Molecular dynamics simulations on parallel and antiparallel C.G*G triplexes

Molecular dynamics (MD) studies have been carried out on the Hoogsteen hydrogen bonded parallel and the reverse Hoogsteen hydrogen bonded antiparallel C.G*G triplexes. Earlier, the molecular mechanics studies had shown that the parallel structure was energetically more favourable than the antiparallel structure. To characterize the structural stability of the two triplexes and to investigate whether the antiparallel structure can transit to an energetically more favourable structure, due to the local fluctuations in the structure during the MD simulation, the two structures were subjected to 200ps of constant temperature vacuum MD simulations at 300K. Initially no constraints were applied to the structures and it was observed that for the antiparallel triplex, the structure showed a large root mean square deviation from the starting structure within the first 12ps and the N4-H41--O6 hydrogen bond in the WC duplex got distorted due to a high propeller twist and a moderate increase in the opening angle in the basepairs. Starting from an initial value of 30 degrees , helical twist of the average structure from this simulation had a value of 36 degrees , while the parallel structure stabilized at a twist of 33 degrees. In spite of the hydrogen bond distortions in the antiparallel triplex, it was energetically comparable to the parallel triplex. To examine the structural characteristics of an undistorted structure, another MD simulation was performed on the antiparallel triplex by constraining all the hydrogen bonds. This structure stabilized at an average twist of 33 degrees. In the course of the dynamics though the energy of the molecule - compared to the initial structure - improved, it did not become comparable to the parallel structure. Energy minimization studies performed in the presence of explicit water and counterions also showed the two structures to be equally favourable energetically. Together these results indicate that the parallel C.G*G triplex with Hoogsteen hydrogen bonds also represents a stereochemically and energetically favourable structure for this class of triplexes.     

Evidence for a DNA triplex in a recombination-like motif: I. Recognition of Watson-Crick base pairs by natural bases in a high-stability triplex

Data are presented on a triplex type with two parallel homologous strands for which triplex formation is almost as strong as duplex formation at least for some sequences and even at pH 7 and 0.2 M NaCl. The evidence mainly rests upon comparing thermodynamic properties of similar systems. A paperclip oligonucleotide d(A12C4T12C4A12) with two linkers C4 obviously can form a triplex with parallel back-folded adenine strand regions, because the single melting transition of this complex splits in two transitions by introducing mismatches only in the third strand region. Respectively, a hairpin duplex d(A12C4T12) and a single strand d(A12) form a triplex as a 1:1 complex in which the second adenine strand is parallel oriented to the homologous one in the Watson-Crick paired duplex. In this system the melting temperature T(m) of the triplex is practically the same as that of the duplex d(A12)-d(T12), at least within a complex concentration range of 0.2-4.0 microM. The melting behaviour of complexes between triplex stabilizing ligand BePI and the system hairpin duplex plus single strand supports the triplex model. Non-denaturing gel electrophoresis suggests the existence of a triplex for a system in which five of the twelve A-T*A base triads are substituted by C-G*C base triads. The recognition between any substituted Watson-Crick base pair (X-Y) in the hairpin duplex d(A4XA7C4T7YT4) and the correspondingly replaced base (Z) in the third strand d(A4ZA7) is mutually selective. All triplexes with matching base substitutions (Z = X) have nearly the same stability (T(m) values from 29 to 33.5 degrees C), whereas triplexes with non-matching substitutions (Z not equal X) show a clearly reduced stability (T(m) values from 15 to 22 degrees C) at 2microM equimolar oligonucleotide concentration. Most nucleic acid triple helices hitherto known are limited to homopurine-homopyrimidine sequences in the target duplex. A stable triplex formation is demonstrated for inhomogeneous sequences tolerating at least 50% pyrimidine content in the homologous strands. On the basis of the surprisingly similar thermodynamic parameters for duplex and triplex, and of the fact that this triplex type seems to be more stable than many other natural DNA triplexes known, and on the basis of semiempirical and molecule mechanical calculations, we postulate bridging interactions of the third strand with the two other strands in the triplex according to the recombination motif. This triplex, denoted by us 'recombination-like form', tolerates heterogeneous base sequences.     

Base triplet nonisomorphism strongly influences DNA triplex conformation: effect of nonisomorphic G* GC and A* AT triplets and bending of DNA triplexes

Structural understanding of DNA triplexes is grossly inadequate despite their efficacy as therapeutic agents. Lack of structural similarity (isomorphism) of base triplets that figure in different DNA triplexes brings in an added complexity. Recently, we have shown that the residual twist (Deltat degrees ) and the radial difference (Deltar A) adequately define base triplet nonisomorphism in structural terms and allow assessment of their role in conferring stability as well as sequence-dependent structural variations in DNA triplexes. To further corroborate these, molecular dynamics (MD) simulations are carried out on DNA triplexes comprising nonisomorphic G* GC and A* AT base triplets under different sequential contexts. Base triplet nonisomorphism between G* GC and A* AT triplets is dominated by Deltat degrees (9.8 degrees ), in view of small Deltar (0.2 A), and is in contrast to G* GC and T* AT triplets where both Deltat degrees (10.6 degrees ) and Deltar (1.1A) are prominent. Results show that Deltat degrees alone enforces mechanistic influence on the triplex-forming purine strand so as to favor a zigzag conformation with alternating conformational features that include high (40 degrees ) and low (20 degrees ) helical twists, and high anti(G) and anti(A) glycosyl conformation. Higher thermal stability of this triplex compared to that formed with G* GC and T* AT triplets can be traced to enhanced base-stacking and counterion interactions. Surprisingly, it is found for the first time that the presence of a nonisomorphic G* GC or A* AT base triplet interrupting an otherwise mini A* AT or G* GC isomorphic triplex can induce a bend/curvature in a DNA triplex. These observations should prove useful in the design of triplex-forming oligonucleotides and in the understanding the binding affinities of this triplex with proteins.     

FTIR and UV spectroscopy studies of triplex formation between alpha-oligonucleotides with non-ionic phoshoramidate linkages and DNA targets

The triplexes formed by pyrimidine alpha-oligodeoxynucleotides, 15mers alpha dT(15) or 12mers alpha dCT having dimethoxyethyl (PNHdiME), morpholino (PMOR) or propyl (PNHPr) non-ionic phosphoramidate linkages with DNA duplex targets have been investigated by UV and FTIR spectroscopy. Due to the decrease in the electrostatic repulsion between partner strands of identical lengths all modifications result in triplexes more stable than those formed with unmodified phosphodiester beta-oligodeoxynucleotides (beta-ODNs). Among the alpha-ODN third strands having C and T bases and non-ionic phosphoramidate linkages (alpha dCTPN) the most efficient modification is (PNHdiME). The enhanced third strand stability of the alpha dCTPN obtained as diastereoisomeric mixtures is attenuated by the steric hindrance of the PMOR linkages or by the hydrophobicity of the PNHPr linkages. All alpha dCTPN strands form triplexes even at neutral pH. In the most favorable case (PNHdiME), we show by FTIR spectroscopy that the triplex formed at pH 7 is held by Hoogsteen T*A.T triplets and in addition by an hydrogen bond between O6 of G and C of the third strand (Tm = 30 degrees C). The detection of protonated cytosines is correlated at pH 6 with a high stabilization of the triplex (Tm = 65 degrees C). While unfavorable steric effects are overcome with alpha anomers, the limitation of the pH dependence is not completely suppressed. Different triplexes are evidenced for non pH dependent phosphoramidate alpha-thymidilate strands (alpha dT(15)PN) interacting with a target duplex of identical length. At low ionic strength and DNA concentration we observe the binding to beta dA(15) either of alpha dT(15)PN as duplex strand and beta dT(15) as third strand, or of two hydrophobic alpha dT(15)PNHPr strands. An increase in the DNA and counterion concentration stabilizes the anionic target duplex and then the alpha dT(15)PN binds as Hoogsteen third strand.     

Circular dichroism and UV melting studies on formation of an intramolecular triplex containing parallel T*A:T and G*G:C triplets: netropsin complexation with the triplex.

We have used circular dichroism and UV absorption spectroscopy to characterize the formation and melting behaviour of an intramolecular DNA triple helix containing parallel T*A:T and G*G:C triplets. Our approach to induce and to stabilize a parallel triplex involves the oligonucleotide 5'-d(G4A4G4[T4]C4T4C4-[T4]G4T4G4) ([T4] represents a stretch of four thymine residues). In a 10 mM sodium cacodylate, 0.2 mM disodium EDTA (pH 7) buffer, we have shown the following significant results. (i) While in the absence of MgCl2 this oligonucleotide adopts an intramolecular hairpin duplex structure prolonged by the single strand extremity 5'-d([T4]G4T4G4), the presence of millimolar concentrations of MgCl2generates an intramolecular triplex (via double hairpin formation). (ii) In contrast to the antiparallel triplex formed by the oligonucleotide 5'-d(G4T4G4[T4]G4A4G4[T4]C4T4C4), the parallel triplex melts in a biphasic manner (a triplex to duplex transition followed by a duplex to coil transition) and is less stable than the antiparallel one. The enthalpy change associated with triplex formation (-37 kcal/mol) is approximately half that of duplex formation (-81 kcal/mol). (iii) The parallel triple helix is disrupted by increasing the concentration of KCl(>10 mM), whereas, under the same conditions, the antiparallel triplex remains stable. (iv) Netropsin, a natural DNA minor groove-binding ligand, binds to the central site A4/T4of the duplex or triplex in an equimolar stoichiometry. Its association constant K is smaller for the parallel triplex ( approximately 1 x 10(7) M-1) than for the antiparallel one ( approximately 1 x 10(8) M-1). In contrast to the antiparallel structure, netropsin binding has no apparent effect on thermal stability of the parallel triple helix.     

NMR studies of triple-strand formation from the homopurine-homopyrimidine deoxyribonucleotides d(GA)4 and d(TC)4

The complexes formed by the homopurine and homopyrimidine deoxyribonucleotides d(GA)4 and d(TC)4 have been investigated by one- and two-dimensional 1H NMR. Under appropriate conditions [low pH, excess d(TC)4 strand] the oligonucleotides form a triplex containing one d(GA)4 and two d(TC)4 strands. The homopurine and one of the homopyrimidine strands are Watson-Crick base paired, and the second homopyrimidine strand is Hoogsteen base paired in the major groove to the d(GA)4 strand. Hoogsteen base pairing in GC base pairs requires hemiprotonation of C; we report direct observation of the C+ imino proton in these base pairs. Both homopyrimidine strands have C3'-endo sugar conformations, but the purine strand does not. The major triplex formed appears to have four TAT and three CGC+ triplets formed by binding of the second d(TC)4 strand parallel to the d(GA)4 strand with a 3' dangling end. In addition to the triplexes formed, at least one other heterocomplex is observed under some conditions.     

Spectroscopic studies on ethidium bromide binding to intramolecular parallel and antiparallel triple helices containing T*A:T and G*G:C triplets

The interaction of ethidium bromide (EB), a DNA intercalator, with two intramolecular triplexes 5'd(G4A4G4-[T4]-C4T4C4-[T4]-G4T4G4), 5'd(G4T4G4-[T4]-G4A4G4-[T4]-C4T4C4) ([T4] represents a stretch of 4 thymine residues) and their precursor duplexes has been investigated by circular dichroism, fluorescence and UV absorption spectroscopy. Binding of EB induces a circular dichroism band in the region around 310 nm which is positive for the duplex forms but negative for the triplex forms. We observed that the binding of EB to the duplex form does not induce the formation of the triplex structures. Thermal denaturation experiments demonstrate that EB stabilizes more the parallel triple helix than the antiparallel one. Analysis of the binding process from fluorescence measurements shows that binding constants to the triple helical forms and to the hairpin reference duplex [T4]-G4A4G4-[T4]-C4T4C4) are close. However the binding site size is larger for the triplexes (4-6 base triplets) than for the duplex (2 base pairs).     

Alternate strand recognition of double-helical DNA by (T,G)-containing oligonucleotides in the presence of a triple helix-specific ligand.

Triple helix formation requires a polypurine- polypyrimidine sequence in the target DNA. Recent works have shown that this constraint can be circumvented by using alternate strand triplex-forming oligonucleotides. We have previously demonstrated that (T,G)-containing triplex- forming oligonucleotides may adopt a parallel or an antiparallel orientation with respect to an oligopurine target, depending upon the sequence and, in particular, upon the number of 5'-GpT-3' and 5'-TpG-3' steps [Sun et al. (1991) C.R. Acad. Sci. Paris Ser III, 313, 585-590]. A single (T,G)-containing oligonucleotide can therefore interact with two oligopurine stretches which alternate on the two strands of the target DNA. The (T,G) switch oligonucleotide contains a 5'-part targeted to one of the oligopurine sequences in a parallel orientation followed by a 3'-part that adopts an antiparallel orientation with respect to the second oligopurine sequence. We show that a limitation to the stability of such a triplex may arise from the instability of the antiparallel part, composed of reverse-Hoogsteen C.GxG and T.AxT base triplets. Using DNase I footprinting and ultraviolet absorption experiments, we report that a benzo[e]pyridoindole derivative [(3-methoxy- 7H-8-methyl-11-[(3'-amino-propyl) amino] benzo[e]pyrido [4,3-b]indole (BePI)], a drug interacting more tightly with a triplex than with a duplex DNA, strongly stabilizes triplexes with reverse-Hoogsteen C.GxG and T.AxT triplets thus allowing a stabilization of the triplex-forming switch (T,G) oligonucleotide on alternating oligopurine- oligopyrimidine 5'-(Pu)14(Py)14-3' duplex sequences. These results lead to an extension of the range of oligonucleotide sequences for alternate strand recognition of duplex DNA.     

Monitoring denaturation behaviour and comparative stability of DNA triple helices using oligonucleotide–gold nanoparticle conjugates

Gold nanoparticle labels, combined with UV-visible optical absorption spectroscopic methods, are employed to probe the temperature-dependent solution properties of DNA triple helices. By using oligonucleotide–nanoparticle conjugates to characterize triplex denaturation, for the first time triplex to duplex melting transitions may be sensitively monitored, with minimal signal interference from duplex to single strand melting, for both parallel and antiparallel triple helices. Further, the comparative sequence-dependent stability of DNA triple helices may also be examined using this approach. Specifically, triplex to duplex melting transitions for triplexes formed using oligonucleotides that incorporate 8-aminoguanine derivatives were successfully monitored and stabilization of both parallel and antiparallel triplexes following 8-aminoguanine substitutions is demonstrated.     

Monitoring denaturation behaviour and comparative stability of DNA triple helices using oligonucleotide-gold nanoparticle conjugates

Gold nanoparticle labels, combined with UV-visible optical absorption spectroscopic methods, are employed to probe the temperature-dependent solution properties of DNA triple helices. By using oligonucleotide-nanoparticle conjugates to characterize triplex denaturation, for the first time triplex to duplex melting transitions may be sensitively monitored, with minimal signal interference from duplex to single strand melting, for both parallel and antiparallel triple helices. Further, the comparative sequence-dependent stability of DNA triple helices may also be examined using this approach. Specifically, triplex to duplex melting transitions for triplexes formed using oligonucleotides that incorporate 8-aminoguanine derivatives were successfully monitored and stabilization of both parallel and antiparallel triplexes following 8-aminoguanine substitutions is demonstrated.     

Protonated pyrimidine-purine-purine triplex.

We have studied a protonated pyrimidine-purine-purine (Py-Pu-Pu) triplex, which is formed between the d(C)nd(G)n duplex and the d(AG)m oligonucleotide as the third strand and carries the CG*A+ protonated base-triads. We have observed such an intermolecular complex between a plasmid carrying the d(C)18 d(G)18 insert and the d(AG)5 oligonucleotide without bivalent cations in 200 mM of Na+ at pH4.0. Bivalent cations additionally stabilize the complex. We propose the structures for nearly isomorphous base-triads TA*A, CG*G and CG*A+. To identify the H-DNA-like structure, which includes the triplex between d(C)n d(G)n duplex and the AG-strand, we have cloned in a superhelical plasmid the insert: G10TTAA(AG)5. The data on photofootprinting and chemical modification with diethyl pyrocarbonate, potassium permanganate and dimethyl sulfate demonstrate that the H-like structure with triplex carrying CG*G and CG*A+ base triads is actually formed under acid conditions. In the course of this study we have come across unexpected results on probing of Py-Pu-Pu triplexes by dimethyl sulfate (DMS): the protection effect is observed not only for guanines entering the duplex but also for guanines in the third strand lying in the major groove. We have demonstrated this effect not only for the case the novel protonated Py-Pu-Pu triplex but also for the traditional non-protonated Py-Pu-Pu intramolecular triplex (H*-DNA) formed by the d(C)37 d(G)37 insert in supercoiled plasmid in the presence of Mg2+ ions.     

DNA triple helix formation at target sites containing several pyrimidine interruptions: stabilization by protonated cytosine or 5-(1-propargylamino)dU.

DNase I footprinting has been used to study the formation of parallel triplexes at oligopurine target sequences which are interrupted by pyrimidines at regular intervals. TA interruptions are targeted with third strand oligonucleotides containing guanine, generating G x TA triplets, while CG base pairs are targeted with thymine, forming T x CG triplets. We have attempted to optimize the stability of these complexes by varying the base composition and sequence arrangement of the target sites, and by replacing the third strand thymines with the positively charged analogue 5-(1-propargylamino)dU (U(P)). For the target sequence (AAAT)(5)AA, in which pyrimidines are positioned at every fourth residue, triplex formation with TG-containing oligonucleotides is only detected in the presence of a triplex-binding ligand, though stable triplexes were detected at the target site (AAAAAT)(3)AAAA. Triplex stability at targets containing pyrimidines at every fourth residue is increased by introducing guanines into the duplex repeat unit using the targets (AGAT)(5)AA and (ATGA)(5)AA. In contrast, placing C(+) x GC triplets on the 5'-side of G x TA, using the target (AGTA)(5)TT, produces complexes of lower stability. We have attempted further to increase the stability of these complexes by using the positively charged thymine base analogue U(P), and have shown that (TU(P)TG)(5)TT forms a more stable complex with target (AAAT)(5)AA than the unmodified third strand, generating a footprint in the absence of a triplex-binding ligand. Triplex formation at (AGTA)(5)AA is improved by using the modified oligonucleotide (TCGU(P))(5)TT, generating a complex in which the charged triplets C(+) x GC and U(P) x AT alternate with uncharged triplets. In contrast, placing U(P) x AT triplets adjacent to C(+) x GC, using the third strand oligonucleotide (U(P)CGT)(5)TT, reduces triplex formation, while the third strand with both substitutions, (U(P)CGU(P))(5)TT, produces a complex with intermediate stability. It appears that, although adjacent U(P) x AT triplets form stable triplexes, placing U(P) x AT adjacent to C(+) x GC is unfavorable. Similar results were obtained with fragments containing CG inversions within the oligopurine tract, though triplexes at (AAAAAC)(3)AA were only detected in the presence of a triplex-binding ligand. Placing C(+) x GC on the 5'-side of T x CG triplets also reduces triplex formation, while a 3'-C(+) x GC produces complexes with increased stability.     

Structure, stability, and thermodynamics of a short intermolecular purine-purine-pyrimidine triple helix

We have investigated the structure and physical chemistry of the d(C3T4C3).2[d(G3A4G3)] triple helix by polyacrylamide gel electrophoresis (PAGE), 1H NMR, and ultraviolet (UV) absorption spectroscopy. The triplex was stabilized with MgCl2 at neutral pH. PAGE studies verify the stoichiometry of the strands comprising the triplex and indicate that the orientation of the third strand in purine-purine-pyrimidine (pur-pur-pyr) triplexes is antiparallel with respect to the purine strand of the underlying duplex. Imino proton NMR spectra provide evidence for the existence of new purine-purine (pur.pur) hydrogen bonds, in addition to those of the Watson-Crick (W-C) base pairs, in the triplex structure. These new hydrogen bonds are likely to correspond to the interaction between third-strand guanine NH1 imino protons and the N7 atoms of guanine residues on the purine strand of the underlying duplex. Thermal denaturation of the triplex proceeds to single strands in one step, under the conditions used in this study. Binding of the third strand appears to enhance the thermal stability of the duplex by 1-3 degrees C, depending on the DNA concentration. The free energy of triplex formation (-26.0 +/- 0.5 kcal/mol) is approximately twice that of duplex formation (-12.6 +/- 0.7 kcal/mol), suggesting that the overall stability of the pur.pur base pairs is similar to that of the W-C base pairs.(ABSTRACT TRUNCATED AT 250 WORDS)     

UV spectroscopic identification and thermodynamic analysis of protonated third strand deoxycytidine residues at neutrality in the triplex d(C(+)-T)6:[d(A-G)6.d(C-T)6]; evidence for a proton switch.

Near-UV difference spectral analysis of the triplex formed from d(C-T)6 and d(A-G)6.d(C-T)6 in neutral and acidic solution shows that the third strand dC residues are protonated at pH 7.0, far above their intrinsic pKa. Additional support for ion-dipole interactions between the third strand dC residues and the G.C target base pairs comes from reduced positive dependence of triplet stability on ionic strength below 0.9 M Na+, inverse dependence above 0.9 M Na+ and strong positive dependence on hydrogen ion concentration. Molecular modeling (AMBER) of C:G.C and C+:G.C base triplets with the third strand base bound in the Hoogsteen geometry shows that only the C+:G.C triplet is energetically feasible. van't Hoff analysis of the melting of the triplex and target duplex shows that between pH 5.0 and 8.5 in 0.15 M NaCl/0.005 M MgCl2 the enthalpy of melting (delta H degree obs) varies from 5.7 to 6.6 kcal.mol-1 for the duplex in a duplex mixture and from 7.3 to 9.7 kcal.mol-1 for third strand dissociation in the triplex mixture. We have extended the condensation-screening theory of Manning to pH-dependent third strand binding. In this development we explicitly include the H+ contribution to the electrostatic free energy and obtain [formula: see text]. The number of protons released in the dissociation of the third strand from the target duplex at pH 7.0, delta n2, is thereby calculated to be 5.5, in good agreement with approximately six third strand dc residues per mole of triplex. This work shows that when third strand binding requires protonated residues that would otherwise be neutral, triplex formation and dissociation are mediated by proton uptake and release, i.e., a proton switch. As a by-product of this study, we have found that at low pH the Watson-Crick duplex d(A-G)6.d(C-T)6 undergoes a transition to a parallel Hoogsteen duplex d(A-G)6.d(C(+)-T)6.     

Triplex formation at physiological pH by 5-Me-dC-N4-(spermine) [X] oligodeoxynucleotides: non protonation of N3 in X of X*G:C triad and effect of base mismatch/ionic strength on triplex stabilities.

Oligodeoxynucleotide (ODN) directed triplex formation has therapeutic importance and depends on Hoogsteen hydrogen bonds between a duplex DNA and a third DNA strand. T*A:T triplets are formed at neutral pH and C+*G:C are favoured at acidic pH. It is demonstrated that spermine conjugation at N4 of 5-Me-dC in ODNs 1-5 (sp-ODNs) imparts zwitterionic character, thus reducing the net negative charge of ODNs 1-5. sp-ODNs form triplexes with complementary 24mer duplex 8:9 show foremost stability at neutral pH 7.3 and decrease in stability towards lower pH, unlike the normal ODNs where optimal stability is found at an acidic pH 5.5. At pH 7.3, control ODNs 6 and 7 carrying dC or 5-Me-dC, respectively, do not show any triple helix formation. The stability order of triplex containing 5-Me-dC-N4-(spermine) with normal and mismatched duplex was found to be X*G:C approximately X*A:T > X*C:G > X*T:A. The hysteresis curve of sp-ODN triplex 3*8:9 indicated a better association with complementary duplex 8:9 as compared to unmodified ODN 6 in triplex 6*8:9. pH-dependent UV difference spectra suggest that N3 protonation is not a requirement for triplex formation by sp-ODN and interstrand interaction of conjugated spermine more than compensates for loss in stability due to absence of a single Hoogsteen hydrogen bond. These results may have importance in designing oligonucleotides for antigene applications.     

FTIR and UV spectroscopy studies of triplex formation between pyrimidine methoxyethylphosphoramidates alpha-oligodeoxynucleotides and ds DNA targets

The ability of non-ionic methoxyethylphosphoramidate (PNHME) alpha-oligodeoxynucleotides (ODNs), alpha dT(15) and alpha dCT dodecamer, to form triplexes with their double-stranded DNA targets was evaluated. Thermal stability of the formed complexes was studied by UV thermal denaturation and the data showed that these PNHME alpha-ODNs formed much more stable triplexes than phosphodiester (PO) beta-ODNs did (Delta Tm = + 20 degrees C for alpha dCT PNHME). In addition, FTIR spectroscopy was used to determine the base pairing and the strand orientations of the triplexes formed by alpha dT(15) PNHME compared to phosphodiester ODNs with beta or alpha anomeric configuration. While beta dT(15) PO failed to form a triplex with a long beta dA(n) x beta dT(n) duplex, the Tm of the Hoogsteen part of the triplex formed by alpha dT(15) PNHME reached 40 degrees C. Moreover alpha dT(15) PNHME displaced the beta dT(15) strand of a shorter beta dA(15) x beta dT(15) duplex. The alpha dCT PNHME and alpha dT(15) PNHME third strands were found antiparallel in contrast to alpha dT(15) PO which is parallel to the purine strand of their duplex target. The uniform preferential Hoogsteen pairing of the nucleotides alpha dT and alpha dC combining both replacements might contribute to the improve stability of the triplexes.     

Stabilization of PyPuPu triplexes with bivalent cations.

We studied the formation of stable PyPuPu intermolecular triplexes under neutral pH in the presence of bivalent cations (Mg, Ca, Mn, Co, Ni, Cu, Zn, Cd, and Ba) with the help of the photo- and DMS footprinting assays. The cations which stabilize d(C)n.d(G)n.d(G)n and d(TC)n.d(GA)n.d(AG)n triplexes were determined. Among them, Zn++ ions stabilized both triplexes, whereas Mg++ ions stabilize CGG triplexes, but do not stabilize TC.GA.AG triplexes. We have shown that an arbitrary purine sequence forms the PyPuPu triplex in the presence of Zn++ ions, and that the purine third strand is antiparallel with respect to the purine strand within the duplex.     

pH and cation effects on the properties of parallel pyrimidine motif DNA triplexes

The effects of cytosine protonation and various cations on the properties of parallel pyrimidine motif DNA triplexes were intensively investigated and characterized by several different techniques, such as circular dichroism (CD) conformation, ultraviolet (UV) melting, differential scanning calorimetry (DSC) thermal denaturation, and surface plasmon resonance (SPR) real-time dynamics. The comparative CD spectra of the triplex and the corresponding homoduplexes showed that the negative peak at approximately 218 nm would be the eigenpeak of the Hoogsteen paired strand, and moreover, the formation pathway of a triplex was significantly pH-dependent and fell into three groups: under acidic conditions, the triplex is formed by a one-step docking, under near physiological conditions, the Watson-Crick duplex is first structured and then accepts the Hoogsteen third strand into its major groove, and under basic conditions, the triplex is not formed. The pH-dependent thermodynamics of the global triplex, the Watson-Crick antiparallel duplex, and the Crick-Hoogsteen parallel duplex were comparatively discussed for the first time. These data revealed that the thermodynamic stabilities of the Watson-Crick-Hoogsteen triplex and the Crick-Hoogsteen duplex would be strongly dependent on cytosine protonation, but a low-pH environment somewhat destabilized the Watson-Crick duplex. The binding energy of triplex formation would be different from the unfolding energy of triplex melting under acidic conditions due to the disparity in the pathway between the formation and unfolding of a triplex. Real-time dynamic measurements showed that the association and dissociation rate constants of a duplex-to-triplex formation are (1.98 +/- 0.24) x 10(3) M(-1) s(-1) and (4.09 +/- 0.96) x 10(-4) s(-1) at 20 degrees C and pH 6.0, respectively. The formation energy of the duplex-to-triplex transition derived from SPR measurements was in agreement with the unfolding energy of the free Hoogsteen paired duplex derived from UV measurements. The calorimetric enthalpies of the triplex-to-duplex-to-single transition were 39.3 and 75.3 kcal/mol under near physiological conditions (pH 7.0), respectively, which were underestimated relative to the van't Hoff enthalpies. In addition, the effects of various cations, ionic strength, mixed-valent cations, and the position of the C(+)xG.C triplets on the thermodynamics of the triplexes were addressed under near physiological conditions. The interaction of metal ions with the triplexes clearly depended on the type and ionic strength of the cations, and the efficiency with which the cations stabilized the global triplex was in the order Mg(2+) > Mn(2+) > Ca(2+) > Ba(2+) > Na(+). These observations would be useful for the design of triplex-forming oligonucleotides for antigene drugs and therapeutic purposes.     

Thermodynamics of triple helix formation: spectrophotometric studies on the d(A)10.2d(T)10 and d(C+3T4C+3).d(G3A4G3).d(C3T4C3) triple helices.

We have stabilized the d(A)10.2d(T)10 and d(C+LT4C+3).d(G3A4G3).d(C3T4C3) triple helices with either NaCl or MgCl2 at pH 5.5. UV mixing curves demonstrate a 1:2 stoichiometry of purine to pyrimidine strands under the appropriate conditions of pH and ionic strength. Circular dichroic titrations suggest a possible sequence-independent spectral signature for triplex formation. Thermal denaturation profiles indicate the initial loss of the third strand followed by dissociation of the underlying duplex with increasing temperature. Depending on the base sequence and ionic conditions, the binding affinity of the third strand for the duplex at 25 degrees C is two to five orders of magnitude lower than that of the two strands forming the duplex. Thermodynamic parameters for triplex formation were determined for both sequences in the presence of 50 mM MgCl2 and/or 2.0 M NaCl. Hoogsteen base pairs are 0.22-0.64 kcal/mole less stable than Watson-Crick base pairs, depending on ionic conditions and base composition. C+.G and T.A Hoogsteen base pairs appear to have similar stability in the presence of Mg2+ ions at low pH.     

Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.