Mechanism and timing of mitotic rearrangements in the subtelomeric D4Z4 repeat involved in facioscapulohumeral muscular dystrophy

Autosomal dominant facioscapulohumeral muscular dystrophy (FSHD1A) is associated with contractions of the polymorphic D4Z4 repeat on chromosome 4qter. Almost half of new FSHD mutations occur postfertilization, resulting in somatic mosaicism for D4Z4. Detailed D4Z4 analysis of 11 mosaic individuals with FSHD revealed a mosaic mixture of a contracted FSHD-sized allele and the unchanged ancestral allele in 8 cases, which is suggestive of a mitotic gene conversion without crossover. However, in 3 cases, the D4Z4 rearrangement resulted in two different-sized D4Z4 repeats, indicative of a gene conversion with crossover. In all cases, DNA markers proximal and distal to D4Z4 showed no allelic exchanges, suggesting that all rearrangements were intrachromosomal. We propose that D4Z4 rearrangements occur via a synthesis-dependent strand annealing model that relatively frequently allows for crossovers. Furthermore, the distribution of different cell populations in mosaic patients with FSHD suggests that mosaicism here results from D4Z4 rearrangements occurring during the first few zygotic cell divisions after fertilization.     

Genetic confirmation of facioscapulohumeral muscular dystrophy in a case with complex D4Z4 rearrangments

Facioscapulohumeral muscular dystrophy (FSHD) is caused by contraction of the D4Z4 repeat on chromosome 4q. Genetic confirmation of the clinical diagnosis of FSHD is complicated by the presence of a homologous repeat on chromosome 10q and the frequent repeat exchanges between both chromosomes. Here, we describe the genetic evaluation of an FSHD patient with a complex D4Z4 allele constitution in which the potentially pathogenic allele seemingly resides on chromosome 10, despite FSHD being exclusively linked to chromosome 4. Complementary allele typing and segregation analysis confirmed the clinical diagnosis of FSHD by revealing the chromosome 4 origin of the pathogenic allele in the presence of two exchanged repeat arrays, one on chromosome 4 and one on chromosome 10, an allele constitution that cannot be identified by conventional DNA diagnosis.     

Parental Somatic Mosaicism Is Underrecognized and Influences Recurrence Risk of Genomic Disorders

New human mutations are thought to originate in germ cells, thus making a recurrence of the same mutation in a sibling exceedingly rare. However, increasing sensitivity of genomic technologies has anecdotally revealed mosaicism for mutations in somatic tissues of apparently healthy parents. Such somatically mosaic parents might also have germline mosaicism that can potentially cause unexpected intergenerational recurrences. Here, we show that somatic mosaicism for transmitted mutations among parents of children with simplex genetic disease is more common than currently appreciated. Using the sensitivity of individual-specific breakpoint PCR, we prospectively screened 100 families with children affected by genomic disorders due to rare deletion copy-number variants (CNVs) determined to be de novo by clinical analysis of parental DNA. Surprisingly, we identified four cases of low-level somatic mosaicism for the transmitted CNV in DNA isolated from parental blood. Integrated probabilistic modeling of gametogenesis developed in response to our observations predicts that mutations in parental blood increase recurrence risk substantially more than parental mutations confined to the germline. Moreover, despite the fact that maternally transmitted mutations are the minority of alleles, our model suggests that sexual dimorphisms in gametogenesis result in a greater proportion of somatically mosaic transmitting mothers who are thus at increased risk of recurrence. Therefore, somatic mosaicism together with sexual differences in gametogenesis might explain a considerable fraction of unexpected recurrences of X-linked recessive disease. Overall, our results underscore an important role for somatic mosaicism and mitotic replicative mutational mechanisms in transmission genetics.     

Equal proportions of affected cells in muscle and blood of a mosaic carrier of facioscapulohumeral muscular dystrophy

Autosomal dominant facioscapulohumeral muscular dystrophy (FSHD) is associated with contractions of D4Z4 repeat on 4q35. It displays a remarkable inter- and intra-familial clinical variability ranging from severe phenotype to asymptomatic carriers. Mosaicism for the contracted FSHD-sized allele is a recurrent finding, but only DNA from lymphocytes had been studied. It is currently not known if mosaicism is unequally distributed between different tissues and if muscle is relatively spared for the presence of the disease allele in mosaic asymptomatic carriers of a disease allele. Here we compare DNA extracted from peripheral blood lymphocytes (PBL), fibroblasts and muscle from a mosaic asymptomatic female carrier and mother of a FSHD patient. PFGE analysis showed a complex allelic segregation: two independent mitotic rearrangement episodes occurred, resulting in mosaicism for a contracted D4Z4 repeat on 4q35 in the mother and mosaicism for an expanded D4Z4 repeat on 10q26 in the affected daughter. The results show that the proportion of mosaicism in PBL and muscle were comparable, while in fibroblasts there was some variation in the mosaicism, which might be caused by culturing artefacts. This finding supports the hypothesis that a mitotic contraction of D4Z4 is an early embryonic event and indicates that the degree of mosaicism in PBL is representative for that of muscle.     

The FSHD-Associated Repeat, D4Z4, Is a Member of a Dispersed Family of Homeobox-Containing Repeats, Subsets of Which Are Clustered on the Short Arms of the Acrocentric Chromosomes

Facioscapulohumeral muscular dystrophy (FSHD) is an autosomal dominant neuromuscular disorder that maps to human chromosome 4q35. FSHD is tightly linked to a polymorphic 3.3-kb tandem repeat locus, D4Z4. D4Z4 is a complex repeat: it contains a novel homeobox sequence and two other repetitive sequence motifs. In most sporadic FSHD cases, a specific DNA rearrangement, deletion of copies of the repeat at D4Z4, is associated with development of the disease. However, no expressed sequences from D4Z4 have been identified. We have previously shown that there are other loci similar to D4Z4 within the genome. In this paper we describe the isolation of two YAC clones that map to chromosome 14 and that contain multiple copies of a D4Z4-like repeat. Isolation of cDNA clones that map to the acrocentric chromosomes and Southern blot analysis of somatic cell hybrids show that there are similar loci on all of the acrocentric chromosomes. D4Z4 is a member of a complex repeat family, and PCR analysis of somatic cell hybrids shows an organization into distinct subfamilies. The implications of this work in relation to the molecular mechanism of FSHD pathogenesis is discussed. We propose the name 3.3-kb repeat for this family of repetitive sequence elements.     

High rate of mosaicism in tuberous sclerosis complex.

Six families with mosaicism are identified in a series of 62 unrelated families with a mutation in one of the two tuberous sclerosis complex (TSC) genes, TSC1 or TSC2. In five families, somatic mosaicism was present in a mildly affected parent of an index patient. In one family with clinically unaffected parents, gonadal mosaicism was detected after TSC was found in three children. The detection of mosaicism has consequences for genetic counseling of the families involved, as changed risks apply to individuals with mosaicism, both siblings and parents. Clinical investigation of parents of patients with seemingly sporadic mutations is essential to determine their residual chance of gonadal and/or somatic mosaicism, unless a mosaic pattern is detected in the index patient, proving a de novo event. In our data set, the exclusion of signs of TSC in the parents of a patient with TSC reduced the chance of one of the parents to be a (mosaic) mutation carrier from 10% to 2%. In the five families with somatic mosaicism, the parent was given the diagnosis after the diagnosis was made in the child.     

Germline mosaicism in 4q35 facioscapulohumeral muscular dystrophy (FSHD1A) occurring predominantly in oogenesis

Facioscapulohumeral muscular dystrophy (FSHD) is an autosomal dominantly inherited neuromuscular disorder affecting facial and shoulder girdle muscles with subsequent progression to the pelvic girdle and lower extremities. The major gene involved has been localized to chromosome 4q35 (FSHD1A). The 4q35 DNA marker p13E-11 (D4F104S1) detects a de novo EcoRI DNA rearrangement of < 30 kb in isolated and familial cases. The intrafamilial size of the fragment is constant, inversely correlated with the severity, and directly correlated with the age of onset of the condition. There has been evidence of parental mosaicism in FSHD1A for the D4F104S1 locus. Four female and three male clinically unaffected parents have been described to be carriers of EcoRI fragments of the same size as their affected offspring, but with a markedly less intensive hybridization signal (semi-quantitative evidence). In our total sample of 42 FSHD1A families, we found semi-quantitative evidence of parental D4F104S1 mosaicism in 11 families (EcoRI fragment size range: 12–27 kb). On analysis with adjacent 4q35 probes (D4S163, D4S139), additional qualitative evidence of germline mosaicism could be obtained in two families. In our mosaic families and in the families reported in the literature, a female predominance of mosaicism carriers (13 females versus 5 males) could be noted. In our sample, mosaicism was observed in multigeneration families, in families with isolated cases, and in families with two and three affected children from seemingly unaffected parents. A short EcoRI fragment once having emerged in a mosaicism carrier was found to be transmitted autosomal dominantly to subsequent generations. Of all reported sporadic patients, 19% have a mosaic parent. Finding evidence of parental mosaicism in all our families with more than one affected child of seemingly unaffected parents suggests that there is no autosomal recessively inherited form of FSHD1A. Received: 5 March 1996 / Revised: 14 May 1996     

Rare etiology of autosomal recessive disease in a child with noncarrier parents

A child with maple syrup urine disease type 2 (MSUD2) was found to be homozygous for a 10-bp MSUD2-gene deletion on chromosome 1. Both purported parents were tested, and neither carries the gene deletion. Polymorphic simple-sequence repeat analyses at 15 loci on chromosome 1 and at 16 loci on other chromosomes confirmed parentage and revealed that a de novo mutation prior to maternal meiosis I, followed by nondisjunction in maternal meiosis II, resulted in an oocyte with two copies of the de novo mutant allele. Fertilization by a sperm that did not carry a paternal chromosome 1 or subsequent mitotic loss of the paternal chromosome 1 resulted in the propositus inheriting two mutant MSUD2 alleles on two maternal number 1 chromosomes.     

Fluorescence in situ hybridisation studies provide evidence for somatic mosaicism in de novo dystrophin gene deletions

The fluorescence in situ hybridisation (FISH) technique was tested for its ability to detect somatic mosaicism in mothers of isolated deletion cases of Duchenne/ Becker muscular dystrophy. A control female with known germline and somatic mosaicism was examined, and both the normal cell line and the carrier cell line were detected. Subsequent FISH analysis of three other mothers of boys with apparent de novo dystrophin gene deletions revealed a second patient with a high level of somatic mosaicism, suggesting that a proportion of de novo dystrophin gene deletions occur as mitotic errors early in development rather than as meiotic errors during gametogenesis.     

Somatic and germline mosaic mutations in the doublecortin gene are associated with variable phenotypes

Mutations in the X-linked gene doublecortin lead to "double cortex" syndrome (DC) in females and to X-linked lissencephaly (XLIS) in males. Because most patients with DC and XLIS are sporadic, representing de novo doublecortin mutations, we considered that some of these patients could be somatic or germline mosaics. Among a population of 20 patients and their families, we found evidence for mosaic doublecortin mutations in 6 individuals. Germline mosaicism was identified in two unaffected women, each with two affected children. Additionally, one affected male with DC was found to be a somatic mosaic, which presumably spared him from the more severe phenotype of lissencephaly. The high rate of mosaicism indicates that there may be a significant recurrence risk for DC/XLIS in families at risk, even when the mother is unaffected.     

Facioscapulohumeral muscular dystrophy and DUX4: breaking the silence

Autosomal dominant facioscapulohumeral muscular dystrophy (FSHD) has an unusual pathogenic mechanism. FSHD is caused by deletion of a subset of D4Z4 macrosatellite repeat units in the subtelomere of chromosome 4q. Recent studies provide compelling evidence that a retrotransposed gene in the D4Z4 repeat, DUX4, is expressed in the human germline and then epigenetically silenced in somatic tissues. In FSHD, the combination of inefficient chromatin silencing of the D4Z4 repeat and polymorphisms on the FSHD-permissive alleles that stabilize the DUX4 mRNAs emanating from the repeat result in inappropriate DUX4 protein expression in muscle cells. FSHD is thereby the first example of a human disease caused by the inefficient repression of a retrogene in a macrosatellite repeat array.     

Post-zygotic Point Mutations Are an Underrecognized Source of De Novo Genomic Variation

De novo mutations are recognized both as an important source of genetic variation and as a prominent cause of sporadic disease in humans. Mutations identified as de novo are generally assumed to have occurred during gametogenesis and, consequently, to be present as germline events in an individual. Because Sanger sequencing does not provide the sensitivity to reliably distinguish somatic from germline mutations, the proportion of de novo mutations that occur somatically rather than in the germline remains largely unknown. To determine the contribution of post-zygotic events to de novo mutations, we analyzed a set of 107 de novo mutations in 50 parent-offspring trios. Using four different sequencing techniques, we found that 7 (6.5%) of these presumed germline de novo mutations were in fact present as mosaic mutations in the blood of the offspring and were therefore likely to have occurred post-zygotically. Furthermore, genome-wide analysis of “de novo” variants in the proband led to the identification of 4/4,081 variants that were also detectable in the blood of one of the parents, implying parental mosaicism as the origin of these variants. Thus, our results show that an important fraction of de novo mutations presumed to be germline in fact occurred either post-zygotically in the offspring or were inherited as a consequence of low-level mosaicism in one of the parents.     

Somatic Mosaicism in Hemophilia A: A Fairly Common Event

Mutations in the large gene of clotting factor VIII (FVIII) are the most common events leading to severe human bleeding disorder. The high proportion of de novo mutations observed in this gene raises the possibility that a significant proportion of such mutations does not derive from a single germ cell but instead should be attributed to a germline or somatic mosaic originating from a mutation during early embryogenesis. The present study explores this hypothesis by using allele-specific PCR to analyze 61 families that included members who had sporadic severe hemophilia A and known FVIII gene defects. The presence of somatic mosaicisms of varying degrees (0.2%-25%) could be shown in 8 (13%) of the 61 families and has been confirmed by a mutation-enrichment procedure. All mosaics were found in families with point mutations (8 [25%] of 32 families). In the subgroup of 8 families with CpG transitions, the percentage with mosaicism increased to 50% (4 of 8 families). In contrast, no mosaics were observed in 13 families with small deletions/insertions or in 16 families with intron 22 inversions. Our data suggest that mosaicism may represent a fairly common event in hemophilia A. As a consequence, risk assessment in genetic counseling should include consideration of the possibility of somatic mosaicism in families with apparently de novo mutations, especially families with the subtype of point mutations.     

Effects of deletions on mitotic stability of the Paternal-Sex-Ratio (PSR) chromosome from Nasonia

Paternal-Sex-Ratio (PSR) is a B chromosome that causes all-male offspring in the parasitoid wasp Nasonia vitripennis. It is only transmitted via sperm of carrier males and destroys the other paternal chromosomes during the first mitotic division of the fertilized egg. Because of haplodiploidy, the effect of PSR is to convert diploid (female) eggs into haploid eggs that develop into PSR-bearing males. The PSR chromosome was previously found to contain several families of repetitive DNA, which appear to be present in local blocks. PSR chromosomes with irradiation-induced deletions have decreased rates of transmission and increased variation in transmission. This study investigates whether these differences in transmission of deletion chromosomes are due to mitotic instability. Two deleton chromosomes (E306 and F316) and the wild-type PSR chromosome were examined. A cytogenetic assay of testes revealed that wild-type PSR males contained the chromosome in 98%–100% of their spermatocytes. Similar counts from carriers of two delection chromosomes were lower and varied between individuals from 50%–100%. One F316 male did not contain the chromosome in any of its spermatocytes although the chromosome was present in somatic tissues based on hybridization to PSR-specific repetitive DNA. A molecular analysis of males found the wild-type PSR chromosome to be present in all somatic tissues. Tissue specific differences in the presence of PSR were found in several males from the two deletion lines. The results show that deletions can result in mosaicism due to increased mitotic instability of PSR. Such individuals sometimes partially or completely fail to transmit the chromosome. Patterns of mosaicism of B chromosomes in other organisms are discussed.by P.B. Moens     

Constitutional and somatic RB1 mutation spectrum in nonfamilial unilateral and bilateral retinoblastoma in India

An epidemiologic survey has indicated a comparatively high prevalence of retinoblastoma (Rb) in Asian countries. Recently, the development of preventive strategies in nonfamilial Rb has become a major goal. The present studies were designed for identification and characterization of constitutional and somatic RB1 gene mutations by conventional cytogenetics, fluorescent in situ hybridization (FISH) and polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP)-DNA sequencing. Of 34 patients 32 were nonfamilial and 2 were familial Rb. Maternal inheritance of del (13q14) was common. FISH was sensitive in detecting monoallelic RB1 deletion/deletion mosaicism as a first genetic hit in 20% of cases. Somatic and germline RB1 point mutations affected exons 3, 17, 20, and 21 and these were identified as novel mutations. Involvement of exon 20 as a predisposing mutation in sporadic unilateral retinoblastoma (URB) probably suggests the susceptibility of exon 20 to unknown etiologic factors in our population. A de novo RB1 deletion along with transmitted RB1 point mutation from an asymptomatic parent was identified as a unique predisposing RB1 mutation chimerism in a URB case that later evolved to bilateral retinoblastoma (BRB). The predisposing mutations such as del (13q), RB1 mono-allelic deletion and RB1 point mutation in sporadic Rb were de novo as well as transmitted mutations from asymptomatic/symptomatic parents. The RB1 mutation incidence was comparatively higher (25%) in nonfamilial Rb with emphasis on high prevalence in sporadic URB (18% versus 0%-9% in the literature series). The present studies demonstrated the efficacy of a multitechnique approach to detect various types of constitutional RB1 mutations such as RB1 deletion, deletion mosaicism, point mutation, mutation chimerism in patients of symptomatic/asymptomatic parents.     

A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.     

Exome Sequencing Reveals De Novo WDR45 Mutations Causing a Phenotypically Distinct,X-Linked Dominant Form of NBIA

Neurodegeneration with brain iron accumulation (NBIA) is a group of genetic disorders characterized by abnormal iron deposition in the basal ganglia. We report that de novo mutations in WDR45, a gene located at Xp11.23 and encoding a beta-propeller scaffold protein with a putative role in autophagy, cause a distinctive NBIA phenotype. The clinical features include early-onset global developmental delay and further neurological deterioration (parkinsonism, dystonia, and dementia developing by early adulthood). Brain MRI revealed evidence of iron deposition in the substantia nigra and globus pallidus. Males and females are phenotypically similar, an observation that might be explained by somatic mosaicism in surviving males and germline or somatic mutations in females, as well as skewing of X chromosome inactivation. This clinically recognizable disorder is among the more common forms of NBIA, and we suggest that it be named accordingly as beta-propeller protein-associated neurodegeneration.     

Somatic mosaicism in two unrelated patients with X-linked chronic granulomatous disease characterized by the presence of a small population of normal cells

X-linked chronic granulomatous disease (X-CGD) is a primary immunodeficiency disease of phagocytes caused by mutations in the cytochrome b(558)β (CYBB) gene. We, for the first time, detected somatic mosaicism in two unrelated male patients with X-CGD caused by de novo nonsense mutations (p.Gly223X and p.Glu462X) in the CYBB gene. In each patient, a small subset of granulocytes was normal in terms of respiratory burst (ROB) activity, gp91(phox) expression, and CYBB sequences. Cells with wild-type CYBB sequence were also detected in buccal swab specimens and in peripheral blood mononuclear cells. The normal cells were shown to be of the patient origin by fluorescent in situ hybridization analysis of X/Y chromosomes, and by HLA DNA typing. Two possible mechanisms for this somatic mosaicism were considered. The first is that the de novo disease-causing mutations in CYBB occurred at an early multicellular stage of embryogenesis with subsequent expansion of the mutated cells, leaving some unmutated cells surviving. The second possibility is that the de novo mutations occurred in oocytes which was followed by reversion of the mutations in a small subset of cells in early embryogenesis.     

Mosaike bei monogenen Erkrankungen

Mosaicism is defined as the simultaneous presence of cells with different genotypes that originate from a common zygote. Mutations can either be present in germline or somatic cells. Monogenic disorders apparently caused by a de novo mutation may show a recurrence risk due to germline mosaicism in a parent. Duchenne muscular dystrophy is a well investigated example with a high frequency of germline mosaicism and the estimation for the risk of recurrence is based on theoretical models and empirical data. Recently, somatic mutations have been uncovered in various syndromic disorders, such as Proteus syndrome or hemimegalencephaly and respective mutations often show gain-of-function properties. Genetic testing is mainly based on next generation sequencing technologies but still remains challenging; however, detection of somatic mosaicism is expected to be of increasing relevance in the diagnosis of monogenic disorders. Somatic mosaicism may also play a hitherto underestimated role in common disorders.