Salt bridge exchange binding mechanism between streptavidin and its DNA aptamer – thermodynamics and spectroscopic evidences

Protein‐nucleic acids binding driven by electrostatic interactions typically are characterized by the release of counter ions, and the salt‐inhibited binding association constant (K_a) and the magnitude of exothermic binding enthalpy (ΔH). Here, we report a non‐classical thermodynamics of streptavidin (SA)–aptamer binding in NaCl (140–350 mM) solutions near room temperatures (23–27 °C). By using isothermal titration calorimetry (ITC) and circular dichroism (CD)/fluorescence spectroscopy, we found that the binding was enthalpy driven with a large entropy cost (ΔH ?20.58 kcal mol^?1, TΔS ?10.99 kcal mol^?1, and K_a 1.08 × 10⁷ M^?1 at 140 mM NaCl 25 °C). With the raise of salt concentrations, the ΔH became more exothermic, yet the K_a was almost unchanged (ΔH ?26.29 kcal mol^?1 and K_a 1.50 × 10⁷ M^?1 at 350 mM NaCl 25 °C). The data suggest that no counter Na⁺ was released in the binding. Spectroscopy data suggest that the binding, with a stoichiometry of 2, was accompanied with substantial conformational changes on SA, and the changes were insensitive to the variation of salt concentrations. To account for the non‐classical results, we propose a salt bridge exchange model. The intramolecular binding‐site salt bridge(s) of the free SA and the charged phosphate group of aptamers re‐organize to form the binding complex by forming a new intermolecular salt bridge(s). The salt bridge exchange binding process requires minimum amount of counter ions releasing but dehydration of the contacting surface of SA and the aptamer. The energy required for dehydration is reduced in the case of binding solution with higher salt concentration and account for the higher binding exothermic mainly. Copyright © 2013 John Wiley & Sons, Ltd.     

Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor

The binding of a DNA aptamer (5′‐CCGTCTTCCAGACAAGAGTGCAGGG‐3′) to recombinant human vascular endothelial growth factor (VEGF₁₆₅) was characterized using surface plasmon resonance (SPR), fluorescence anisotropy and isothermal titration calorimetry (ITC). Results from both fluorescence anisotropy and ITC indicated that a single aptamer molecule binds to each VEGF homodimer, unlike other VEGF inhibitors that exhibit 2(ligand):1(VEGF homodimer) stoichiometry. In addition, ITC revealed that the association of the aptamer to VEGF at 20°C is enthalpically driven, with an unfavorable entropy contribution. SPR kinetic studies, with careful control of possible mass transfer effects, demonstrated that the aptamer binds to VEGF with an association rate constant k_on = 4.79 ± 0.03 × 10⁴ M^?1 s^?1 and a dissociation rate constant k_off = 5.21 ± 0.02 × 10^?4 s^?1 at 25°C. Key recognition hot‐spots were determined by a combination of aptamer sequence substitutions, truncations, and extensions. Most single‐nucleotide substitutions, particularly within an mfold‐predicted stem, suppress binding, whereas those within a predicted loop have a minimal effect. The 5′‐end of the aptamer plays a key role in VEGF recognition, as a single‐nucleotide truncation abolished VEGF binding. Conversely, an 11‐fold increase in the association rate (and affinity) is observed with a single cytosine nucleotide extension, due to pairing of the 3′‐GGG with 5′‐CCC in the extended aptamer. Our approach effectively maps the secondary structural elements in the free aptamer, which present the unpaired interface for high affinity VEGF recognition. These data demonstrate that a directed binding analysis can be used in concert with library screening to characterize and improve aptamer/ligand recognition. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 145–156, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Development of a ssDNA aptamer system with reduced graphene oxide (rGO) to detect nonylphenol ethoxylate in domestic detergent

Endocrine‐disrupting chemicals are a major public health problem throughout the world. In the human body, these compounds functionalize the same as sexual hormones, inducing precocious puberty, gynecomastia, etc. To help prevent this occurrence, a simple detection system is needed. In this study, a nonylphenol ethoxylate (NPE)‐specific aptamer was selected by reduced graphene oxide‐systematic evolution of ligands by exponential enrichment. A random ssDNA library was incubated with rGO for adsorption, followed by elution with the target molecule. As a result of screening, a DNA aptamer was found that specifically bounds to the target with high binding affinity (K_d = 100.9 ± 13.2 nM) and had a low limit of detection (LOD = 696 pM). Furthermore, this NPE‐binding aptamer bounds selectively to the target. Characterization of the aptamer was confirmed by measuring the fluorescence signal recovery from rGO. In addition, detection of NPE was performed with several water samples, and the detection accuracy was 100 ± 10%. From these results, we expect that this aptamer could be applied to an on‐site detection system for NPE in industrial sites or domestic fields.     

Confirming therapeutic target of protopine using immobilized β2‐adrenoceptor coupled with site‐directed molecular docking and the target‐drug interaction by frontal analysis and injection amount–dependent method

Drug‐protein interaction analysis is pregnant in designing new leads during drug discovery. We prepared the stationary phase containing immobilized β₂‐adrenoceptor (β ₂‐ AR) by linkage of the receptor on macroporous silica gel surface through N ,N ′‐carbonyldiimidazole method. The stationary phase was applied in identifying antiasthmatic target of protopine guided by the prediction of site‐directed molecular docking. Subsequent application of immobilized β ₂‐ AR in exploring the binding of protopine to the receptor was realized by frontal analysis and injection amount–dependent method. The association constants of protopine to β ₂‐ AR by the 2 methods were (1.00 ± 0.06) × 10⁵M⁻¹ and (1.52 ± 0.14) × 10⁴M⁻¹. The numbers of binding sites were (1.23 ± 0.07) × 10⁻⁷M and (9.09 ± 0.06) × 10⁻⁷M, respectively. These results indicated that β ₂‐ AR is the specific target for therapeutic action of protopine in vivo. The target‐drug binding occurred on Ser¹⁶⁹ in crystal structure of the receptor. Compared with frontal analysis, injection amount–dependent method is advantageous to drug saving, improvement of sampling efficiency, and performing speed. It has grave potential in high‐throughput drug‐receptor interaction analysis.     

A cross-linked anti-TNF-α aptamer for neutralization of TNF-α-induced cutaneous Shwartzman phenomenon: A simple and novel approach for improving aptamers' affinity and efficiency

To increase the efficiency of aptamers to their targets, a simple and novel method has been developed based on aptamer oligomerization. To this purpose, previously anti-human TNF-α aptamer named T1–T4 was trimerized through a trimethyl aconitate core for neutralization of in vitro and in vivo of TNF-α. At first, 54 mer T1–T4 aptamers with 5′-NH₂ groups were covalently coupled to three ester residues in the trimethyl aconitate. In vitro activity of novel anti-TNF-α aptamer and its dissociation constant (K_d) was done using the L929 cell cytotoxicity assay. In vivo anti-TNF-α activity of new oligomerized aptamer was assessed in a mouse model of cutaneous Shwartzman. Anchoring of three T1–T4 aptamers to trimethyl aconitate substituent results in formation of the 162 mer fragment, which was well revealed by gel electrophoresis. In vitro study indicated that the trimerization of T1–T4 aptamer significantly improved its anti-TNF-α activity compared to non-modified aptamers (P < 0.0001) from 40% to 60%. The determination of K_d showed that trimerization could effectively enhance K_d of aptamer from 67 nM to 36 nM. In vivo study showed that trimer aptamer markedly reduced mean scar size from 15.2 ± 1.2 mm to 1.6 ± 0.1 mm (P < 0.0001), which prevent the formation of skin lesions. In vitro and in vivo studies indicate that trimerization of anti-TNF-α aptamer with a novel approach could improve the anti-TNF-α activity and therapeutic efficacy. According to our findings, a new anti-TNF-α aptamer described here could be considered an appropriate therapeutic agent in treating several inflammatory diseases.     

MOF@Au NPs/aptamer fluorescent probe for the selective and sensitive detection of thiamethoxam

The luminescence performance of fluorescent reagents plays a crucial role in fluorescence analysis. Therefore, in this study, a novel bi-ligand Zn-based metal–organic framework, Au nanoparticle (NP) fluorescent material was synthesized using a hydrothermal method with Zn as the metal source. Simultaneously, a DNA aptamer was introduced as a molecular recognition element to develop a Zn-based MOF@Au NPs/DNA aptamer fluorescent probe for the ultra-trace detection of thiamethoxam residues in agricultural products. The probe captured different concentrations of the target molecule, thiamethoxam, through the DNA aptamer, causing a conformational change in the DNA aptamer and bursting the fluorescence of the probe, therefore establishing a fluorometric method for thiamethoxam detection. This method is highly sensitive due to the excellent luminescence properties of the Zn-based MOF@Au NPs, and the DNA aptamer can specifically recognize thiamethoxam, offering high selectivity. The linear range of the method was 2.5–6000 × 10⁻¹¹ mol L⁻¹, with a detection limit of 8.33 × 10⁻¹² mol L⁻¹. This method was applied to the determination of actual samples, such as bananas, and the spiked recovery rate was found to be in the range 84.05–109.07%. Overall, the proposed probe has high sensitivity, high selectivity, and easy operation for the detection of thiamethoxam residues in actual samples.     

Investigation of the interaction between split aptamer and vascular endothelial growth factor 165 using single molecule force spectroscopy

Understanding the binding of split aptamer/its target could become a breakthrough in the application of split aptamer. Herein, vascular endothelial growth factor (VEGF), a major biomarker of human diseases, was used as a model, and its interaction with split aptamer was explored with single molecule force spectroscopy (SMFS). SMFS demonstrated that the interaction force of split aptamer/VEGF₁₆₅ was 169.44 ± 6.59 pN at the loading rate of 35.2 nN/s, and the binding probability of split aptamer/VEGF₁₆₅ was dependent on the concentration of VEGF₁₆₅. On the basis of dynamic force spectroscopy results, one activation barrier in the dissociation process of split aptamer/VEGF₁₆₅ complexes was revealed, which was similar to that of the intact aptamer/VEGF₁₆₅. Besides, the dissociation rate constant (k_off) of split aptamer/VEGF₁₆₅ was close to that of intact aptamer/VEGF₁₆₅, and the interaction force of split aptamer/VEGF₁₆₅ was higher than the force of intact aptamer/VEGF₁₆₅. It indicated that split aptamer also possessed high affinity with VEGF₁₆₅. The work can provide a new method for exploring the interaction of split aptamer/its targets at single‐molecule level.     

A biophysical and computational study unraveling the molecular interaction mechanism of a new Janus kinase inhibitor Tofacitinib with bovine serum albumin

The interaction of a recently certified kinase inhibitor Tofacitinib (TFB) with bovine serum albumin (BSA) has been studied, by spectroscopic and molecular docking studies. Spectrofluorimetric measurements at 3 different temperatures (288, 298, and 310 K) showed that TFB quench the intrinsic fluorescence of BSA upon forming a nonfluorescent complex. The intrinsic fluorescence data showed that TFB binds to BSA with binding constant (K _b) of approximately 10⁴M⁻¹, affirming a significant affinity of TFB with BSA. The decrease in Stern‐Volmer quenching constant with increasing temperature exhibited the static mechanism of quenching. Negative value of ΔG (−6.94 ± 0.32 kcal·mol⁻¹), ΔH (−7.87 ± 0.52 kcal·mol⁻¹), and ΔS (−3.14 ± 0.42 cal·mol⁻¹·K⁻¹) at all 3 temperatures declared the reaction between BSA and TFB to be spontaneous and exothermic. Far‐UV circular dichroism spectroscopy results demonstrated an increase in helical content of BSA in the presence of TFB. Moreover, dynamic light scattering measurements showed that TFB resulted into a decrease in the hydrodynamic radii (from 3.6 ± 0.053 to 2.9 ± 0.02 nm) of BSA. Molecular docking studies confirmed that TFB binds near site II on BSA, hydrogen bonding, and hydrophobic interaction were involved in the BSA‐TFB complex formation. The present study characterizing the BSA‐TFB interaction could be significant towards gaining an insight into the drug pharmacokinetics and pharmacodynamics and also in the direction of rational drug designing with better competence, against emerging immune‐mediated diseases, ie, alopecia and rheumatoid arthritis.     

Antibody–aptamer functionalized fibre‐optic biosensor for specific detection of Listeria monocytogenes from food

Aim: To develop antibody–aptamer functionalized fibre‐optic biosensor for specific detection of Listeria monocytogenes from food products. Methods and Results: Aptamer, a single‐stranded oligonucleotide ligand that displays affinity for the target molecule, was used in the assay to provide sensor specificity. Aptamer‐A8, specific for internalin A, an invasin protein of L. monocytogenes, was used in the fibre‐optic sensor together with antibody in a sandwich format for detection of L. monocytogenes from food. Biotinylated polyclonal anti‐Listeria antibody, P66, was immobilized on streptavidin‐coated optical waveguide surface for capturing bacteria, and Alexa Fluor 647‐conjugated A8 was used as a reporter. The biosensor was able to selectively detect pathogenic Listeria in pure culture and in mixture with other bacteria at a concentration of approx. 10³ CFU ml^?1. This sensor also successfully detected L. monocytogenes cells from artificially contaminated (initial inoculation of 10² CFU 25 g^?1) ready‐to‐eat meat products such as sliced beef, chicken and turkey after 18 h of enrichment. Conclusion: Based on the data presented in this study, the antibody–aptamer functionalized fibre‐optic biosensor could be used as a detection tool for sensitive and specific detection of L. monocytogenes from foods. Significance and Impact of the Study: The study demonstrates feasibility and novel application of aptamer on fibre‐optic biosensor platform for the sensitive detection of L. monocytogenes from food products.     

Quantification of receptor targeting aptamer binding characteristics using single-molecule spectroscopy

This experimental design presents a single molecule approach based on fluorescence correlation spectroscopy (FCS) for the quantification of outer membrane proteins which are receptors to an aptamer specifically designed to target the surface receptors of live Salmonella typhimurium. By using correlation analysis, we also show that it is possible to determine the associated binding kinetics of these aptamers on live single cells. Aptamers are specific oligonucleotides designed to recognize conserved sequences that bind to receptors with high affinity, and therefore can be integrated into selective biosensor platforms. In our experiments, aptamers were constructed to bind to outer membrane proteins of S. typhimurium and were assessed for specificity against Escherichia coli. By fluorescently labeling aptamer probes and applying FCS, we were able to study the diffusion dynamics of bound and unbound aptamers and compare them to determine the dissociation constants and receptor densities of the bacteria for each aptamer at single molecule sensitivity. The dissociation constants for these aptamer probes calculated from autocorrelation data were 0.1285 and 0.3772 nM and the respective receptor densities were 42.27 receptors per µm² and 49.82 receptors per µm². This study provides ample evidence that the number of surface receptors is sufficient for binding and that both aptamers have a high‐binding affinity and can therefore be used in detection processes. The methods developed here are unique and can be generalized to examine surface binding kinetics and receptor quantification in live bacteria at single molecule sensitivity levels. The impact of this study is broad because our approach can provide a methodology for biosensor construction and calculation of live single cell receptor‐ligand kinetics in a variety of environmental and biological applications. Bioeng. 2011; 108:1222–1227. © 2010 Wiley Periodicals, Inc.     

Molecular recognition force spectroscopy study of the dynamic interaction between aptamer GBI‐10 and extracellular matrix protein tenascin‐C on human glioblastoma cell

Molecular recognition force spectroscopy (MR‐FS) was applied to investigate the dynamic interaction between aptamer GBI‐10 and tenascin‐C (TN‐C) on human glioblastoma cell surface at single‐molecule level. The unbinding force between aptamer GBI‐10 and TN‐C was 39 pN at the loading rate of 0.3 nN sec^?1. A series of kinetic parameters concerning interaction process such as the unbinding force f_u, the association rate constant k_on, dissociation rate constant at zero force k_off, and dissociation constant K_D for aptamer GBI‐10/TN‐C complexes were acquired. In addition, the interaction of aptamer GBI‐10 with TN‐C depended on the presence of Mg²⁺. This work demonstrates that MR‐FS can be used as an attractive tool for exploring the interaction forces and dynamic process of aptamer and ligand at the single‐molecule level. As a future perspective, MR‐FS may be used as a potential diagnostic and therapeutic tool by combining with other techniques. Copyright © 2012 John Wiley & Sons, Ltd.     

Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr‐activated sepharose‐4B affinity chromatography

Staphylococcus aureus are potent human pathogens possessing arsenal of virulence factors. Staphylococcal food poisoning (SFP) and respiratory infections mediated by staphylococcal enterotoxin B (SEB) are common clinical manifestations. Many diagnostic techniques are based on serological detection and quantification of SEB in different food and clinical samples. Aptamers are known as new therapeutic and detection tools which are available in different ssDNA, dsDNA and protein structures. In this study, we used a new set of ssDNA aptamers against SEB. The methods used included preparation of a dsDNA library using standard SEB protein as the target analyte, affinity chromatography matrix in microfuge tubes, SELEX procedures to isolate specific ssDNA‐aptamer as an affinity ligand, aptamer purification using ethanol precipitation method, affinity binding assay using ELISA, aptamer cloning and specificity test. Among 12 readable sequences, three of them were selected as the most appropriate aptamer because of their affinity and specificity to SEB. This study presents a new set of ssDNA aptamer with favorable selectivity to SEB through 12 rounds of SELEX. Selected aptamers were used to detect SEB in infected serum samples. Results showed that SEB c1 aptamer (2 µg SEB/100 nM aptamer) had favorable specificity to SEB (k_d = 2.3 × 10^?11). In conclusion, aptamers can be considered as useful tools for detecting and evaluating SEB. The results showed that affinity chromatography was an affordable assay with acceptable accuracy to isolate sensitive and selective novel aptamers. Copyright © 2016 John Wiley & Sons, Ltd.     

Insight into the molecular recognition of spermine by DNA quadruplexes from an NMR study of the association of spermine with the thrombin‐binding aptamer

The preferred residence sites and the conformation of DNA‐bound polyamines are central to understanding the regulatory roles of polyamines. To this end, we have used a series of selective ¹³C‐edited and selective total correlation spectroscopy‐edited one‐dimensional (1D) nuclear Overhauser effect spectroscopy NMR experiments to determine a number of intramolecular ¹H nuclear Overhauser effect (NOE) connectivities in ¹³C‐labelled spermine bound to the thrombin‐binding aptamer. The results provide evidence that the aptamer‐bound spermine adopts a conformation that optimizes electrostatic and hydrogen bond contacts with the aptamer backbone. The distance between the nitrogen atoms of the central aminobutyl is reduced by an increase in the population of gauche conformers at the C6–C7 bonds, which results in either a curved or S‐shaped spermine conformation. Molecular modelling contributes insight toward the mode of spermine binding of these spermine structures within the narrow grooves of DNA quadruplexes. In each case, the N5 ammonium group makes hydrogen bonds with two nearby phosphates across the narrow groove. Our results have implications for the understanding of chromatin structure and the rational design of quadruplex‐binding drugs. Copyright © 2013 John Wiley & Sons, Ltd.     

Uptake kinetics and storage capacity of dissolved inorganic phosphorus and corresponding dissolved inorganic nitrate uptake in Saccharina latissima and Laminaria digitata (Phaeophyceae)

Uptake rates of dissolved inorganic phosphorus and dissolved inorganic nitrogen under unsaturated and saturated conditions were studied in young sporophytes of the seaweeds Saccharina latissima and Laminaria digitata (Phaeophyceae) using a “pulse‐and‐chase” assay under fully controlled laboratory conditions. In a subsequent second “pulse‐and‐chase” assay, internal storage capacity (ISC) was calculated based on V_M and the parameter for photosynthetic efficiency F_v/F_m. Sporophytes of S. latissima showed a V_S of 0.80 ± 0.03 μmol · cm^?2 · d^?1 and a V_M of 0.30 ± 0.09 μmol · cm^?2 · d^?1 for dissolved inorganic phosphate (DIP), whereas V_S for DIN was 11.26 ± 0.56 μmol · cm^?2 · d^?1 and V_M was 3.94 ± 0.67 μmol · cm^?2 · d^?1. In L. digitata, uptake kinetics for DIP and DIN were substantially lower: V_S for DIP did not exceed 0.38 ± 0.03 μmol · cm^?2 · d^?1 while V_M for DIP was 0.22 ± 0.01 μmol · cm^?2 · d^?1. V_S for DIN was 3.92 ± 0.08 μmol · cm^?2 · d^?1 and the V_M for DIN was 1.81 ± 0.38 μmol · cm^?2 · d^?1. Accordingly, S. latissima exhibited a larger ISC for DIP (27 μmol · cm^?2) than L. digitata (10 μmol · cm^?2), and was able to maintain high growth rates for a longer period under limiting DIP conditions. Our standardized data add to the physiological understanding of S. latissima and L. digitata, thus helping to identify potential locations for their cultivation. This could further contribute to the development and modification of applications in a bio‐based economy, for example, in evaluating the potential for bioremediation in integrated multitrophic aquacultures that produce biomass simultaneously for use in the food, feed, and energy industries.     

Interaction of 3’-O-caffeoyl D-quinic acid with multisubunit protein helianthinin

Chlorogenic acid, 3’-O-caffeoyl D-quinic acid, is an inherent ligand present inHelianthus annuus L. The effect of pH on chlorogenic acid binding to helianthinin suggests that maximum binding occurs at pH 6.0. The protein-polyphenol complex precipitates as a function of time. The association constant of the binding of chlorogenic acid to helianthinin, determined by equilibrium dialysis, at 31°C has a value of 3.5 ± 0.1 × 10⁴M^−-1 resulting in a ΔG value of − 6.32 ± 0.12 kcal /mol. The association constantK _ais 1.0 ± 0.1 × 10⁴M⁻¹ as determined by ultraviolet difference spectral titration at 25°C with ΔG° of -5.46 ± 0.06 kcal/mol. From fluorescence spectral titration at 28°C, theK _avalue is 1.38 ± 0.1 × 1 0 4M⁻¹ resulting in a ΔG of − 5.70 ± 0.05 kcal/mol. The total number of binding sites on the protein are 420 ± 50 as calculated from equilibrium dialysis. Microcalorimetric data of the ligand-protein interaction at 23°C suggests mainly two classes of binding. The thermal denaturation temperature,T _mof the protein decreases from 76°C to 72°C at 1 × 10⁻³M chlorogenic acid concentration upon complexation. This suggests that the complexation destabilizes the protein. The effect of temperature onK _aof chlorogenic acid shows a nonlinear increase from 10.2°C to 45°C. Chemical modification of both lysyl and tryptophanyl residues of the protein decreases the strength of binding of chlorogenic acid. Lysine, tryptophan and tyrosine of protein are shown to be present at the binding site. Based on the above data, it is suggested that charge-transfer complexation and entropically driven hydrophobic interaction are the predominant forces that are responsible for binding of chlorogenic acid to the multisubunit protein, helianthinin. Publication No. 324.     

Binding of 4-methyl umbelliferyl-α-D-glucoPyranoside to Vicia faba lectin: Fluorescence-quenching studies

On binding toVicia faba lectin, the fluorescence of 4-methylumbelliferyl-α-D-glucoPyranoside was quantitatively quenched showing that the interaction of 4-methylumbelliferyl-α-D-glucoPyranoside took Place in a binding environment. The binding of the fluorescent sugar was saccharide sPecific as evidenced by the reversal of 4-methylumbelliferyl-α-D-glucoPyranoside fluorescence quenching by D-fructose. The association constant,K _a, values for the 4-methylumbelliferyl-α-D-glucoPyranoside was determined by comPetition study emPloying reversal of fluorescence quenching of 4-methylumbelliferyl-α-D-glucoPyranoside by D-fructose. TheK _a value obtained for D-fructose was 1.07 ±0.03 X 10⁴ M^-1 and for 4-methylumbelliferyl-α-D-glucoPyranoside was 1.60 ±0.05 X 10⁴ M^-1 at 15°C. TheK _a values of 2.51 ±0.06 X 10⁴M^-1, l.26 ±0.02 X 10⁴ M^-1 and 0.56 ±0.01 X 10⁴M^-1, resPectively at 10°, 20° and 30°C were obtained from the ChiPman equation. The relative fluorescence quenching, ΔF _a, at infinite concentration of the free saccharide sites ofVicia faba lectin [P′] was 93.5% at 30°C and the binding constant for 4-methylumbelliferyl-α-D-glucoPyranoside lectin interaction as derived by Yank and Hanaguchi equation was 0.63 ±0.01 X 10⁴M^-1.     

In vitro selection of sialic acid specific RNA aptamer and its application to the rapid sensing of sialic acid modified sugars

Sialic acids (SAs) are located on the terminal positions of glycan on a cell surface, which play important role in the spread and metastasis of cancer cells and infection of pathogen. For their detection and diagnosis, the finding of SA specific ligand is an essential prerequisite. Here, RNA aptamer for N‐acetylneuraminic acid (Neu5Ac), a representative of SAs, with the high affinity of 1.35 nM and the selectivity was screened by in vitro selection method. The strong binding of the screened aptamer was enough to protect the hydrolysis of Neu5Ac by neuraminidase with the stoichiometry of 1:1 molar ratio. For the rapid detection of SAs, the RNA aptamer was further engineered to the aptazyme sensor by conjugating with a ribozyme following the characterization of selected aptamer by RNase footprinting assay. Without additional desialylation, modification, or/and purification processes, the aptazyme indicated high catalytic activities in the presence of Neu5Ac over 20 µM in several minutes. Also, we observed that the aptazyme sensor shows high sensitivities to Neu5Ac‐conjugated sugars as well as Neu5Ac monomer, but not in non‐Neu5Ac modified sugars. The aptamer for Neu5Ac can support valuable tools in a wide range of bioanalytical applications as well as biosensors. Biotechnol. Bioeng. 2013; 110: 905–913. © 2012 Wiley Periodicals, Inc.     

Production of polycaprolactone nanoparticles with hydrodynamic diameters below 100 nm

Cancer is a worldwide increasing burden and its therapy is often challenging and causes severe side effects in healthy tissue. If drugs are loaded into nanoparticles, side effects can be reduced, and efficiency can be increased via the enhanced permeability and retention effect. This effect is based on the fact that nanoparticles with sizes from 10 to 200 nm can accumulate in tumor tissue due to their leaky vasculature. In this work, we produced polycaprolactone (PCL) in the sizes 1.8, 5.4, and 13.6 kDa and were able to produce spherical shaped nanoparticles with mean diameters of 64 ± 19 nm out of the PCL_5.4 and 45 ± 8 nm out of the PCL_13.6 reproducibly. By encapsulation of paclitaxel the diameter of that nanoparticles did not increase, and we were able to encapsulate 73 ± 7 fmol paclitaxel per 1000 particles in the PCL_5.4‐nanoparticles and 35 ± 8 fmol PTX per 1000 PCL_13.6‐nanoparticles. Furthermore, we coupled the aptamer S15 to preformed PCL_5.4‐nanoparticles resulting in particles with a hydrodynamic diameter of 153 nm. This offers the opportunity to use these nanoparticles for targeted drug delivery.     

Interconvertible Kinetic States of t-Butylbicycloorthobenzoate Binding Sites of the γ-Aminobutyric AcidA Ionophores

The kinetics of t-[³H]butylbicycloorthobenzoate (TBOB) binding to the convulsant sites of the γ-aminobutyric acid_A (GABA_A) receptor-ionophore complex were examined in synaptosomal membrane preparations of rat brain. On and off rates of TBOB binding were accelerated by 1 μM GABA and decelerated by 1 μM bicuculline methochloride, a GABA_A antagonist. The presence of GABA and bicuculline methochloride created rapid and slow phases of dissociation, respectively. The three groups of rate constants distinguished for the dissociation of 4 nM and 30 nM [³H]TBOB represent multiaffinity states of the convulsant sites depending on the presence of GABA or bicuculline methochloride. Apparent association rate constants do not obey the equation k_app=k_off±k_on [TBOB] without assuming interconvertibility of the kinetic states during binding. Avermectin B_1a (AVM B_1a), a chloride channel opening agent, accelerated the association and dissociation of TBOB and resulted in a biphasic effect on TBOB binding, i.e., enhancement at low concentrations (EC₅₀, 7.8 nM) followed by displacement at high concentrations (IC₅₀ 6.3 μM) of AVM B_1a. AVM B_1a resulted in similar biphasic effects on t- [³⁵S]butylbicyclophosphorothionate binding. DIDS, an isothiocyanatostilbene derivative with irreversible anion channel blocking effect, selectively inhibited basal [³H]TBOB binding (IC₅₀ 125 μM DIDS) leaving the enhancement by AVM B_1a unaffected.