Binding of pentagalloyl glucose to two globular proteins occurs via multiple surface sites

The interaction between pentagalloyl glucose (PGG) and two globular proteins, bovine serum albumin (BSA) and ribulose-1,5-bisphosphate carboxylase oxygenase (rubisco), was investigated by isothermal titration calorimetry (ITC). ITC data fit to a binding model consisting of two sets of multiple binding sites, which reveal similarities in the mode of binding of PGG to BSA and rubisco. In both cases, the interaction is characterized by a high number of binding sites, which suggests that binding occurs by a surface adsorption mechanism that leads to coating of the protein surface, which promotes aggregation and precipitation of the PGG-protein complex. This model was confirmed by turbidimetry analysis of the PGG-BSA interaction. Analysis of tryptophan fluorescence quenching during the interaction of PGG with BSA suggests that binding of PGG leads to some conformational changes that are energetically closer to the unfolded state of the BSA structure, because small red shifts in the resulting emission spectra were observed.     

Testing of the portal hypothesis: analysis of a V32G, F57G, K58G mutant of the fatty acid binding protein of the murine adipocyte

The portal region of fatty acid binding proteins is hypothesized to function as a dynamic aperture, controlling accessibility of external ligands to the internal fatty acid binding cavity. To test this hypothesis, a triple mutant of the murine FABP4 has been developed (V32G, F57G, K58G, referred to as the portal mutant) that is predicted to constitutively enlarge the opening due to a reduction in the molecular dimensions of the side chains of key portal amino acids. The portal mutant was purified from expressing Escherichia coli, its stability was evaluated, and the thermodynamics and kinetics of ligand binding were compared to that of wild-type protein. Introduction of the three amino acid substitutions caused no significant change in the stability of the protein with a free energy of unfolding of 13.7 kJ/mol as compared to 14.0 kJ/mol for the wild-type protein. The portal mutant exhibited a modest decrease (4-fold) in ligand binding affinity using the fluorescent probe 1-anilinonaphthalene-8-sulfonic acid (1,8-ANS) as a surrogate ligand. 1,8-ANS displacement assays revealed that the binding affinity for oleate increased from a K0.5 of 196 +/- 15 nM for the wild-type protein to 165 +/- 8 for the portal mutant, while that for arachidonate decreased from the wild type of 186 +/- 11 nM to 418 +/- 26 nM for the portal mutant. To evaluate cavity accessibility, rate of 1,8-ANS binding was assessed between the portal and wild-type protein. Using equimolar amounts of ligand and protein at 4 degrees, 1,8-ANS bound within the cavity to 95% saturation (t0.95) in 750 ms, while the mutant protein was fully modified in less than 1.4 ms. To independently evaluate cavity accessibility, modification of the sole protein cysteine residue, C117 residing within the cavity near C2-C4 of the bound ligand, was monitored using 5,5'-dithio-bis(2-nitrobenzoic acid) modification. The half time for modification (t0.5) for the wild-type protein was approximately 20 s, while that for V32G F57G K58G occurred in less than a second. As such, enlargement of the portal region of FABP4 markedly increased the accessibility of ligands to the cavity while having only modest effects on ligand affinity. Taken together, these data provide support for the portal region hypothesis and suggest dynamic fluctuations in this region regulate cavity access, but not ligand affinity or selectivity.     

Application of ANS fluorescent probes to identify hydrophobic sites on the surface of DREAM

DREAM (calsenilin or KChIP-3) is a calcium sensor involved in regulation of diverse physiological processes by interactions with multiple intracellular partners including DNA, K_v4 channels, and presenilin, however the detailed mechanism of the recognition of the intracellular partners remains unclear. To identify the surface hydrophobic surfaces on apo and Ca^2 +DREAM as a possible interaction sites for target proteins and/or specific regulators of DREAM function the binding interactions of 1,8-ANS and 2,6-ANS with DREAM were characterized by fluorescence and docking studies. Emission intensity of ANS–DREAM complexes increases upon Ca^2 + association which is consistent with an overall decrease in surface polarity. The dissociation constants for ANS binding to apoDREAM and Ca^2 +DREAM were determined to be 195 ± 20 μM and 62 ± 4 μM, respectively. Fluorescence lifetime measurements indicate that two ANS molecules bind in two independent binding sites on DREAM monomer. One site is near the exiting helix of EF-4 and the second site is located in the hydrophobic crevice between EF-3 and EF-4. 1,8-ANS displacement studies using arachidonic acid demonstrate that the hydrophobic crevice between EF-3 and EF-4 serves as a binding site for fatty acids that modulate functional properties of K_v4 channel:KChIP complexes. Thus, the C-terminal hydrophobic crevice may be involved in DREAM interactions with small hydrophobic ligands as well as other intracellular proteins.     

Thermodynamic stability of carbonic anhydrase: measurements of binding affinity and stoichiometry using ThermoFluor

ThermoFluor (a miniaturized high-throughput protein stability assay) was used to analyze the linkage between protein thermal stability and ligand binding. Equilibrium binding ligands increase protein thermal stability by an amount proportional to the concentration and affinity of the ligand. Binding constants (K(b)) were measured by examining the systematic effect of ligand concentration on protein stability. The precise ligand effects depend on the thermodynamics of protein stability: in particular, the unfolding enthalpy. An extension of current theoretical treatments was developed for tight binding inhibitors, where ligand effect on T(m) can also reveal binding stoichiometry. A thermodynamic analysis of carbonic anhydrase by differential scanning calorimetry (DSC) enabled a dissection of the Gibbs free energy of stability into enthalpic and entropic components. Under certain conditions, thermal stability increased by over 30 degrees C; the heat capacity of protein unfolding was estimated from the dependence of calorimetric enthalpy on T(m). The binding affinity of six sulfonamide inhibitors to two isozymes (human type 1 and bovine type 2) was analyzed by both ThermoFluor and isothermal titration calorimetry (ITC), resulting in a good correlation in the rank ordering of ligand affinity. This combined investigation by ThermoFluor, ITC, and DSC provides a detailed picture of the linkage between ligand binding and protein stability. The systematic effect of ligands on stability is shown to be a general tool to measure affinity.     

A study of the interaction of avidin with 2-anilinonaphthalene-6-sulfonic acid as a probe of the biotin binding site

The environment of the biotin binding site on avidin was investigated by determining the fluorescence enhancement of a series of fluorescent probes that are anilinonaphthalene sulfonic acid derivatives. Of the compounds tested, 2-anilinonaphthalene-6-sulfonic acid (2,6-ANS) exhibited the greatest enhancement under the conditions used (which would reflect both molar fluorescence enhancement and binding affinity) and exhibited more than 95% reversal upon addition of biotin. Thus, 2,6-ANS was chosen for more detailed characterization of the interaction with avidin. Only a single class of binding sites for 2,6-ANS was identified; the mean value for the Kd was 203 +/- 16 microM (X +/- 1 S.D.), and the molar ratio of 2,6-ANS binding sites to biotin binding sites was approx. 1. These results provide evidence that the biotin binding site and the 2,6-ANS binding site are at least partially overlapping, but the possibility that the probe binding site is altered by a conformational change induced by biotin binding cannot be excluded. At excitation = 328 nm and emission = 408 nm, the molar fluorescence of the bound probe was 6.8 +/- 1.0 microM-1 and that of the free probe was 0.061 +/- 0.008 microM-1 giving an enhancement ratio (molar fluorescence of bound probe/molar fluorescence of free probe) of 111 +/- 22. Upon binding, the wavelength of maximum fluorescence decreases. These findings also provide evidence that the fluorescence enhancement associated with the interaction of 2,6-ANS and avidin reflects the environment of the biotin binding site. The Kosower's Z factor, an empirical index of apolarity, was 82.1 for the 2,6-ANS binding site on avidin. This value reflects a degree of apolarity that is similar to apolar environments observed for substrate binding sites on several enzymes; although not the dominant factor, this environment may contribute to the strong binding of biotin.     

Protein purification by polyelectrolyte coacervation: influence of protein charge anisotropy on selectivity

The effect of polyelectrolyte binding affinity on selective coacervation of proteins with the cationic polyelectrolyte, poly(diallyldimethylammonium chloride) (PDADMAC), was investigated for bovine serum albumin/β-lactoglobulin (BSA/BLG) and for the isoforms BLG-A/BLG-B. High-sensitivity turbidimetric titrations were used to define conditions of complex formation and coacervation (pH(c) and pH(?), respectively) as a function of ionic strength. The resultant phase boundaries, essential for the choice of conditions for selective coacervation for the chosen protein pairs, are nonmonotonic with respect to ionic strength, for both pH(c) and pH(?). These results are explained in the context of short-range attraction/long-range repulsion governing initial protein binding "on the wrong side of pI" and also subsequent phase separation due to charge neutralization. The stronger binding of BLG despite its higher isoelectric point, inferred from lower pH(c), is shown to result from the negative "charge patch" on BLG, absent for BSA, as visualized via computer modeling (DelPhi). The higher affinity of BLG versus BSA was also confirmed by isothermal titration calorimetry (ITC). The relative values of pH(?) for the two proteins show complex salt dependence so that the choice of ionic strength determines the order of coacervation, whereas the choice of pH controls the yield of the target protein. Coacervation at I = 100 mM, pH 7, of BLG from a 1:1 (w/w) mixture with BSA was shown by SEC to provide 90% purity of BLG with a 20-fold increase in concentration. Ultrafiltration was shown to remove effectively the polymer from the target protein. The relationship between protein charge anisotropy and binding affinity and between binding affinity and selective coacervation, inferred from the results for BLG/BSA, was tested using the isoforms of BLG. Substitution of glycine in BLG-B by aspartate in BLG-A lowers pH(c) by 0.2, as anticipated on the basis of DelPhi modeling. The stronger binding of BLG-A, confirmed by ITC, led to a difference in pH(?) that was sufficient to provide enrichment by a factor of 2 for BLG-A in the coacervate formed from "native BLG".     

Interaction of piroxicam with bovine serum albumin investigated by spectroscopic,calorimetric and computational molecular methods

Abstract

The binding of drugs to serum proteins is governed by weak non-covalent forces. In this study, the nature and magnitude of the interactions between piroxicam (PRX) and bovine serum albumin (BSA) was assessed using spectroscopic, calorimetric and computational molecular methods. The fluorescence data revealed an atypical behavior during PRX and BSA interaction. The quenching process of tryptophan (Trp) by PRX is a dual one (approximately equal static and dynamic quenched components). The FRET results indicate that a non-radiative transfer of energy occurred. The association constant and the number of binding sites indicate moderate PRX and BSA binding. The competitive binding study indicates that PRX is bound to site I from the hydrophobic pocket of subdomain IIA of BSA. The synchronous spectra showed that the microenvironment around the BSA fluorophores and protein conformation do not change considerably. The Trp lifetimes revealed that PRX mainly quenches the fluorescence of Trp-213 situated in the hydrophobic domain. The CD and DSC investigation show that addition of PRX stabilizes the protein structure. ITC results revealed that BSA-PRX binding involves a combination of electrostatic, hydrophobic and hydrogen interactions. The analysis of the computational data is consistent with the experimental results. This thorough investigation of the PRX-BSA binding may provide support for other studies concerning moderate affinity drugs with serum protein.

Communicated by Ramaswamy H. Sarma     

Millisecond Timescale Dynamics of Human Liver Fatty Acid Binding Protein: Testing of Its Relevance to the Ligand Entry Process

For over a decade, scientists have been attempting to know more about the conformational dynamics of fatty acid binding proteins (FABPs), to answer the puzzling question of how ligands could access the internalized binding site(s). Conformational exchange of FABPs on the microsecond to millisecond timescales has been found in many FABPs and offers an important hypothesis for the ligand entry mechanism. Despite the potential significance, the validity of this hypothesis has not been verified yet. In this study, the slow dynamics of human liver fatty acid binding protein (hLFABP) that was shown previously to be highly flexible on millisecond timescales was quantitatively characterized in detail. In addition, the interaction between hLFABP and 1,8-ANS was studied using NMR spectroscopy, and the kinetic rate of ANS association to hLFABP was measured. We believe the current result excludes the possibility that the intrinsic millisecond dynamics of hLFABP represents a critical conformational reorganization process required for ligand entry, but implies that it may represent the exchange between the apo-state and a state resembling the singly-bound conformation. Furthermore, we suggest these results show that the ligand-entry related functional dynamics could occur on the microsecond/submicrosecond timescales, highly encouraging future computational studies on this topic.     

Interaction of insulin with a triblock copolymer of PEG-(fumaric-sebacic acids)-PEG: thermodynamic and spectroscopic studies

A comparative study on the interaction of (PEG-co-P(FA/SC)-co-PEG) triblock copolymer with bovine and human insulins was carried out using isothermal titration calorimetry (ITC), circular dichroism (CD), and fluorescence spectroscopy. ITC data show that the copolymer has a low affinity for both proteins, with an association constant of about 7-9 x 10(3) M (-1). Results also show that binding is enthalpically driven, and disfavored by conformational entropy. CD spectroscopy studies reveal a small increase in the helical content and a decrease in beta-structure as well as random coil in both proteins. Acrylamide quenching experiments display reduced accessibility of tyrosines, while intrinsic fluorescence spectra show lower tyrosine emission. Furthermore, thermal unfolding experiments, studied by far-UV CD at 222 and 217 nm, demonstrate that upon interaction with the copolymer helix structure becomes less stable while the stability of beta-structure remains unchanged. Altogether, these observations indicate that (PEG-co-P(FA/SC)-co-PEG) triblock copolymer has similar effect(s) on both proteins.     

The energetics of HMG box interactions with DNA: thermodynamics of the DNA binding of the HMG box from mouse sox-5

The energetics of the Sox-5 HMG box interaction with DNA duplexes, containing the recognition sequence AACAAT, were studied by fluorescence spectroscopy, isothermal titration calorimetry (ITC) and differential scanning calorimetry (DSC). Fluorescence titration showed that the association constant of this HMG box with the duplexes is of the order 4x10(7) M(-1), increasing somewhat with temperature rise, i.e. the Gibbs energy is -40 kJ mol(-1) at 5 degrees C, decreasing to -48 kJ mol(-1) at 32 degrees C. ITC measurements of the enthalpy of association over this temperature range showed an endothermic effect below 17 degrees C and an exothermic effect above, suggesting a heat capacity change on binding of about -4 kJ K(-1) mol(-1), a value twice larger than expected from structural considerations. A straightforward interpretation of ITC data in heat capacity terms assumes, however, that the heat capacities of all participants in the association reaction do not change over the considered temperature range. Our previous studies showed that over the temperature range of the ITC experiments the HMG box of Sox-5 starts to unfold, absorbing heat and the heat capacities of the DNA duplexes also increase significantly. These heat capacity effects differ from that of the DNA/Sox-5 complex. Correcting the ITC measured binding enthalpies for the heat capacity changes of the components and complex yielded the net enthalpies which exhibit a temperature dependence of about -2 kJ K(-1) mol(-1), in good agreement with that predicted on the basis of dehydration of the protein-DNA interface. Using the derived heat capacity change and the enthalpy and Gibbs energy of association measured at 5 degrees C, the net enthalpy and entropy of association of the fully folded HMG box with the target DNA duplexes was determined over a broad temperature range. These functions were compared with those for other known cases of sequence specific DNA/protein association. It appears that the enthalpy and entropy of association of minor groove binding proteins are more positive than for proteins binding in the major groove. The observed thermodynamic characteristics of protein binding to the A+T-rich minor groove of DNA might result from dehydration of both polar and non-polar groups at the interface and release of counterions. The expected entropy of dehydration was calculated and found to be too large to be compensated by the negative entropy of reduction of translational/rotational freedom. This implies that DNA/HMG box association proceeds with significant decrease of conformational entropy, i.e. reduction in conformational mobility.     

Why has porcine VEG protein unusually high stability and suppressed binding ability?

Von Ebner gland protein (VEGP) and odorant-binding protein (OBP) were purified from porcine lingual epithelium and nasal mucosa, respectively. Both VEGP and OBP preparations were homogeneous as indicated by SDS-PAGE, isoelectric focusing, gel-filtration and electrospray mass spectrometry. However, high-sensitivity differential scanning calorimetry (HS-DSC) yielded multiphasic denaturation thermograms for both proteins indicating their conformational heterogeneity. The unfolding transition of VEGP is observed at extremely high temperatures (about 110 degrees C), which is unexpected for a protein with significant structural homology to OBP and other lipocalins. Isothermal titration calorimetry (ITC) did not detect the binding of either aspartame or denatonium saccharide to VEGP nor did it detect binding of 2-isobutyl-3-methoxypyrazine (IBMP) to OBP. Extraction of OBP with mixed organic solvents eliminated the conformational heterogeneity and the protein showed a reversible two-state transition in HS-DSC thereafter. ITC also showed that the extracted OBP was able to bind IBMP. These results imply that tightly bound endogenous ligands increase the thermal stability of OBP and block the binding of other ligands. In contrast to OBP, the extraction of VEGP with organic solvents failed to promote binding or to establish thermal homogeneity, most likely because of the irreversible denaturation of VEGP. Thus, the elucidation of the functional behaviour of VEGP is closely related to the exhaustive purging of its endogenous ligands which otherwise very efficiently mask ligand binding sites of this protein.     

Alignment of anilinonaphthalene-sulfonate and related fluorescent probe molecules in squid axon membrane and in synthetic polymers

As a fluorescent probe for the squid axon membrane, the behavior of 1-anilinonaphthalene-8-sulfonate (1,8-ANS) was found to be very different from that of its positional isomer, 2,6-ANS, or of the methylated derivative, 2,6-TNS. The degree of polarization of the fluorescent light contributing to a transient intensity reduction during nerve excitation was larger than about 0.7 for both 2,6-ANS and 2,6-TNS, while the corresponding value for 1,8-ANS in a squid axon was about 0.35.The physicochemical basis of this difference was investigated by measuring the fluorescence polarization of these probe molecules incorporated into poly(vinyl alcohol) sheets. In a stretched sheet of this synthetic polymer, 1,8-ANS showed poor alignment, while the 2,6-derivatives were highly oriented with their transition moments aligned approximately in the direction of stretching. Based on these findings, the experimental results obtained from squid axons were interpreted as an indication of the existence, at or near the membrane, of a longitudinally oriented macromolecular structure, bringing about a high degree of alignment of 2,6-ANS or 2,6-TNS molecules.It is clear that, as a probe for fluorescence polarization studies of macromolecular structures, 2,6-TNS is far superior to 1,8-ANS.     

Insights into protein–polysorbate interactions analysed by means of isothermal titration and differential scanning calorimetry

Therapeutic proteins formulated as liquid solutions at high protein concentration are very sensitive to chemical and physical degradation. Especially avoiding the formation of protein aggregates is very crucial for product quality. In order to stabilize the colloidal properties of protein therapeutics various excipient are used. Especially the detergents polysorbate 20 and 80 are common. However, the mechanism upon which the detergents protect the protein from aggregation is not really known. The present study investigates the interaction of polysorbate 20 and 80 with different proteins: lysozyme, bovine serum albumin (BSA) and an immunoglobulin. The interaction and binding of the detergents to the proteins is investigated by isothermal titration calorimetry (ITC). From ITC the thermodynamic parameters (ΔH: change in enthalpy, ΔS: entropy and ΔG: free energy) upon binding are derived as well as the binding constant K _a. The thermal stability of the proteins in the presence of the detergent is assessed by differential scanning calorimetry (DSC). The results show that both detergents bind to BSA with K _a between 8 and 12 × 10³ M⁻¹ with ΔH −50 to −60 kJ/mol (25°C). One to two detergent molecules bind to BSA. The presence of both detergents induces a weak stabilisation of the thermal denaturation properties of BSA. However, the interaction of polysorbate 20 and 80 with lysozyme and the immunoglobulin is quite negligible. The presence of the detergents up to a concentration of 2 mM has no impact on the heat capacity curve neither a destabilisation nor a stabilisation of the native conformation is observed.     

Interaction of bovine serum albumin with some novel PEG-containing diblock copolymers

A comparative study on the interaction of different PEG-containing diblock copolymers including SA400, SA600, SA1500 and OA1500 (stearyl and oleyl esters of polyethylene glycol with 400, 600 and 1500 molecular weights, respectively) with bovine serum albumin (BSA) was carried out using isothermal titration calorimetry (ITC), attenuated total reflectance Fourier transform infrared (ATR-FTIR), circular dichroism (CD), and fluorescence spectroscopies. ITC data show that SA400, SA600, SA1500 and OA1500 bind to BSA, with association constants of (14.5, 3.16, 50.7 and 17.6)x10(3)M(-1), respectively. Results also show that the binding is enthalpically driven, disfavored by conformational entropy. Quantitative analysis of the FTIR absorbance spectra at amide I' (1600-1700cm(-1)) as well as far UV circular dichroism data show that these polymers do not disturb the BSA structure and only cause a slight increment in helicity along with a slight decrease in the beta-structure. Only stearyl esters SA400 and SA1500 slightly decreased the random structure content of the BSA. The diblock copolymers inhibit protein aggregation and bind to BSA better than their constituent PEGs causing an increment in its T(m); SA1500 is showing the strongest effect.     

A fluorometric assay for the biotin-avidin interaction based on displacement of the fluorescent probe 2-anilinonaphthalene-6-sulfonic acid

Avidin and biotin can be sensitively and accurately quantitated using the fluorescent probe 2-anilinonaphthalene-6-sulfonic acid (2,6-ANS). In the presence of avidin, the fluorescence of 2,6-ANS is blue shifted with a large increase in quantum yield. Biotin binding causes complete displacement of the bound fluorophore with concomitant quenching of the fluorescence. The fluorometric monitoring of the displacement of 2,6-ANS can be used as a facile method of measuring the biotin-avidin interaction. 2,6-ANS displacement gives the same stoichiometry as the method using 4'-hydroxyazobenzene-2-carboxylic acid. Our initial studies of an affinity-purified avidin revealed that, of the four binding sites on the avidin tetramer, a mean of three remain available for biotin (or dye) binding; this finding highlights a caveat concerning the use of affinity-purified oligomeric-binding proteins with multiple sites. As compared with previous fluorescence methods, the use of 2,6-ANS gives high sensitivity without the necessity of preparing and purifying a covalent avidin conjugate. In addition, the present method;:is potentially more sensitive than those based on optical absorbance; uses a probe that has increased stability and a larger Stokes shift compared with fluorescein; is not subject to protein interference; and gives accurate results over a wide range of 2,6-ANS and avidin concentrations.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Biophysical characterization of a riboflavin-conjugated dendrimer platform for targeted drug delivery

The present study describes the biophysical characterization of generation-five poly(amidoamine) (PAMAM) dendrimers conjugated with riboflavin (RF) as a cancer-targeting platform. Two new series of dendrimers were designed, each presenting the riboflavin ligand attached at a different site (isoalloxazine at N-3 and d-ribose at N-10) and at varying ligand valency. Isothermal titration calorimetry (ITC) and differential scanning calorimetry (DSC) were used to determine the binding activity for riboflavin binding protein (RfBP) in a cell-free solution. The ITC data shows dendrimer conjugates have K(D) values of ≥ 465 nM on a riboflavin basis, an affinity ~93-fold lower than that of free riboflavin. The N-3 series showed greater binding affinity in comparison with the N-10 series. Notably, the affinity is inversely correlated with ligand valency. These findings are also corroborated by DSC, where greater protein-conjugate stability is achieved with the N-3 series and at lower ligand valency.     

Molecular mechanism of polyethylene glycol mediated stabilization of protein

The effect of different molar ratios of polyethylene glycol (PEG) on the conformational stability of protein, bovine serum albumin (BSA), was studied. The binding of PEG with BSA was observed by fluorescence spectroscopy by measuring the fluorescence intensity after displacement of PEG with chromophore ANS and had further been confirmed by measuring the intrinsic fluorescence of tryptophan residues of BSA. Co-lyophilization of BSA with PEG at optimum BSA:PEG molar ratio led to the formation of the stable protein particles. Circular dichroism (CD) spectroscopy study suggested that a conformational change had occurred in the protein after PEG interaction and demonstrated the highest stability of protein at the optimum BSA:PEG molar ratio of 1:0.75. Additional differential scanning calorimetry (DSC) study suggested strong binding of PEG to protein leading to thermal stability at optimum molar ratio. Molecular mechanism operating behind the polyethylene glycol (PEG) mediated stabilization of the protein suggested that strong physical adsorption of PEG on the hydrophobic core of the protein (BSA) along with surface adsorption led to the stability of protein.     

The pH-dependent interaction of cinnamomin with lipid membranes investigated by fluorescence methods

Cinnamomin, a new type II ribosome-inactivating protein (RIP), was found to be able to induce the release of calcein loaded in lecithin small unilamellar vesicles and the fusion or aggregation of the lecithin liposomes. Such induction could be promoted severalfold by a pH 5.0 environment, a condition similar to that in endocytic vesicles. Lowering the pH from 7.5 to 5.0 evoked conformational changes of cinnamomin and unmasked its hydrophobic areas, including the exposure of 1-anilino-8-naphthalenesulfonate (1,8-ANS) binding sites of the molecule. Some tryptophan residues with affinity to acrylamide were demonstrated to participate in the lipid-protein interaction. The pH dependent fusogenicity of type II RIP might suggest its in vivo function as a fusogen to exert its cytotoxicity.