding 4     

An Improved Synthesis of 2′-Deoxy-9-deazaadenosine and an N-7 Blocked Derivative Useful for the Synthesis of Modified Oligonucleotides Containing 2′-Deoxy-9-deazaadenosine

Abstract

As an epimerization resistant synthon in the synthesis of oligo-nucleotides consisting of C-nucleoside analogues, hitherto unknown 5-benzyloxy-methyl-3-(2-deoxy-β-D-erythro-pentofuranosyl)pyrrolo[3,2-d]pyrimpyrimidine (7-benzyloxymethyl-2′-deoxy-9-deazaadenosine) was prepared in seven steps from the known 3-amino-2-cyano-4-(2,3-O-isopropylidene-5-O-trityl-β-D-ribofuranosyl)-pyrrolpyrrole (1). Treatment of 1 with benzyl chloromethyl ether in the presence of potassium t-butoxide and 18-crown-6 afforded the N-protected pyrrole 2, which was converted into the 9-deazapurine derivative 3 in high yield by heating in EtOH. 7-Benzyloxymethyl-9-deazaadenosine 4 was obtained from 3 by acid hydrolysis in 2.5% methanolic hydrogen chloride. After protection of the hydroxyl groups of 4 with Markievicz's reagent, the product 5 was converted into the 2′-O-phenoxythiocarbonyl derivative 6. Reduction of 6 with butyltin hydride in the presence of 2,2′-azobis(2-methylpropionitrile), followed by desilylation with triethylammonium fluoride, afforded the desired 7-benzyloxymethyl-2′-deoxy-9-deazaadenosine (8) in high overall yield. The benzyloxymethyl group of 8 was removed by hydrogenolysis over palladium hydroxide (Degussa type) to give 2′-deoxy-9-deazaadenosine (9) in quantitative yield. The structure of 9 is discussed.     

A Practical Synthesis of N1-Methyl-2′-deoxy-ψ-uridine (ψ-Thymidine) and Its Incorporation into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A₁₀:T₁₀) at pH 7.0.     

Efficient Synthesis of 2′-Bromo-2′-Deoxy-3′,5′-O-TPDS-pyrimidine Nucleosides by Boron Trifluoride Catalyzed Reaction of O2,2′-Anhydro-(1-β-D-Arabinofuran0Syl)pyrimidine Nucleosides with Lithium Bromide

Abstract

Efficient syntheses of 2′-bromo-2′-deoxy-3′,5′-O-TPDS-uridine (5a) and 1-(2-bromo-3,5-O-TPDS-β-D-ribofuranosyl)thymine (5b) from uridine and 1-(β-D-ribofuranosyl)thymine are described, respectively. The key step is a treatment of 3′,5′-O-TPDS-O²,2′-anhydro-1-(β-D-ardbinofuranosyl)uracil (4a) and -thymine (4b) with LiBr in the presence of BF₃-OEt₂ in 1,4-dioxane at 60°C to give 5a and 5b in 98%, and 96% yield, respectively.

     

Synthesis of 2′,3′-Dideoxypurinenucleosides via the Palladium Catalyzed Reduction of 9-(2,5-Di-O-acetyl-3-bromo-3-deoxy-β-d-xylofuranosyl)purine Derivatives

Abstract

Practical method to produce 2′,3′-dideoxypurinenucleosides from 9-(2,5-di-O-acetyl-3-bromo-3-deoxy-β-D-xylofuranosyl)purines (1) was developed. High ratio of 2′,3′-dideoxynucleoside to 3′-deoxyribonucleoside was obtained by selecting the reaction conditions (solvent, pH and/or base), or changing 2′-acyloxy leaving group. The reaction mechanism was studied by deuteration experiments of 1a and 1-(3,5-di-O-acety1-2-bromo-2-deoxy-β-D-ribofuranosyl)thymine (12).

     

CycloSaligenyl Pronucleotides of 5-Iodo and 5-Trifluoromethyl-1-(2-deoxy-β-D-ribofuranosyl)-2,4-difluorobenzene Mimics of Thymidine: Synthesis and Evaluation of this Pronucleotide Monophosphate Delivery System for Compounds with Potential Anticancer Activity

Abstract

A group of unnatural 1-(2-deoxy-β-D-ribofuranosyl)-2,4-difluorobenzenes possessing a 5-I or 5-CF₃ substituent, that were originally designed as thymidine mimics, were coupled via their 5′-OH group to a cyclosaligenyl (cycloSal) ring system having a variety of C-3 substituents (Me, OMe, H). The 5′-O-cycloSal-pronucleotide concept was designed to effect a thymidine kinase-bypass, thereby providing a method for the intracellular delivery and generation of the 5′-O-monophosphate for nucleosides that are poorly phosphorylated. The 5′-O-cycloSal pronucleotide phosphotriesters synthesized in this study were obtained as a 1:1 mixture of two diastereomers that differ in configuration (S _P or R _P) at the asymmetric phosphorous center. The (S _P)- and (R _P)-diastereomers for the 5′-O-3-methylcycloSal- and 5′-O-3-methoxycycloSal derivatives of 1-(2-deoxy-β-D-ribofuranosyl)-2,4-difluoro-5-iodobenzene were separated by silica gel flash column chromatography. This class of cycloSal pronucleotide compounds generally exhibited weak cytotoxic activities in a MTT assay (CC₅₀ values in the 10^?3 to 10^?4 M range), against a number of cancer cell lines (143B, 143B-LTK, EMT-6, Hela, 293), except for cyclosaligenyl-5′-O-[1′-(2,4-difluoro-5-iodophenyl)-2′-deoxy-β-D-ribofuranosyl]phosphate that was more potent (CC₅₀ values in the 10^?5 to 10^?6 M range), than the reference drug 5-iodo-2′-deoxyuridine (IUDR) which showed CC₅₀ values in the 10^?3 to 10^?5 M range.     

Synergistic Effect of 5-Nitro-2′-deoxyuridine with Ganciclovir Against Human Cytomegalovirus In Vitro

Abstract

In this paper we describe a practical synthesis of 5-nitro-2′-deoxyuridine (4) and 1-(2-deoxy-2-fluoro-β-D-arabinofuranosyl)-5-nitrouracil (11). These compounds were then evaluated for their ability to inhibit the growth of human cytomegalovirus (HCMV, strain AD169) in MRC-5 cells using a plaque reduction assay. Compound 11 was unable to inhibit the growth of HCMV at the highest concentration tested (100 μg/mL). However, compound 4 (5-NO₂-dU) exhibited marginal activity against HCMV in vitro in a dose-dependent manner with a 50% inhibitory concentrations (IC₅₀) of 1 to 5 μg/mL. Combinations of 5-NO₂-dU with ganciclovir synergistically inhibited HCMV induced cell killing in culture.     

Synthesis of 1-(2,3-Dideoxy-β-d-glycero-pent-2-enofuranosyl)thymine (d4T; Stavudine) from 5-Methyluridine

Abstract

A practical synthetic method of d4T (3) from 5-methyluridine (2a) was developed. The Marumoto-Mansuri method was modified using 2′,3′-O-methoxy-ethylidene-5-methyluridine (10) as an intermediate to afford 1-(3,5-di-O-acetyl-2-bromo-2-deoxy-β-D-ribofuranosyl)thymine (6a) in high yield with less formation of by-products. The reaction mechanism was also discussed.

     

Synthesis and Structural Analysis of Oxadiazole Carboxamide Deoxyribonucleoside Analogs

Two novel C-linked oxadiazole carboxamide nucleosides 5-(2′-deoxy-3′,5′-β-D-erythro-pentofuranosyl)-1,2,4-oxadiazole-5-carboxamide (1) and 5-(2′-deoxy-3′,5′-β-D-erythro-pentofuranosyl)-1,2,4-oxadiazole-3-carboxamide (2) were successfully synthesized and characterized by X-ray crystallography. The crystallographic analysis shows that both unnatural nucleoside analogs 1 and 2 adapt the C2′-endo (“south”) conformation. The orientation of the oxadiazole carboxamide nucleobase moiety was determined as anti (conformer A) and high anti (conformer B) in the case of the nucleoside analog 1 whereas the syn conformation is adapted by the unnatural nucleoside 2. Furthermore, nucleoside analogs 1 and 2 were converted with high efficiency to corresponding nucleoside triphosphates through the combination chemo-enzymatic approach. Oxadiazole carboxamide deoxyribonucleoside analogs represent valuable tools to study DNA polymerase recognition, fidelity of nucleotide incorporation, and extension.

     

Synthesis and Antiviral Activities of 5-Substituted 1-(2-Deoxy-2-C-methylene-4-thio-β-D-erythro-pentofuranosyl)uracilst†

Abstract

Various 5-substituted 1-(2-deoxy-2-C-methylene-4-thio-β-D-erythropentofuranosyl)uracils (4′-thioDMDUs) were synthesized from D-glucose via sila-Pummerer-type glycosylation. All of the β-anomers of 5-substituted 4′-thioDMDU, except the 5-hydroxyethyl derivative, showed potent anti-HSV-1 activity (ED₅₀ = 0.016–0.096 μg/mL). 5-Ethyl- and 5-iodo-4′-thioDMDUs were also active against HSV-2 (ED₅₀ = 0.17 and 0.86 μg/mL, respectively). 5-Bromovinyl-4′-thioDMDU was particularly active against VZV (ED₅₀ = 0.013 μg/mL).

     

The Synthesis of Some 5-Substituted-6-aza-2′-deoxyuridines

Abstract

5-(2-Thienyl)-1-(2-deoxy-3,5-di-O-p-toluoyl-β-D-erythro-pentofuranosyl)-6-azauracil [VIII] and 5-cyclopropyl-1-(2-deoxy-3,5-di-O-p-toluoyl-β-D-erythro-pentofuranosyl)-6-azauracil [X] were obtained in high yields (93.5% and 81.3% respectively) exclusively as β anomers, by condensation of the corresponding silylated triazine bases with 2-deoxyu-3,5-di-O-p-toluoyl-D-erythro-pentosyl chloride in chloroform. After deblocking both nucleosides with sodium methoxide in methanol, 5-(2-thienyl)-6-aza-2′-deoxyuridine [IX] and 5-cyclopropyl-6-aza-2′-deoxyuridine [XI] were obtained. The nucleoside IX was further acetylated, brominated with Br₂/CCl₄ and deblocked with methanolic ammonia to give 6-aza-5[2-(5-bromothienyl)]-2′-deoxyuridine[XIV].     

Synthesis of a Novel C-Nucleoside, 2-Amino-7-(2-deoxy-β- D-erythro-pentofuranosyl)-3H,5H-pyrrolo-[3,2-d]pyrimidin-4-one (2′-Deoxy-9-deazaguanosine)

Abstract

A synthesis of the C-nucleoside, 2-amino-7-(2-deoxy-β-D-erythro-pentofuranosyl)-3H,5H-pyrrolo[3,2-d]pyrimidin-4-one (9-deaza-2′-deoxyguanosine) was achieved starting from 2-amino-6-metnyl-3H-pyrimidin-4-one (5) and methyl 2-deoxy-3,5-di-O-(p-nitrobenzoyl)- D-erythro-pento-furanoside (11). The anomeric configuration of the C-nucleoside was established by ¹H NMR, NOEDS and ROESY. This C-nucleoside did not inhibit the growth of T-cell lymphoma cells.     

Some Aspects of Ribonucleoside Chemistry

Abstract

New routes to the preparations of 2′-deoxy-3′-C-methyl uridine (2c) and 1-(5′-0-trityl-3′-deoxy-β-D-glycero-pentofuran-2-ulosyl)uracil (4) from 5′-0-trityl-2′-0-tosyl uridine (1) and 5′-0-trityl-3′-0-tosyl uridine (3) respectively are described.     

Keto-fluorothiopyranosyl nucleosides: a convenient synthesis of 2- and 4-keto-3-fluoro-5-thioxylopyranosyl thymine analogs

A novel series of fluorinated keto-β-d-5-thioxylopyranonucleosides bearing thymine as the heterocyclic base have been designed and synthesized. Deprotection of 3-deoxy-3-fluoro-5-S-acetyl-5-thio-d-xylofuranose (1) and selective acetalation gave the desired isopropylidene 5-thioxylopyranose precursor 3. Acetylation and isopropylidene removal followed by benzoylation led to 3-deoxy-3-fluoro-1,2-di-Ο-benzoyl-4-O-acetyl-5′-thio-d-xylopyranose (6). This was condensed with silylated thymine and selectively deacetylated to afford 1-(2′-Ο-benzoyl-3′-deoxy-3′-fluoro-5′-thio-β-d-xylopyranosyl)thymine (8). Oxidation of the free hydroxyl group in the 4′-position of the sugar led to the formation of the target 4′-keto compound together with the concomitant displacement of the benzoyl group by an acetyl affording, 1-(2′-O-acetyl-3′-deoxy-3′-fluoro-β-d-xylopyranosyl-4′-ulose)thymine (9). Benzoylation of 3 and removal of the isopropylidene group followed by acetylation, furnished 3-deoxy-3-fluoro-1,2-di-Ο-acetyl-4-O-benzoyl-5′-thio-d-xylopyranose (12). Condensation of thiosugar 12 with silylated thymine followed by selective deacetylation led to the 1-(4′-Ο-benzoyl-3′-fluoro-5′-thio-β-d-xylopyranosyl)thymine (14). Oxidation of the free hydroxyl group in the 2′-position and concomitant displacement of the benzoyl group by an acetyl gave target 1-(4′-O-acetyl-3′-deoxy-3′-fluoro-β-d-xylopyranosyl-2′-ulose)thymine (15).