Transgene integration in aspen: structures of integration sites and mechanism of T-DNA integration

To obtain insight into the mechanism of transferred DNA (T-DNA) integration in a long-lived tree system, we analysed 30 transgenic aspen lines. In total, 27 right T-DNA/plant junctions, 20 left T-DNA/plant junctions, and 10 target insertions from control plants were obtained. At the right end, the T-DNA was conserved up to the cleavage site in 18 transgenic lines (67%), and the right border repeat was deleted in nine junctions. Nucleotides from the left border repeat were present in 19 transgenic lines out of 20 cases analysed. However, only four (20%) of the left border ends were conserved to the processing end, indicating that the T-DNA left and right ends are treated mechanistically differently during the T-DNA integration process. Comparison of the genomic target sites prior to integration to the T-DNA revealed that the T-DNA inserted into the plant genome without any notable deletion of genomic sequence in three out of 10 transgenic lines analysed. However, deletions of DNA ranging in length from a few nucleotides to more than 500 bp were observed in other transgenic lines. Filler DNAs of up to 235 bp were observed on left and/or right junctions of six transgenic lines, which in most cases originated from the nearby host genomic sequence or from the T-DNA. Short sequence similarities between recombining strands near break points, in particular for the left T-DNA end, were observed in most of the lines analysed. These results confirm the well-accepted T-DNA integration model based on single-stranded annealing followed by ligation of the right border which is preserved by the VirD2 protein. However, a second category of T-DNA integration was also identified in nine transgenic lines, in which the right border of the T-DNA was partly truncated. Such integration events are described via a model for the repair of genomic double-strand breaks in somatic plant cells based on synthesis-dependent strand-annealing. This report in a long-lived tree system provides major insight into the mechanism of transgene integration.     

The DNA sequences of T-DNA junctions suggest that complex T-DNA loci are formed by a recombination process resembling T-DNA integration

After Agrobacterium-mediated plant transformation, multiple T-DNAs frequently integrate at the same position in the plant genome, resulting in the formation of inverted and direct repeats. Because these inverted repeats cannot be amplified and analyzed by PCR, Arabidopsis root cells were co-transformed with two different T-DNAs with distinct sequences adjacent to the T-DNA borders. Nine direct or inverted T-DNA border junctions were analyzed at the sequence level. Precise end-to-end fusions were found between two right border ends, whereas imprecise fusions and filler DNA were present in T-DNA linkages containing a left border end. The results suggest that end-to-end ligation of double-stranded T-DNAs occurs especially between right T-DNA ends and that illegitimate recombination on the basis of microhomology, deletions, repair activities and insertions of filler DNA is involved in the formation of left border T-DNA junctions. Therefore, a similar illegitimate recombination mechanism is proposed that is involved in the formation of complex T-DNA inserts as well as in the integration of the T-DNA in the plant genome.     

T-DNA integration in Arabidopsis chromosomes. Presence and origin of filler DNA sequences

To investigate the relationship between T-DNA integration and double-stranded break (DSB) repair in Arabidopsis, we studied 67 T-DNA/plant DNA junctions and 13 T-DNA/T-DNA junctions derived from transgenic plants. Three different types of T-DNA-associated joining could be distinguished. A minority of T-DNA/plant DNA junctions were joined by a simple ligation-like mechanism, resulting in a junction without microhomology or filler DNA insertions. For about one-half of all analyzed junctions, joining of the two ends occurred without insertion of filler sequences. For these junctions, microhomology was strikingly combined with deletions of the T-DNA ends. For the remaining plant DNA/T-DNA junctions, up to 51-bp-long filler sequences were present between plant DNA and T-DNA contiguous sequences. These filler segments are built from several short sequence motifs, identical to sequence blocks that occur in the T-DNA ends and/or the plant DNA close to the integration site. Mutual microhomologies among the sequence motifs that constitute a filler segment were frequently observed. When T-DNA integration and DSB repair were compared, the most conspicuous difference was the frequency and the structural organization of the filler insertions. In Arabidopsis, no filler insertions were found at DSB repair junctions. In maize (Zea mays) and tobacco (Nicotiana tabacum), DSB repair-associated filler was normally composed of simple, uninterrupted sequence blocks. Thus, although DSB repair and T-DNA integration are probably closely related, both mechanisms have some exclusive and specific characteristics.     

T-DNA integration: a mode of illegitimate recombination in plants.

Transferred DNA (T-DNA) insertions of Agrobacterium gene fusion vectors and corresponding insertional target sites were isolated from transgenic and wild type Arabidopsis thaliana plants. Nucleotide sequence comparison of wild type and T-DNA-tagged genomic loci showed that T-DNA integration resulted in target site deletions of 29-73 bp. In those cases where integrated T-DNA segments turned out to be smaller than canonical ones, the break-points of target deletions and T-DNA insertions overlapped and consisted of 5-7 identical nucleotides. Formation of precise junctions at the right T-DNA border, and DNA sequence homology between the left termini of T-DNA segments and break-points of target deletions were observed in those cases where full-length canonical T-DNA inserts were very precisely replacing plant target DNA sequences. Aberrant junctions were observed in those transformants where termini of T-DNA segments showed no homology to break-points of target sequence deletions. Homology between short segments within target sites and T-DNA, as well as conversion and duplication of DNA sequences at junctions, suggests that T-DNA integration results from illegitimate recombination. The data suggest that while the left T-DNA terminus and both target termini participate in partial pairing and DNA repair, the right T-DNA terminus plays an essential role in the recognition of the target and in the formation of a primary synapsis during integration.     

CRISPR/Cas9-mediated targeted T-DNA integration in rice

Key message

Combining with a CRISPR/Cas9 system, Agrobacterium-mediated transformation can lead to precise targeted T-DNA integration in the rice genome.

Abstract

Agrobacterium-mediated T-DNA integration into the plant genomes is random, which often causes variable transgene expression and insertional mutagenesis. Because T-DNA preferentially integrates into double-strand DNA breaks, we adapted a CRISPR/Cas9 system to demonstrate that targeted T-DNA integration can be achieved in the rice genome. Using a standard Agrobacterium binary vector, we constructed a T-DNA that contains a CRISPR/Cas9 system using SpCas9 and a gRNA targeting the exon of the rice AP2 domain-containing protein gene Os01g04020. The T-DNA also carried a red fluorescent protein and a hygromycin resistance (hptII) gene. One version of the vector had hptII expression driven by an OsAct2 promoter. In an effort to detect targeted T-DNA insertion events, we built another T-DNA with a promoterless hptII gene adjacent to the T-DNA right border such that integration of T-DNA into the targeted exon sequence in-frame with the hptII gene would allow hptII expression. Our results showed that these constructs could produce targeted T-DNA insertions with frequencies ranging between 4 and 5.3% of transgenic callus events, in addition to generating a high frequency (50?80%) of targeted indel mutations. Sequencing analyses showed that four out of five sequenced T-DNA/gDNA junctions carry a single copy of full-length T-DNA at the target site. Our results indicate that Agrobacterium-mediated transformation combined with a CRISPR/Cas9 system can efficiently generate targeted T-DNA insertions.

     

T-DNA integration patterns in transgenic tobacco plants

To investigate the various integration patterns of T-DNA generated by infection withAgrobacterium, we developed a vector (pRCV2) for the effective T-DNA tagging and applied it to tobacco (Nicotiana tabacum cv. Havana SR1). pRCV2 was constructed for isolating not only intact T-DNA inserts containing both side borders of T-DNA, but also for partial T-DNA inserts that comprise only the right or left side. We also designed PCR confirmation primer sets that can amplify in several important regions within pRCV2 to detect various unpredictable integration patterns. These can also be used for the direct inverse PCR. Leaf disks of tobacco were transformed withAgrobacterium tumefaciens LBA4404 harboring pRCV2. PCR and Southern analysis revealed the expected 584 bp product for thehpt gene as well as one of 600 bp for thegus gene in all transformants; one or two copies were identified for these integrated genes. Flanking plant genomic DNA sequences from the transgenic tobacco were obtained via plasmid rescue and then sequenced. Abnormal integration patterns in the tobacco genome were found in many transgenic lines. Of the 17 lines examined, 11 contained intact vector backbone; a somewhat larger deletion of the left T-DNA portion was encountered in 4 lines. Because nicking sites at the right border showed irregular patterns when the T-DNA was integrated, it was difficult to predict the junction regions between the vector and the flanking plant DNA.     

Site-specific integration of Agrobacterium tumefaciens T-DNA via double-stranded intermediates

Agrobacterium tumefaciens-mediated genetic transformation involves transfer of a single-stranded T-DNA molecule (T strand) into the host cell, followed by its integration into the plant genome. The molecular mechanism of T-DNA integration, the culmination point of the entire transformation process, remains largely obscure. Here, we studied the roles of double-stranded breaks (DSBs) and double-stranded T-DNA intermediates in the integration process. We produced transgenic tobacco (Nicotiana tabacum) plants carrying an I-SceI endonuclease recognition site that, upon cleavage with I-SceI, generates DSB. Then, we retransformed these plants with two A. tumefaciens strains: one that allows transient expression of I-SceI to induce DSB and the other that carries a T-DNA with the I-SceI site and an integration selection marker. Integration of this latter T-DNA as full-length and I-SceI-digested molecules into the DSB site was analyzed in the resulting plants. Of 620 transgenic plants, 16 plants integrated T-DNA into DSB at their I-SceI sites; because DSB induces DNA repair, these results suggest that the invading T-DNA molecules target to the DNA repair sites for integration. Furthermore, of these 16 plants, seven plants incorporated T-DNA digested with I-SceI, which cleaves only double-stranded DNA. Thus, T-strand molecules can be converted into double-stranded intermediates before their integration into the DSB sites within the host cell genome.     

Molecular characterization of T-DNA integration sites in transgenic birch

The integration and structure of a transgene locus can have profound effects on the level and stability of transgene expression. We screened 28 transgenic birch (Betula platyphylla Suk.) lines transformed with an insect-resistance gene (bgt) using Agrobacterium tumefaciens. Among the transgenic plants, the copy number of transgene varied from one to four. A rearrangement or partial deletion had occurred in the process of T-DNA integration. T-DNA repeat formation, detected by reverse primer PCR, was found among randomly screened transgenic lines. Sequencing of the junctions between the T-DNA inserts revealed deletions of 19–589 bp and an additional 45 bp filler DNA sequence was inserted between the T-DNA repeats at one junction. Micro-homologous sequences (1–6 bp) were observed in the junctions between the T-DNA inserts. Using SiteFinding-PCR, a relatively high percentage of AT value was found for the flanking regions. Deletion of the right border repeat was observed in 12/18 of the T-DNA/plant junctions analyzed. The number of nucleotides deleted varied from 3 to 712. Deletions of 17–89 bp were observed in all left T-DNA/plant junctions analyzed. A vector backbone DNA sequence in the transgene loci was also detected using primer pairs outside the left and right T-DNA borders. Approximately 89.3% of the lines contained some vector backbone DNA. These observations revealed that it is important to check the specificity of the integration. A mechanism of T-DNA transport and integration is proposed for this long-lived tree species.     

DNA rearrangement associated with the integration of T-DNA in tobacco: an example for multiple duplications of DNA around the integration target

Transferred DNA (T-DNA) of the tumor-inducing (Ti) plasmid is transferred from Agrobacterium tumefaciens to plant cells and is stably integrated into the plant nuclear genome. By the inverse polymerase chain reaction DNA fragments were amplified that contained the T-DNA/plant DNA junctions from the total DNA of a transgenic tobacco plant that had a single copy of the T-DNA in a repetitive region of its genome. A DNA fragment containing the target site was amplified from the total DNA of non-transformed tobacco by the polymerase chain reaction using high-stringency conditions. Comparison of the nucleotide sequence of the target site with those of the T-DNA/plant DNA junctions revealed that various duplications of short stretches of nucleotide sequences around the target and in the incoming T-DNA had accompanied the integration of the T-DNA. A deletion of 16 bp at the target site was also found and the target site was similar, in terms of nucleotide sequence, to regions around the breakpoints of the T-DNA. This finding provides a clear example of the occurrence of complex rearrangements during the integration of T-DNA.     

T-DNA recombination and replication in maize cells

T-DNA recombination and replication was analyzed in 'black mexican sweet' (BMS) cells transformed with T-DNAs containing the replication system from wheat dwarf virus (WDV). Upon recombination between the T-DNA ends, a promoterless marker gene (gusA) was activated. Activation of the recombination marker gene was delayed and increased exponentially over time, suggesting that recombination and amplification of the T-DNA occurred in maize cells. Mutant versions of the viral initiator gene (rep), known to be defective in the replication function, failed to generate recoverable recombinant T-DNA molecules. Circularization of T-DNA by the FLP/FRT site-specific recombination system and/or homologous recombination was not necessary to recover circular T-DNAs. However, replicating T-DNAs appeared to be suitable substrates for site-specific and homologous recombination. Among 33 T-DNA border junctions sequenced, only one pair of identical junction sites was found implying that the population of circular T-DNAs was highly heterogenous. Since no circular T-DNA molecules were detected in treatments without rep, it suggested that T-DNA recombination was linked to replication and might have been stimulated by this process. The border junctions observed in recombinant T-DNA molecules were indicative of illegitimate recombination and were similar to left-border recombination of T-DNA into the genome after Agro-mediated plant transformation. However, recombination between T-DNA molecules differed from T-DNA/genomic DNA junction sites in that few intact right borders were observed. The replicating T-DNA molecules did not enhance genomic random integration of T-DNA in the experimental configuration used for this study.     

Analysis of integration sites of T-DNA insertions in transgenic tobacco plants

DNA fragments containing T-DNA/plant DNA junctions isolated from 17 transgenic tobacco plants were amplified using inverse PCR. Analysis of the nucleotide sequences of 34 cloned DNA fragments revealed 100% homology with vector sequences outside T-DNA in 10 cases. Nine nucleotide sequences had homology with the repeats in the tobacco genome. The percentage of homology varied from 70 to 90%, with the identified repeats belonging to different types. In most clones no homology was revealed with the GENEBANK sequences. Alignment of the sequences truncated during the integration of the left and the right borders of the T-DNA insertions demonstrated significant clusterization (10 bp region) of truncation sites for the left border. Five sequences had identical truncation sites (+23 T) that showed the perferable use of this nucleotide. The AT content varied from 51 to 72% which was close to the total percentage of AT pairs in the tobacco genome.     

Characterization of T-DNA insertions in transgenic grapevines obtained by Agrobacterium-mediated transformation

T-DNA integration patterns in 49 transgenic grapevines produced via Agrobacterium-mediated transformation were analyzed. Inverse PCR (iPCR) was performed to identify T-DNA/plant junctions. Sequence comparison revealed several deletions in the T-DNA right border (RB) and left border (LB), and filler DNA and duplications or deletions of grapevine DNA at the T-DNA insertion loci. In 20 T-DNA/grapevine genome junctions microsimilarities were found associated with the joining points and in all grapevine lines microsimilarities were present near the breaking points along the 30 bases of T-DNA adjacent to the two borders. Analysis of target site preferences of T-DNA insertions indicated a non-random distribution of the T-DNA, with a bias toward the intron regions of the grapevine genes. Compositional analysis of grapevine DNA around the T-DNA insertion sites revealed an inverse relationship between the CG and AT-skews and AT rich sequences present at 300–500 bp upstream the insertion points, near the RB of the T-DNA. PCR assays showed that vector backbone sequences were integrated in 28.6% of the transgenic plants analyzed and multiple T-DNAs frequently integrated at the same position in the plant genome, resulting in the formation of tandem and inverted repeats.     

Capture of genomic and T-DNA sequences during double-strand break repair in somatic plant cells.

To analyze genomic changes resulting from double-strand break (DSB) repair, transgenic tobacco plants were obtained that carried in their genome a restriction site of the rare cutting endonuclease I-SceI within a negative selectable marker gene. After induction of DSB repair via Agrobacterium-mediated transient expression of I-SceI, plant cells were selected that carried a loss-of-function phenotype of the marker. Surprisingly, in addition to deletions, in a number of cases repair was associated with the insertion of unique and repetitive genomic sequences into the break. Thus, DSB repair offers a mechanism for spreading different kinds of sequences into new chromosomal positions. This may have evolutionary consequences particularly for plants, as genomic alterations occurring in meristem cells can be transferred to the next generation. Moreover, transfer DNA (T-DNA), carrying the open reading frame of I-SceI, was found in several cases to be integrated into the transgenic I-SceI site. This indicates that DSB repair also represents a pathway for the integration of T-DNA into the plant genome.     

High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.     

The Arabidopsis AtLIG4 gene is required for the repair of DNA damage,but not for the integration of Agrobacterium T-DNA

The joining of breaks in the chromosomal DNA backbone by ligases in processes of replication, recombination and repair plays a crucial role in the maintenance of genomic stability. Four ATP-dependent ligases, designated DNA ligases I–IV, have been identified in higher eukaryotes, and each one has distinct functions. In mammals and yeast, DNA ligase IV is exclusively involved in the repair of DNA double-strand breaks by non-homologous end joining. Recently, an Arabidopsis thaliana orthologue of the yeast and mammalian DNA ligase IV gene was found and termed AtLIG4. Here we describe the isolation and functional characterisation of a plant line with a T-DNA insertion in the AtLIG4 gene. Plants homozygous for the T-DNA insertion did not display any growth or developmental defects and were fertile. However, mutant seedlings were hypersensitive to the DNA-damaging agents methyl methanesulfonate and X-rays, demonstrating that AtLIG4 is required for the repair of DNA damage. Recently, we showed that a yeast lig4 mutant is deficient in Agrobacterium T-DNA integration. However, using tumorigenesis and germline transformation assays, we found that the plant AtLIG4 mutant is not impaired in T-DNA integration. Thus, in contrast to yeast, DNA ligase IV is not required for T-DNA integration in plants.     

Nonhomologous end joining and homologous recombination DNA repair pathways in integration mutagenesis in the xylose-fermenting yeast Pichia stipitis

Pichia stipitis integrates linear homologous DNA fragments mainly ectopically. High rates of randomly occurring integration allow tagging mutagenesis with high efficiency using simply PCR amplificates of suitable selection markers from the P. stipitis genome. Linearization of an autonomously replicating vector caused a distinct increase of the transformation efficiency compared with the circular molecule. Cotransformation of a restriction endonuclease further enhanced the transformation efficiency. This effect was also observed with integrative vector DNA. In most cases vector integration in chromosomal targets did not depend on microhomologies, indicating that restriction-enzyme-mediated integration (REMI) does not play an essential role in P. stipitis. Small deletions were observed at the ends of the integrated vectors and in the target sites. Disruption of the PsKU80 gene increased the frequency of homologous integration considerably but resulted in a remarkable decrease of the transformation efficiency. These results suggest that in P. stipitis the nonhomologous end joining (NHEJ) pathway obviously predominates the homologous recombination pathway of double-strand break repair.     

Genome-wide analysis of T-DNA integration into the chromosomes of Magnaporthe oryzae

Agrobacterium tumefaciens-mediated transformation (ATMT) has become a prevalent tool for functional genomics of fungi, but our understanding of T-DNA integration into the fungal genome remains limited relative to that in plants. Using a model plant-pathogenic fungus, Magnaporthe oryzae, here we report the most comprehensive analysis of T-DNA integration events in fungi and the development of an informatics infrastructure, termed a T-DNA analysis platform (TAP). We identified a total of 1110 T-DNA-tagged locations (TTLs) and processed the resulting data via TAP. Analysis of the TTLs showed that T-DNA integration was biased among chromosomes and preferred the promoter region of genes. In addition, irregular patterns of T-DNA integration, such as chromosomal rearrangement and readthrough of plasmid vectors, were also observed, showing that T-DNA integration patterns into the fungal genome are as diverse as those of their plant counterparts. However, overall the observed junction structures between T-DNA borders and flanking genomic DNA sequences revealed that T-DNA integration into the fungal genome was more canonical than those observed in plants. Our results support the potential of ATMT as a tool for functional genomics of fungi and show that the TAP is an effective informatics platform for handling data from large-scale insertional mutagenesis.     

Association of Arabidopsis topoisomerase IIA cleavage sites with functional genomic elements and T-DNA loci

Topoisomerase IIA (Topo IIA) is an essential ubiquitous enzyme involved in controlling DNA topology during multiple processes of genome function, and has been implicated in the generation of double-stranded breaks (DSB) in genomic DNA prior to DNA integration in plant genomes. Despite extensive characterization of type II topoisomerases from bacteria, viruses and animals, no studies on the specificity of plant Topo IIA-mediated DNA cleavage have been reported. We mapped and characterized Arabidopsis thaliana Topo IIA (AtTopoIIA) cleavage sites and demonstrated that they were cleaved in vivo. The consensus for the AtTopoIIA cleavage sites (ANNNRN downward arrowGTACNTNNNY) was significantly different from recognition sequences reported for Topo IIA from other organisms. The mapped cleavage sites were abundant in the Arabidopsis genome, exhibited a weak consensus, and were cleaved with relatively low efficiency. Use of the systematic evolution of ligands by exponential enrichment (SELEX) protocol identified a single, efficiently cleaved sequence TATATATATGTATATATATA that was over-represented in the genome. The mapped AtTopoIIA cleavage sites and the SELEX sites differed in their genomic distribution and associations with gene regulatory elements, matrix attachment regions, stress-induced DNA duplex destabilization sequences and T-DNA loci, suggesting different genome functions. Mapped AtTopoIIA sites but not SELEX sites were strongly associated with T-DNA integration sites, providing evidence for the involvement of AtTopoIIA-mediated DSB formation in T-DNA integration.