共查询到20条相似文献,搜索用时 390 毫秒
1.
C. P. A. de Haan R. Kivist? M. L. H?nninen 《Applied and environmental microbiology》2010,76(20):6942-6943
Cj0859c variants fspA1 and fspA2 from 669 human, poultry, and bovine Campylobacter jejuni strains were associated with certain hosts and multilocus sequence typing (MLST) types. Among the human and poultry strains, fspA1 was significantly (P < 0.001) more common than fspA2. FspA2 amino acid sequences were the most diverse and were often truncated.Campylobacter jejuni is the leading cause of bacterial gastroenteritis worldwide and responsible for more than 90% of Campylobacter infections (7). Case-control studies have identified consumption or handling of raw and undercooked poultry meat, drinking unpasteurized milk, and swimming in natural water sources as risk factors for acquiring domestic campylobacteriosis in Finland (7, 9). Multilocus sequence typing (MLST) has been employed to study the molecular epidemiology of Campylobacter (4) and can contribute to virulotyping when combined with known virulence factors (5). FspA proteins are small, acidic, flagellum-secreted nonflagellar proteins of C. jejuni that are encoded by Cj0859c, which is expressed by a σ28 promoter (8). Both FspA1 and FspA2 were shown to be immunogenic in mice and protected against disease after challenge with a homologous strain (1). However, FspA1 also protected against illness after challenge with a heterologous strain, whereas FspA2 failed to do the same at a significant level. Neither FspA1 nor FspA2 protected against colonization (1). On the other hand, FspA2 has been shown to induce apoptosis in INT407 cells, a feature not exhibited by FspA1 (8). Therefore, our aim was to study the distributions of fspA1 and fspA2 among MLST types of Finnish human, chicken, and bovine strains.In total, 367 human isolates, 183 chicken isolates, and 119 bovine isolates (n = 669) were included in the analyses (3). PCR primers for Cj0859c were used as described previously (8). Primer pgo6.13 (5′-TTGTTGCAGTTCCAGCATCGGT-3′) was designed to sequence fspA1. Fisher''s exact test or a chi-square test was used to assess the associations between sequence types (STs) and Cj0859c. The SignalP 3.0 server was used for prediction of signal peptides (2).The fspA1 and fspA2 variants were found in 62.6% and 37.4% of the strains, respectively. In 0.3% of the strains, neither isoform was found. Among the human and chicken strains, fspA1 was significantly more common, whereas fspA2 was significantly more frequent among the bovine isolates (Table (Table1).1). Among the MLST clonal complexes (CCs), fspA1 was associated with the ST-22, ST-45, ST-283, and ST-677 CCs and fspA2 was associated with the ST-21, ST-52, ST-61, ST-206, ST-692, and ST-1332 CCs and ST-58, ST-475, and ST-4001. Although strong CC associations of fspA1 and fspA2 were found, the ST-48 complex showed a heterogeneous distribution of fspA1 and fspA2. Most isolates carried fspA2, and ST-475 was associated with fspA2. On the contrary, ST-48 commonly carried fspA1 (Table (Table1).1). In our previous studies, ST-48 was found in human isolates only (6), while ST-475 was found in both human and bovine isolates (3, 6). The strict host associations and striking difference between fspA variants in human ST-48 isolates and human/bovine ST-475 isolates suggest that fspA could be important in host adaptation.
Open in a separate windowaIn 0.3% of the strains, neither isoform was found. NF, not found.bNA, not associated.A total of 28 isolates (representing 6 CCs and 13 STs) were sequenced for fspA1 and compared to reference strains NCTC 11168 and 81-176. All isolates in the ST-22 CC showed the same one-nucleotide (nt) difference with both NCTC 11168 and 81-176 strains, resulting in a Thr→Ala substitution in the predicted protein sequence (represented by isolate FB7437, GenBank accession number ; Fig. HQ104931Fig.1).1). Eight other isolates in different CCs showed a 2-nt difference (isolate 1970, GenBank accession number ; Fig. HQ104932Fig.1)1) compared to strains NCTC 11168 and 81-176, although this did not result in amino acid substitutions. All 28 isolates were predicted to encode a full-length FspA1 protein.Open in a separate windowFIG. 1.Comparison of FspA1 and FspA2 isoforms. FspA1 is represented by 81-176, FB7437, and 1970. FspA2 is represented by C. jejuni strains 76763 to 1960 (GenBank accession numbers ). Scale bar represents amino acid divergence.In total, 62 isolates (representing 7 CCs and 35 STs) were subjected to fspA2 sequence analysis. Although a 100% sequence similarity between different STs was found for isolates in the ST-21, ST-45, ST-48, ST-61, and ST-206 CCs, fspA2 was generally more heterogeneous than fspA1 and we found 13 predicted FspA2 amino acid sequence variants in total (Fig. HQ104933 to HQ104946(Fig.1).1). In several isolates with uncommon and often unassigned (UA) STs, the proteins were truncated (Fig. (Fig.1),1), with most mutations being ST specific. For example, all ST-58 isolates showed a 13-bp deletion (isolate 3074_2; Fig. Fig.1),1), resulting in a premature stop codon. Also, all ST-1332 CC isolates were predicted to have a premature stop codon by the addition of a nucleotide between nt 112 and nt 113 (isolate 1960; Fig. Fig.1),1), a feature shared with two isolates typed as ST-4002 (UA). A T68A substitution in ST-1960 (isolate T-73494) also resulted in a premature stop codon. Interestingly, ST-1959 and ST-4003 (represented by isolate 4129) both lacked one triplet (nt 235 to 237), resulting in a shorter FspA2 protein. SignalP analysis showed the probability of a signal peptide between nt 22 and 23 (ACA-AA [between the underlined nucleotides]). An A24C substitution in two other strains, represented by isolate 76580, of ST-693 and ST-993 could possibly result in a truncated FspA2 protein as well.In conclusion, our results showed that FspA1 and FspA2 showed host and MLST associations. The immunogenic FspA1 seems to be conserved among C. jejuni strains, in contrast to the heterogeneous apoptosis-inducing FspA2, of which many isoforms were truncated. FspA proteins could serve as virulence factors for C. jejuni, although their roles herein are not clear at this time. 相似文献
TABLE 1.
Percent distributions of fspA1 and fspA2 variants among 669 human, poultry, and bovine Campylobacter jejuni strains and their associations with hosts, STs, and CCsHost or ST complex/ST (no. of isolates) | % of strains witha: | P valueb | |
---|---|---|---|
fspA1 | fspA2 | ||
Host | |||
All (669) | 64.3 | 35.4 | |
Human (367) | 69.5 | 30.0 | <0.001 |
Poultry (183) | 79.2 | 20.8 | <0.001 |
Bovine (119) | 25.2 | 74.8 | <0.0001 |
ST complex and STs | |||
ST-21 complex (151) | 2.6 | 97.4 | <0.0001 |
ST-50 (76) | NF | 100 | <0.0001 |
ST-53 (19) | NF | 100 | <0.0001 |
ST-451 (9) | NF | 100 | <0.0001 |
ST-883 (11) | NF | 100 | <0.0001 |
ST-22 complex (22) | 100 | NF | <0.0001 |
ST-22 (11) | 100 | NF | <0.01 |
ST-1947 (9) | 100 | NF | 0.03 |
ST-45 complex (268) | 99.3 | 0.7 | <0.0001 |
ST-11 (7) | 100 | NF | NA |
ST-45 (173) | 99.4 | 0.6 | <0.0001 |
ST-137 (22) | 95.5 | 4.5 | 0.001 |
ST-230 (14) | 100 | NF | <0.0001 |
ST-48 complex (18) | 44.4 | 55.6 | NA |
ST-48 (7) | 100 | NF | NA |
ST-475 (8) | NF | 100 | <0.001 |
ST-52 complex (5) | NF | 100 | <0.01 |
ST-52 (4) | NF | 100 | 0.02 |
ST-61 complex (21) | NF | 100 | <0.0001 |
ST-61 (11) | NF | 100 | <0.0001 |
ST-618 (3) | NF | 100 | 0.04 |
ST-206 complex (5) | NF | 100 | <0.01 |
ST-283 complex (24) | 100 | NF | <0.0001 |
ST-267 (23) | 100 | NF | <0.0001 |
ST-677 complex (59) | 100 | NF | <0.0001 |
ST-677 (48) | 100 | NF | <0.0001 |
ST-794 (11) | 100 | NF | <0.001 |
ST-692 complex (3) | NF | 100 | 0.04 |
ST-1034 complex (5) | NF | 80 | NA |
ST-4001 (3) | NF | 100 | 0.04 |
ST-1287 complex/ST-945 (8) | 100 | NF | NA |
ST-1332 complex/ST-1332 (4) | NF | 100 | 0.02 |
Unassigned STs | |||
ST-58 (6) | NF | 100 | <0.01 |
ST-586 (6) | 100 | NF | NA |
2.
Tatiana N. Stekhanova Andrey V. Mardanov Ekaterina Y. Bezsudnova Vadim M. Gumerov Nikolai V. Ravin Konstantin G. Skryabin Vladimir O. Popov 《Applied and environmental microbiology》2010,76(12):4096-4098
Short-chain alcohol dehydrogenase, encoded by the gene Tsib_0319 from the hyperthermophilic archaeon Thermococcus sibiricus, was expressed in Escherichia coli, purified and characterized as an NADPH-dependent enantioselective oxidoreductase with broad substrate specificity. The enzyme exhibits extremely high thermophilicity, thermostability, and tolerance to organic solvents and salts.Alcohol dehydrogenases (ADHs; EC 1.1.1.1.) catalyze the interconversion of alcohols to their corresponding aldehydes or ketones by using different redox-mediating cofactors. NAD(P)-dependent ADHs, due to their broad substrate specificity and enantioselectivity, have attracted particular attention as catalysts in industrial processes (5). However, mesophilic ADHs are unstable at high temperatures, sensitive to organic solvents, and often lose activity during immobilization. In this relation, there is a considerable interest in ADHs from extremophilic microorganisms; among them, Archaea are of great interest. The representatives of all groups of NAD(P)-dependent ADHs have been detected in genomes of Archaea (11, 12); however, only a few enzymes have been characterized, and the great majority of them belong to medium-chain (3, 4, 14, 16, 19) or long-chain iron-activated ADHs (1, 8, 9). Up to now, a single short-chain archaeal ADH from Pyrococcus furiosus (10, 18) and only one archaeal aldo-keto reductase also from P. furiosus (11) have been characterized.Thermococcus sibiricus is a hyperthermophilic anaerobic archaeon isolated from a high-temperature oil reservoir capable of growth on complex organic substrates (15). The complete genome sequence of T. sibiricus has been recently determined and annotated (13). Several ADHs are encoded by the T. sibiricus genome, including three short-chain ADHs (Tsib_0319, Tsib_0703, and Tsib_1998) (13). In this report, we describe the cloning and expression of the Tsib_0319 gene from T. sibiricus and the purification and the biochemical characterization of its product, the thermostable short-chain ADH (TsAdh319).The Tsib_0319 gene encodes a protein with a size of 234 amino acids and the calculated molecular mass of 26.2 kDa. TsAdh319 has an 85% degree of sequence identity with short-chain ADH from P. furiosus (AdhA; PF_0074) (18). Besides AdhA, close homologs of TsAdh319 were found among different bacterial ADHs, but not archaeal ADHs. The gene flanked by the XhoI and BamHI sites was PCR amplified using two primers (sense primer, 5′-GTTCTCGAGATGAAGGTTGCTGTGATAACAGGG-3′, and antisense primer, 5′-GCTGGATCCTCAGTATTCTGGTCTCTGGTAGACGG-3′) and cloned into the pET-15b vector. TsAdh319 was overexpressed, with an N-terminal His6 tag in Escherichia coli Rosetta-gami (DE3) and purified to homogeneity by metallochelating chromatography (Hi-Trap chelating HP column; GE Healthcare) followed by gel filtration on Superdex 200 10/300 GL column (GE Healthcare) equilibrated in 50 mM Tris-HCl (pH 7.5) with 200 mM NaCl. The homogeneity and the correspondence to the calculated molecular mass of 28.7 kDa were verified by SDS-PAGE (7). The molecular mass of native TsAdh319 was 56 to 60 kDa, which confirmed the dimeric structure in solution.The standard ADH activity measurement was made spectrophotometrically at the optimal pH by following either the reduction of NADP (in 50 mM Gly-NaOH buffer; pH 10.5) or the oxidation of NADPH (in 0.1 M sodium phosphate buffer; pH 7.5) at 340 nm at 60°C. The enzyme exhibited a strong preference for NADP(H) and broad substrate specificity (Table (Table1).1). The highest oxidation rates were found with pentoses d-arabinose (2.0 U mg−1) and d-xylose (2.46 U mg−1), and the highest reduction rates were found with dimethylglyoxal (5.9 U mg−1) and pyruvaldehyde (2.2 U mg−1). The enzyme did not reduce sugars which were good substrates for the oxidation reaction. The kinetic parameters of TsAdh319 determined for the preferred substrates are shown in Table Table2.2. The enantioselectivity of the enzyme was estimated by measuring the conversion rates of 2-butanol enantiomers. TsAdh319 showed an evident preference, >2-fold, for (S)-2-butanol over (RS)-2-butanol. The enzyme stereoselectivity is confirmed by the preferred oxidation of d-arabinose over l-arabinose (Table (Table1).1). The fact that TsAdh319 is metal independent was supported by the absence of a significant effect of TsAdh319 preincubation with 10 mM Me2+ for 30 min before measuring the activity in the presence of 1 mM Me2+ or EDTA (Table (Table3).3). TsAdh319 also exhibited a halophilic property, so the enzyme activity increased in the presence of NaCl and KCl and the activation was maintained even at concentration of 4 M and 3 M, respectively (Table (Table33).
Open in a separate windowaSubstrates were present in 250 mM or 50 mM (*) concentrations.bRelative rates, measured under standard conditions, were calculated by defining the activity for 2-propanol as 100%, which corresponds to 1.0 U mg−1. Data are averages from triplicate experiments.cRelative rates, measured under standard conditions, were calculated by defining the activity for pyruvaldehyde as 100%, which corresponds to 2.2 U mg−1. Data are averages from triplicate experiments.
Open in a separate windowaActivity was measured under standard conditions with 2-propanol. Data are averages from triplicate experiments.bActivity was measured under standard conditions with pyruvaldehyde. Data are averages from triplicate experiments.
Open in a separate windowaThe activity was measured under standard conditions with 2-propanol; relative rates were calculated by defining the activity without salts as 100%, which corresponds to 0.9 U mg−1. Data are averages from duplicate experiments.The most essential distinctions of TsAdh319 are the thermophilicity and high thermostability of the enzyme. The optimum temperature for the 2-propanol oxidation catalyzed by TsAdh319 was not achieved. The initial reaction rate of oxidation increased up to 100°C (Fig. (Fig.1).1). The Arrhenius plot is a straight line, typical of a single rate-limited thermally activated process, but there is no obvious transition point due to the temperature-dependent conformational changes of the protein molecule. The activation energy for the oxidation of 2-propanol was estimated at 84.0 ± 5.8 kJ·mol−1. The thermostability of TsAdh319 was calculated from residual TsAdh319 activity after preincubation of 0.4 mg/ml enzyme solution in 50 mM Tris-HCl buffer (pH 7.5) containing 200 mM NaCl at 70, 80, 90, or 100°C. The preincubation at 70°C or 80°C for 1.5 h did not cause a decrease in the TsAdh319 activity, but provoked slight activation. The residual TsAdh319 activities began to decrease after 2 h of preincubation at 70°C or 80°C and were 10% and 15% down from the control, respectively. The determined half-life values of TsAdh319 were 2 h at 90°C and 1 h at 100°C.Open in a separate windowFIG. 1.Temperature dependence of the initial rate of the 2-propanol reduction by TsAdh319. The reaction was initiated by enzyme addition to a prewarmed 2-propanol-NADP mixture. The inset shows the Arrhenius plot of the same data.Protein thermostability often correlates with such important biotechnological properties as increased solvent tolerance (2). We tested the influence of organic solvents at a high concentration (50% [vol/vol]) on TsAdh319 by using either preincubation of the enzyme at a concentration of 0.2 mg/ml with solvents for 4 h at 55°C or solvent addition into the reaction mixture to distinguish the effect of solvent on the protein stability and on the enzyme activity. TsAdh319 showed significant solvent tolerance in both cases (Table (Table4),4), and the effects of solvents could be modulated by salts, acting apparently as molecular lyoprotectants (17). Furthermore, TsAdh319 maintained 57% of its activity in 25% (vol/vol) 2-propanol, which could be used as the cosubstrate in cofactor regeneration (6).
Open in a separate windowaThe activity measured at the standard condition with 2-propanol as a substrate. Data are averages from triplicate experiments.bPreincubation for 4 h at 55°C in the presence of 50% (vol/vol) of solvent prior the activity assay.cWithout preincubation, solvent addition to the reaction mixture up to 50% (vol/vol) or using the buffer saturated by a solvent (*).dDMSO, dimethyl sulfoxide.eDMFA, dimethylformamide.From all the aforesaid we may suppose TsAdh319 or its improved variant to be interesting both for the investigation of structural features of protein tolerance and for biotechnological applications. 相似文献
TABLE 1.
Substrate specificity of TsAdh319Substratea | Relative activity (%) |
---|---|
Oxidation reactionb | |
Methanol | 0 |
2-Methoxyethanol | 0 |
Ethanol | 36 |
1-Butanol | 80 |
2-Propanol | 100 |
(RS)-(±)-2-Butanol | 86 |
(S)-(+)-2-Butanol | 196 |
2-Pentanol | 67 |
1-Phenylmethanol | 180 |
1.3-Butanediol | 91 |
Ethyleneglycol | 0 |
Glycerol | 16 |
d-Arabinose* | 200 |
l-Arabinose* | 17 |
d-Xylose* | 246 |
d-Ribose* | 35 |
d-Glucose* | 146 |
d-Mannose* | 48 |
d-Galactose* | 0 |
Cellobiose* | 71 |
Reduction reactionc | |
Pyruvaldehyde | 100 |
Dimethylglyoxal | 270 |
Glyoxylic acid | 36 |
Acetone | 0 |
Cyclopentanone | 0 |
Cyclohexanone | 4 |
3-Methyl-2-pentanone* | 13 |
d-Arabinose* | 0 |
d-Xylose* | 0 |
d-Glucose* | 0 |
Cellobiose* | 0 |
TABLE 2.
Apparent Km and Vmax values for TsAdh319Coenzyme or substrate | Apparent Km (mM) | Vmax (U mg−1) | kcat (s−1) |
---|---|---|---|
NADPa | 0.022 ± 0.002 | 0.94 ± 0.02 | 0.45 ± 0.01 |
NADPHb | 0.020 ± 0.003 | 3.16 ± 0.11 | 1.51 ± 0.05 |
2-Propanol | 168 ± 29 | 1.10 ± 0.09 | 0.53 ± 0.04 |
d-Xylose | 54.4 ± 7.4 | 1.47 ± 0.09 | 0.70 ± 0.04 |
Pyruvaldehyde | 17.75 ± 3.38 | 4.26 ± 0.40 | 2.04 ± 0.19 |
TABLE 3.
Effect of various ions and EDTA on TsAdh319aCompound | Concn (mM) | Relative activity (%) |
---|---|---|
None | 0 | 100 |
NaCl | 400 | 206 |
600 | 227 | |
4,000 | 230 | |
KCl | 600 | 147 |
2,000 | 200 | |
3,000 | 194 | |
MgCl2 | 10 | 78 |
CoCl2 | 10 | 105 |
NiSO4 | 10 | 100 |
ZnSO4 | 10 | 79 |
FeSO4 | 10 | 74 |
EDTA | 1 | 100 |
5 | 80 |
TABLE 4.
Influence of various solvents on TsAdh319 activityaSolvent | Relative activity (%)b | Relative activity (%)c | |
---|---|---|---|
Buffer without NaCl | Buffer with 600 mM NaCl | ||
None | 100 | 100 | 100 |
DMSOd | 98 | 0 | 40 |
DMFAe | 101 | 13 | 41 |
Methanol | 98 | 25 | 9 |
Acetonitrile | 95 | 0 | 0 |
Ethyl acetate | 47 | 0* | 33* |
Chloroform | 105 | 79* | 81* |
n-Hexane | 105 | 60* | 118* |
n-Decane | 36 | 91* | 107* |
3.
4.
5.
6.
Chris A. Whitehouse Carson Baldwin Rangarajan Sampath Lawrence B. Blyn Rachael Melton Feng Li Thomas A. Hall Vanessa Harpin Heather Matthews Marina Tediashvili Ekaterina Jaiani Tamar Kokashvili Nino Janelidze Christopher Grim Rita R. Colwell Anwar Huq 《Applied and environmental microbiology》2010,76(6):1996-2001
7.
Lisa Jacobsen Lisa Durso Tyrell Conway Kenneth W. Nickerson 《Applied and environmental microbiology》2009,75(13):4633-4635
Escherichia coli isolates (72 commensal and 10 O157:H7 isolates) were compared with regard to physiological and growth parameters related to their ability to survive and persist in the gastrointestinal tract and found to be similar. We propose that nonhuman hosts in E. coli O157:H7 strains function similarly to other E. coli strains in regard to attributes relevant to gastrointestinal colonization.Escherichia coli is well known for its ecological versatility (15). A life cycle which includes both gastrointestinal and environmental stages has been stressed by both Savageau (15) and Adamowicz et al. (1). The gastrointestinal stage would be subjected to acid and detergent stress. The environmental stage is implicit in E. coli having transport systems for fungal siderophores (4) as well as pyrroloquinoline quinone-dependent periplasmic glucose utilization (1) because their presence indicates evolution in a location containing fungal siderophores and pyrroloquinoline quinone (1).Since its recognition as a food-borne pathogen, there have been numerous outbreaks of food-borne infection due to E. coli O157:H7, in both ground beef and vegetable crops (6, 13). Cattle are widely considered to be the primary reservoir of E. coli O157:H7 (14), but E. coli O157:H7 does not appear to cause disease in cattle. To what extent is E. coli O157:H7 physiologically unique compared to the other naturally occurring E. coli strains? We feel that the uniqueness of E. coli O157:H7 should be evaluated against a backdrop of other wild-type E. coli strains, and in this regard, we chose the 72-strain ECOR reference collection originally described by Ochman and Selander (10). These strains were chosen from a collection of 2,600 E. coli isolates to provide diversity with regard to host species, geographical distribution, and electromorph profiles at 11 enzyme loci (10).In our study we compared the 72 strains of the ECOR collection against 10 strains of E. coli O157:H7 and six strains of E. coli which had been in laboratory use for many years (Table (Table1).1). The in vitro comparisons were made with regard to factors potentially relevant to the bacteria''s ability to colonize animal guts, i.e., acid tolerance, detergent tolerance, and the presence of the Entner-Doudoroff (ED) pathway (Table (Table2).2). Our longstanding interest in the ED pathway (11) derives in part from work by Paul Cohen''s group (16, 17) showing that the ED pathway is important for E. coli colonization of the mouse large intestine. Growth was assessed by replica plating 88 strains of E. coli under 40 conditions (Table (Table2).2). These included two LB controls (aerobic and anaerobic), 14 for detergent stress (sodium dodecyl sulfate [SDS], hexadecyltrimethylammonium bromide [CTAB], and benzalkonium chloride, both aerobic and anaerobic), 16 for acid stress (pH 6.5, 6.0, 5.0, 4.6, 4.3, 4.2, 4.1, and 4.0), four for the ability to grow in a defined minimal medium (M63 glucose salts with and without thiamine), and four for the presence or absence of a functional ED pathway (M63 with gluconate or glucuronate). All tests were done with duplicate plates in two or three separate trials. The data are available in Tables S1 to S14 in the supplemental material, and they are summarized in Table Table22.
Open in a separate window
Open in a separate windowaEight LB controls were run, two for each set of LB experiments: SDS, CTAB, benzalkonium chloride (BAC), and pH stress.bGrowth was measured as either +++, +, or 0 (good, poor, and none, respectively), with +++ being the growth achieved on the LB control plates. “Variable” means that two or three replicates did not agree. All experiments were done at 37°C.c“Anaerobic” refers to use of an Oxoid anaerobic chamber. Aerobic and anaerobic growth data are presented together when the results were identical and separately when the results were not the same or the anaerobic set had not been done. LB plates were measured after 1 (aerobic) or 2 (anaerobic) days, and the M63 plates were measured after 2 or 3 days.dCTAB used at 0.05, 0.2%, and 0.4%.eM63 defined medium (3) was supplemented with glucose, gluconate, or glucuronate, all at 0.2%.fIdentical results were obtained with and without 0.0001% thiamine.gND, not determined. 相似文献
TABLE 1.
E. coli strains used in this studyE. coli strain (n) | Source |
---|---|
ECOR strains (72) | Thomas Whittman |
Laboratory adapted (6) | |
K-12 Davis | Paul Blum |
CG5C 4401 | Paul Blum |
K-12 Stanford | Paul Blum |
W3110 | Paul Blum |
B | Tyler Kokjohn |
AB 1157 | Tyler Kokjohn |
O157:H7 (10) | |
FRIK 528 | Andrew Benson |
ATCC 43895 | Andrew Benson |
MC 1061 | Andrew Benson |
C536 | Tim Cebula |
C503 | Tim Cebula |
C535 | Tim Cebula |
ATCC 43889 | William Cray, Jr. |
ATCC 43890 | William Cray, Jr. |
ATCC 43888 | Willaim Cray, Jr. |
ATCC 43894 | William Cray, Jr. |
TABLE 2.
Physiological comparison of 88 strains of Escherichia coliGrowth medium or condition | Oxygenc | No. of strains with type of growthb
| |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ECOR strains (n = 72)
| Laboratory strains (n = 6)
| O157:H7 strains (n = 10)
| |||||||||||
Good | Poor | None | Variable | Good | Poor | None | Variable | Good | Poor | None | Variable | ||
LB controla | Both | 72 | 0 | 0 | 0 | 6 | 0 | 0 | 0 | 10 | 0 | 0 | 0 |
1% SDS | Aerobic | 69 | 3 | 0 | 0 | 6 | 0 | 0 | 0 | 8 | 0 | 0 | 2 |
5% SDS | Aerobic | 68 | 4 | 0 | 0 | 6 | 0 | 0 | 0 | 8 | 2 | 0 | 0 |
1% SDS | Anaerobic | 53 | 15 | 4 | 0 | 2 | 3 | 1 | 0 | 1 | 7 | 0 | 2 |
5% SDS | Anaerobic | 0 | 68 | 4 | 0 | 0 | 4 | 2 | 0 | 0 | 7 | 0 | 4 |
CTABd (all) | Both | 0 | 0 | 72 | 0 | 0 | 0 | 6 | 0 | 0 | 0 | 10 | 0 |
0.05% BAC | Aerobic | 3 | 11 | 58 | 2 | 0 | 2 | 2 | 2 | 0 | 0 | 9 | 1 |
0.2% BAC | Aerobic | 0 | 1 | 71 | 0 | 1 | 0 | 5 | 0 | 0 | 0 | 10 | 0 |
0.05% BAC | Anaerobic | 2 | 3 | 67 | 0 | 0 | 1 | 5 | 0 | 0 | 0 | 9 | 1 |
0.2% BAC | Anaerobic | 0 | 0 | 72 | 0 | 0 | 0 | 6 | 0 | 0 | 0 | 10 | 0 |
pH 6.5 | Both | 72 | 0 | 0 | 0 | 6 | 0 | 0 | 0 | 10 | 0 | 0 | 0 |
pH 6 | Both | 72 | 0 | 0 | 0 | 6 | 0 | 0 | 0 | 10 | 0 | 0 | 0 |
pH 5 | Both | 70 | 2 | 0 | 0 | 6 | 0 | 0 | 0 | 9 | 0 | 0 | 1 |
pH 4.6 | Both | 70 | 2 | 0 | 0 | 6 | 0 | 0 | 0 | 10 | 0 | 0 | 0 |
pH 4.3 | Aerobic | 14 | 0 | 1 | 57 | 3 | 1 | 2 | 0 | 3 | 2 | 0 | 5 |
pH 4.3 | Anaerobic | 69 | 3 | 0 | 0 | 3 | 1 | 2 | 0 | 1 | 1 | 0 | 0 |
pH 4.1 or 4.2 | Aerobic | 0 | 0 | 72 | 0 | NDg | ND | ||||||
pH 4.0 | Both | 0 | 0 | 72 | 0 | 0 | 0 | 6 | 0 | 0 | 0 | 9 | 1 |
M63 with supplemente | |||||||||||||
Glucose | Aerobicf | 69 | 1 | 2 | 0 | 5 | 0 | 1 | 0 | 9 | 0 | 1 | 0 |
Glucose | Anaerobicf | 70 | 0 | 2 | 0 | 5 | 0 | 1 | 0 | 9 | 0 | 1 | 0 |
Gluconate | Both | 69 | 1 | 2 | 0 | 5 | 0 | 1 | 0 | 9 | 0 | 1 | 0 |
Glucuronate | Aerobic | 68 | 2 | 2 | 0 | 5 | 0 | 1 | 0 | 9 | 0 | 1 | 0 |
Glucuronate | Anaerobic | 69 | 1 | 2 | 0 | 5 | 0 | 1 | 0 | 9 | 0 | 1 | 0 |
8.
Pamela R. Hall Brian Hjelle Hadya Njus Chunyan Ye Virginie Bondu-Hawkins David C. Brown Kathleen A. Kilpatrick Richard S. Larson 《Journal of virology》2009,83(17):8965-8969
Specific therapy is not available for hantavirus cardiopulmonary syndrome caused by Andes virus (ANDV). Peptides capable of blocking ANDV infection in vitro were identified using antibodies against ANDV surface glycoproteins Gn and Gc to competitively elute a cyclic nonapeptide-bearing phage display library from purified ANDV particles. Phage was examined for ANDV infection inhibition in vitro, and nonapeptides were synthesized based on the most-potent phage sequences. Three peptides showed levels of viral inhibition which were significantly increased by combination treatment with anti-Gn- and anti-Gc-targeting peptides. These peptides will be valuable tools for further development of both peptide and nonpeptide therapeutic agents.Andes virus (ANDV), an NIAID category A agent linked to hantavirus cardiopulmonary syndrome (HCPS), belongs to the family Bunyaviridae and the genus Hantavirus and is carried by Oligoryzomys longicaudatus rodents (11). HCPS is characterized by pulmonary edema caused by capillary leak, with death often resulting from cardiogenic shock (9, 16). ANDV HCPS has a case fatality rate approaching 40%, and ANDV is the only hantavirus demonstrated to be capable of direct person-to-person transmission (15, 21). There is currently no specific therapy available for treatment of ANDV infection and HCPS.Peptide ligands that target a specific protein surface can have broad applications as therapeutics by blocking specific protein-protein interactions, such as preventing viral engagement of host cell receptors and thus preventing infection. Phage display libraries provide a powerful and inexpensive tool to identify such peptides. Here, we used selection of a cyclic nonapeptide-bearing phage library to identify peptides capable of binding the transmembrane surface glycoproteins of ANDV, Gn and Gc, and blocking infection in vitro.To identify peptide sequences capable of recognizing ANDV, we panned a cysteine-constrained cyclic nonapeptide-bearing phage display library (New England Biolabs) against density gradient-purified, UV-treated ANDV strain CHI-7913 (a gift from Hector Galeno, Santiago, Chile) (17, 18). To increase the specificity of the peptides identified, we eluted phage by using monoclonal antibodies (Austral Biologicals) prepared against recombinant fragments of ANDV Gn (residues 1 to 353) or Gc (residues 182 to 491) glycoproteins (antibodies 6B9/F5 and 6C5/D12, respectively). Peptide sequences were determined for phage from iterative rounds of panning, and the ability of phage to inhibit ANDV infection of Vero E6 cells was determined by immunofluorescent assay (IFA) (7). Primary IFA detection antibodies were rabbit polyclonal anti-Sin Nombre hantavirus (SNV) nucleoprotein (N) antibodies which exhibit potent cross-reactivity against other hantavirus N antigens (3). ReoPro, a commercially available Fab fragment which partially blocks infection of hantaviruses in vitro by binding the entry receptor integrin β3 (5), was used as a positive control (80 μg/ml) along with the original antibody used for phage elution (5 μg/ml). As the maximum effectiveness of ReoPro in inhibiting hantavirus entry approaches 80%, we set this as a threshold for maximal expected efficacy for normalization. The most-potent phage identified by elution with the anti-Gn antibody 6B9/F5 bore the peptide CPSNVNNIC and inhibited hantavirus entry by greater than 60% (61%) (Table (Table1).1). From phage eluted with the anti-Gc antibody 6C5/D12, those bearing peptides CPMSQNPTC and CPKLHPGGC also inhibited entry by greater than 60% (66% and 72%, respectively).
Open in a separate windowaStandard deviations of four experiments are shown in parentheses. Peptide-bearing phage were added at 109 phage/μl.bP values for the pairwise amino acid alignment score of each peptide versus that of integrin β3 were determined using an unpaired Student''s t test. P values considered statistically significant are shown in bold.To determine whether the peptide sequences of any of the identified inhibitory phage showed homology to integrin β3, a known entry receptor for pathogenic hantaviruses (6, 7), we used the Gap program to perform a pairwise amino acid alignment of each peptide versus the extracellular portion of integrin β3 and determined P values for the alignments. Of 45 phage eluted with the anti-Gn antibody, 6B9/F5, 27 of the peptide sequences showed homology to integrin β3 (P < 0.05), and 9 were highly significant (P ≤ 0.0005) (Fig. (Fig.1A).1A). Of the latter, CKFPLNAAC and CSQFPPRLC map to the hybrid domain (Fig. (Fig.1B),1B), which is proximal to the plexin-semaphorin-integrin domain (PSI) containing residue D39, shown to be critical for viral entry in vitro (19). Five sequences (CPSSPFNH, CPKHVLKVC, CNANKPKMC, CQSQTRNHC, and CDQRTTRLC) map to the I-like (or βA) domain near the binding site of ReoPro (2). Finally, CLPTDPIQC maps to the epidermal growth factor 4 (EGF-4) domain, and CSTRAENQC aligns to a portion of β3 untraceable in the crystal structure, specifically the linker region between the hybrid domain and EGF-1. Although this represents a disordered portion of the protein (22), the location of this loop proximal to the PSI domain is worth noting, due to the role of the PSI domain in facilitating viral entry (19). Therefore, 60% of phage eluted with the anti-Gn antibody showed some homology to integrin β3, and those with highly significant P values predominantly mapped to or proximal to regions of known interest in viral entry.Open in a separate windowFIG. 1.Inhibitory peptides identified through phage panning against ANDV show homology to integrin β3. (A) Alignment of phage peptide sequences with P values for integrin β3 pairwise alignment of less than 0.05. Residues comprising the signal peptide, transmembrane, and cytoplasmic domains, which were not included during pairwise alignment, are underlined. Residues 461 to 548, which are missing in the crystal structure, are italicized. Residues involved in the ReoPro binding site are highlighted in green (2). Residue D39 of the PSI domain is highlighted in yellow (19). Peptides are shown above the sequence of integrin β3, with antibody 6C5/D12-eluted sequences shown in blue text and sequences eluted with antibody 6B9/F5 shown in red. Peptide sequences with alignment P values of ≤0.0005 are highlighted in yellow. Percent inhibition of the peptide-bearing phage is shown in parentheses. (B) View of integrin αvβ3 (PDB ID 1U8C [23]). αv is shown in blue ribbon diagram, and β3 is shown in salmon-colored surface representation, with specific domains circled. Residues corresponding to the ReoPro binding site are shown in green, as in panel A, and D39 is shown in yellow. Regions corresponding to 6C5/D12-eluted peptides with P values of ≤0.0005 for alignment with integrin β3 (highlighted in panel A) are shown in blue, and those corresponding to 6B9/F5-eluted peptides with P values of ≤0.0005 for alignment with integrin β3 are shown in red. Alignment of peptide PLASTRT (P value of 0.0040) adjacent to D39 of the PSI domain is shown in magenta. Graphics were prepared using Pymol (DeLano Scientific LLC, San Carlos, CA).Of the 41 peptide-bearing phage eluted with the anti-Gc antibody 6C5/D12, 14 showed sequence homology to integrin β3 (P < 0.05), 4 of which had P values of ≤0.0005 (Fig. (Fig.1A).1A). Of the latter, sequence CTTMTRMTC mapped to the base of the I-like domain (Fig. (Fig.1B),1B), while CHGVYALHC and CRDTTPWWC mapped to the EGF-3 domain. Finally, sequence CTPTMHNHC mapped to the linker region untraceable in the crystal structure. Therefore, in contrast to peptide sequences identified by competition with the anti-Gn antibody, sequences identified by competition with the anti-Gc antibody 6C5/D12 appear to be mostly unrelated to integrin β3.As a low level of pathogenic hantavirus infection can be seen in cells lacking integrin β3, such as CHO cells (19), we asked if any of the identified peptide sequences could represent a previously unidentified receptor. We used the Basic Local Alignment Search Tool to search a current database of human protein sequences for potential alternate receptors represented by these peptides. However, none of the alignments identified proteins that are expressed at the cell surface, eliminating them as potential candidates for alternate viral entry receptors. This suggests that the majority of the peptides identified here likely represent novel sequences for binding ANDV surface glycoproteins.To determine whether synthetic peptides would also block infection, we synthesized cyclic peptides based on the 10 most-potent peptide-bearing phage. These peptides, in the context of phage presentation, showed levels of inhibition ranging from 44 to 72% (Table (Table2).2). When tested by IFA at 1 mM, four of the synthetic peptides showed inhibition levels significantly lower than those of the same peptide presented in the context of phage. This is not surprising, as steric factors due to the size of the phage and the multivalent presentation of peptide in the context of phage may both contribute to infection inhibition (8). However, there was no significant difference in inhibition by synthetic peptide versus peptide-bearing phage for six of the sequences, implying that inhibition in the context of phage was due solely to the nature of the peptide itself and not to steric factors or valency considerations contributed by the phage, which contrasts with our previous results, determined by using phage directed against αvβ3 integrin (10).
Open in a separate windowaStandard deviations of the results of at least four experiments are shown in parentheses.bMean percent inhibition between phage and synthetic peptide differs significantly (P < 0.05).The three most-potent synthetic peptides were examined for their ability to inhibit ANDV entry in a dose-dependent manner. The concentration of each peptide that produces 50% of its maximum potential inhibitory effect was determined. As shown in Fig. Fig.2A,2A, the 50% inhibitory concentration for each of the peptides was in the range of 10 μM, which from our experience is a reasonable potency for a lead compound to take forward for optimization.Open in a separate windowFIG. 2.Activities of synthetic peptides in inhibition of ANDV infection in vitro. (A) Peptides were examined for their ability to block ANDV infection of Vero E6 cells in a dose-dependent manner by IFA. (B) Peptides were tested in parallel for the ability to block infection of Vero E6 cells by ANDV, SNV, HTNV, and PHV. (C) Peptides were tested, singly or in combination, for the ability to block ANDV infection of Vero E6 cells. For all experiments, controls included media, ReoPro at 80 μg/ml, and monoclonal antibodies 6C5/D12 and 6B9/F5 at 5 μg/ml. All peptides were used at 1 mM. Data points represent n = 2 to 6, with error bars showing the standard errors of the means. Statistical analyses were performed on replicate samples using an unpaired Student''s t test.In order to determine the specificity of the three most-potent synthetic cyclic peptides in blocking ANDV, we examined them for inhibition of ANDV infection versus two other pathogenic hantaviruses, SNV and Hantaan virus (HTNV), or the nonpathogenic hantavirus Prospect Hill virus (PHV). As shown in Fig. Fig.2B,2B, ReoPro, which binds integrin β3, showed inhibition of infection by each of the pathogenic hantavirus strains, known to enter cells via β3, but not the nonpathogenic PHV, which enters via integrin β1 (6, 7). In contrast, peptides selected for the ability to bind ANDV were highly specific inhibitors of ANDV versus SNV, HTNV, or PHV. The specificities of peptides eluted by the anti-Gn monoclonal antibody are not surprising, as they are likely due to global differences in the Gn amino acid sequence. Specifically, sequence homologies between ANDV and SNV, HTNV, and PHV are 61%, 36%, and 51%, respectively, for the region corresponding to the immunogen for antibody 6B9/F5. Although homology between the immunogen for antibody 6C5/D12 and the corresponding Gc region of these viruses is somewhat higher (82% with SNV, 63% with HTNV, and 71% with PHV), the possibility that the monoclonal antibody used here recognizes a three-dimensional epitope lends itself to the high specificity of the peptides.The current model for cellular infection by hantaviruses (14) is as follows. Viral binding of the host cell surface target integrin is followed by receptor-mediated endocytosis and endosome acidification. Lowered pH induces conformational changes in Gn and/or Gc, which facilitate membrane fusion and viral release into the cytosol. As there is currently little information available about whether one glycoprotein is dominant in mediating infection, and as neutralizing epitopes have been found on both Gn and Gc glycoproteins (1, 4, 12, 13, 20), we examined whether combining anti-Gn- and anti-Gc-targeted synthetic peptides would lead to an increased infection blockade compared to those for single treatments. As shown in Fig. Fig.2C,2C, the combination of anti-Gn and anti-Gc peptides CMQSAAAHC and CTVGPTRSC resulted in a significant increase in infection inhibition (P = 0.0207 for CMQSAAAHC, and P = 0.0308 for CTVGPTRSC) compared to that resulting from single treatments. Although the high specificity of the peptides for ANDV makes it unlikely that this combination treatment will lead to more cross-reactivity with other pathogenic hantaviruses, this can be determined only by additional testing. Regardless, these data suggest a unique role for each of these viral proteins in the infection process as well as the benefits of targeting multiple viral epitopes for preventing infection.To our knowledge, the peptides reported here are the first identified that directly target ANDV, and this work further illustrates the power of coupling phage display and selective elution techniques in the identification of novel peptide sequences capable of specific protein-protein interactions from a large, random pool of peptide sequences. These novel peptide inhibitors (R. S. Larson, P. R. Hall, H. Njus, and B. Hjelle, U.S. patent application 61/205,211) provide leads for the development of more-potent peptide or nonpeptide organics for therapeutic use against HCPS. 相似文献
TABLE 1.
Peptide-bearing phage eluted from ANDVPhage | % Inhibition (SD)a | P valueb |
---|---|---|
Phage bearing the following peptides eluted with anti-Gn antibody 6B9/F5 | ||
Group 1 (<30% inhibition) | ||
CDQRTTRLC | 8.45 (15.34) | 0.0002 |
CPHDPNHPC | 9.94 (7.72) | 0.333 |
CQSQTRNHC | 11.76 (13.25) | 0.0001 |
CLQDMRQFC | 13.26 (9.92) | 0.0014 |
CLPTDPIQC | 15.70 (14.05) | 0.0005 |
CPDHPFLRC | 16.65 (15.22) | 0.8523 |
CSTRAENQC | 17.56 (16.50) | 0.0004 |
CPSHLDAFC | 18.98 (20.06) | 0.0017 |
CKTGHMRIC | 20.84 (7.47) | 0.0563 |
CVRTPTHHC | 20.89 (27.07) | 0.1483 |
CSGVINTTC | 21.57 (19.61) | 0.0643 |
CPLASTRTC | 21.65 (5.98) | 0.004 |
CSQFPPRLC | 22.19 (8.26) | 0.0004 |
CLLNKQNAC | 22.34 (7.78) | 0.001 |
CKFPLNAAC | 22.89 (6.15) | 0.0001 |
CSLTPHRSC | 23.63 (16.74) | 0.0563 |
CKPWPMYSC | 23.71 (6.68) | 0.0643 |
CLQHDALNC | 24.01 (7.60) | 1 |
CNANKPKMC | 24.67 (11.67) | 0.0004 |
CPKHVLKVC | 25.30 (28.36) | 0.0003 |
CTPDKKSFC | 26.91 (11.15) | 0.399 |
CHGKAALAC | 27.22 (32.53) | 0.005 |
CNLMGNPHC | 28.08 (21.35) | 0.0011 |
CLKNWFQPC | 28.64 (18.49) | 0.0016 |
CKEYGRQMC | 28.76 (29.33) | 0.0362 |
CQPSDPHLC | 29.44 (31.22) | 0.0183 |
CSHLPPNRC | 29.70 (17.37) | 0.0061 |
Group 2 (30-59% inhibition) | ||
CSPLLRTVC | 33.05 (20.26) | 0.0023 |
CHKGHTWNC | 34.17 (12.50) | 0.0795 |
CINASHAHC | 35.62 (13.03) | 0.3193 |
CWPPSSRTC | 36.75 (26.95) | 0.0006 |
CPSSPFNHC | 37.78 (7.11) | 0.0001 |
CEHLSHAAC | 38.47 (7.60) | 0.0115 |
CQDRKTSQC | 38.74 (9.12) | 0.1802 |
CTDVYRPTC | 38.90 (25.03) | 0.006 |
CGEKSAQLC | 39.11 (27.52) | 0.0013 |
CSAAERLNC | 40.13 (6.33) | 0.0033 |
CFRTLEHLC | 42.07 (5.01) | 0.0608 |
CEKLHTASC | 43.60 (27.92) | 0.1684 |
CSLHSHKGC | 45.11 (49.81) | 0.0864 |
CNSHSPVHC | 45.40 (28.80) | 0.0115 |
CMQSAAAHC | 48.88 (44.40) | 0.5794 |
CPAASHPRC | 51.84 (17.09) | 0.1935 |
CKSLGSSQC | 53.90 (13.34) | 0.0145 |
Group 3 (60-79% inhibition) | ||
CPSNVNNIC | 61.11 (25.41) | 0.1245 |
Negative control | 0 (6.15) | |
6B9/F5 (5 μg/ml) | 26.77 (5.33) | |
ReoPro (80 μg/ml) | 79.86 (4.88) | |
Phage bearing the following peptides eluted with anti-Gc antibody 6C5/D12 | ||
Group 1 (<30% inhibition) | ||
CHPGSSSRC | 1.01 (7.03) | 0.0557 |
CSLSPLGRC | 10.56 (13.62) | 0.7895 |
CTARYTQHC | 12.86 (3.83) | 0.3193 |
CHGVYALHC | 12.91 (7.32) | 0.0003 |
CLQHNEREC | 16.79 (13.72) | 0.0958 |
CHPSTHRYC | 17.23 (14.53) | 0.0011 |
CPGNWWSTC | 19.34(9.91) | 0.1483 |
CGMLNWNRC | 19.48 (19.42) | 0.0777 |
CPHTQFWQC | 20.44 (13.65) | 0.0008 |
CTPTMHNHC | 20.92 (11.68) | 0.0001 |
CDQVAGYSC | 21.79 (23.60) | 0.0063 |
CIPMMTEFC | 24.33 (9.28) | 0.2999 |
CERPYSRLC | 24.38 (9.09) | 0.0041 |
CPSLHTREC | 25.06 (22.78) | 0.1202 |
CSPLQIPYC | 26.30 (34.29) | 0.4673 |
CTTMTRMTC (×2) | 29.27 (8.65) | 0.0001 |
Group 2 (30-59% inhibition) | ||
CNKPFSLPC | 30.09 (5.59) | 0.4384 |
CHNLESGTC | 31.63 (26.67) | 0.751 |
CNSVPPYQC | 31.96 (6.51) | 0.0903 |
CSDSWLPRC | 32.95 (28.54) | 0.259 |
CSAPFTKSC | 33.40 (10.64) | 0.0052 |
CEGLPNIDC | 35.63 (19.90) | 0.0853 |
CTSTHTKTC | 36.28 (13.42) | 0.132 |
CLSIHSSVC | 36.40 (16.44) | 0.8981 |
CPWSTQYAC | 36.81 (32.81) | 0.5725 |
CTGSNLPIC | 36.83 (31.64) | 0.0307 |
CSLAPANTC | 39.73 (4.03) | 0.1664 |
CGLKTNPAC | 39.75 (16.98) | 0.2084 |
CRDTTPWWC | 40.08 (18.52) | 0.0004 |
CHTNASPHC | 40.26 (4.77) | 0.5904 |
CTSMAYHHC | 41.89 (8.61) | 0.259 |
CSLSSPRIC | 42.13 (29.75) | 0.2463 |
CVSLEHQNC | 45.54 (6.55) | 0.5065 |
CRVTQTHTC | 46.55 (8.45) | 0.3676 |
CPTTKSNVC | 49.28 (14.00) | 0.3898 |
CSPGPHRVC | 49.50 (42.60) | 0.0115 |
CKSTSNVYC | 51.20 (4.60) | 0.0611 |
CTVGPTRSC | 57.30 (11.31) | 0.0176 |
Group 3 (60-79% inhibition) | ||
CPMSQNPTC | 65.60 (13.49) | 0.014 |
CPKLHPGGC | 71.88 (27.11) | 0.0059 |
Negative control | 0.26 (4.53) | |
6C5/D12 (5 μg/ml) | 22.62 (8.40) | |
ReoPro (80 μg/ml) | 80.02 (76.64) |
TABLE 2.
Synthetic cyclic peptides inhibit ANDV infectionTarget | Sample | % Inhibition bya:
| |
---|---|---|---|
Peptide-bearing phage | Synthetic peptide | ||
Gn | CMQSAAAHC | 48.88 (44.40) | 59.66 (11.17) |
Gc | CTVGPTRSC | 57.30 (11.31) | 46.47 (7.61) |
Gn | CPSNVNNIC | 61.11 (25.41) | 44.14 (10.74) |
Gn | CEKLHTASC | 43.60 (27.92) | 34.87 (9.26) |
Gc | CPKLHPGGC | 71.88 (27.11) | 30.95 (7.73)b |
Gn | CSLHSHKGC | 45.11 (49.81) | 29.79 (9.34) |
Gc | CPMSQNPTC | 65.60 (13.49) | 18.19 (8.55)b |
Gn | CKSLGSSQC | 53.90 (13.34) | 18.10 (7.55)b |
Gn | CNSHSPVHC | 45.40 (28.80) | 15.52 (10.48) |
Gn | CPAASHPRC | 51.84 (17.09) | 0 (10.72)b |
Integrin β3 | ReoPro | 80.10 (7.72) | |
Gn | 6B9/F5 antibody | 42.72 (6.75) | |
Gc | 6C5/D12 antibody | 31.04 (7.81) |
9.
Camilla L. Nesb? Rajkumari Kumaraswamy Marlena Dlutek W. Ford Doolittle Julia Foght 《Applied and environmental microbiology》2010,76(14):4896-4900
All cultivated Thermotogales are thermophiles or hyperthermophiles. However, optimized 16S rRNA primers successfully amplified Thermotogales sequences from temperate hydrocarbon-impacted sites, mesothermic oil reservoirs, and enrichment cultures incubated at <46°C. We conclude that distinct Thermotogales lineages commonly inhabit low-temperature environments but may be underreported, likely due to “universal” 16S rRNA gene primer bias.Thermotogales, a bacterial group in which all cultivated members are anaerobic thermophiles or hyperthermophiles (5), are rarely detected in anoxic mesothermic environments, yet their presence in corresponding enrichment cultures, bioreactors, and fermentors has been observed using metagenomic methods and 16S rRNA gene amplification (6) (see Table S1 in the supplemental material). The most commonly detected lineage is informally designated here “mesotoga M1” (see Table S1 in the supplemental material). PCR experiments indicated that mesotoga M1 sequences amplified inconsistently using “universal” 16S rRNA gene primers, perhaps explaining their poor detection in DNA isolated from environmental samples (see text and Table S2 in the supplemental material). We therefore designed three 16S rRNA PCR primer sets (Table (Table1)1) targeting mesotoga M1 bacteria and their closest cultivated relative, Kosmotoga olearia. Primer set A was the most successful set, detecting a wider diversity of Thermotogales sequences than set B and being more Thermotogales-specific than primer set C (Table (Table22).
Open in a separate windowaHeterogeneity hot spots identified in reference 1.
Open in a separate windowaSee the supplemental material for site and methodological details. NA, not applicable; ND, not determined.bThe number of OTUs observed at a 0.01 distance cutoff is given for each primer set. The numbers of clones with Thermotogales sequences are in parentheses. —, PCR was attempted but no Thermotogales sequences were obtained or the PCR consistently failed.c+, sequence(s) detected; −, not detected. For more information on the enrichments, see the text and Table S3 in the supplemental material.dFrom April to May 2004, the temperature at the depth where the sample was taken was 12°C (7).eThere were no water samples from DWH and HSAT available for enrichment cultures, and no DNA was available from HWH.fThis reservoir has been treated with biocides; moreover, at this site, the water is filtered before being reinjected into the reservoir.gTemperatures of the oil pool where the water sample was obtained. The HSAT facility receives water from two oil pools, one at 41°C and one at 50°C.hWe screened DNA from samples taken in 2006 and 2008 but detected the same sequences in both, so sequences from the two samples were pooled.iThe mesotoga M1 and Kosmotoga sequences from DWH and DF were >99% similar and were assembled into one sequence in Fig. Fig.11.jThis reservoir has been injected with water from a neighboring oil reservoir.Since the putative mesophilic Thermotogales have been overwhelmingly associated with polluted and hydrocarbon-impacted environments and mesothermic oil reservoirs are the only natural environments where mesotoga M1 sequences previously were detected (see Table S1 in the supplemental material), we selected four oil reservoirs with in situ temperatures of 14°C to 53°C and two temperate, chronically hydrocarbon-impacted sites for analysis (Table (Table2).2). Total community DNA was extracted, the 16S rRNA genes were amplified, cloned, and sequenced as described in the supplemental material. 相似文献
TABLE 1.
Primers targeting mesotoga M1 bacteria constructed and used in this studyPrimer | Sequence (5′ to 3′) | Position in mesotoga 16S rRNA gene | No. of heterogeneity hot spotsa | Potential primer match in other Thermotogales lineages |
---|---|---|---|---|
Primer set A | 1 (helix 17) | |||
NMes16S.286F | CGGCCACAAGGAYACTGAGA | 286 | Perfect match in Kosmotoga olearia. The last 7 or 8 nucleotides at the 3′ end are conserved in other Thermotogales lineages. | |
NMes16S.786R | TGAACATCGTTTAGGGCCAG | 786 | One 5′ mismatch in Kosmotoga olearia and Petrotoga mobilis; 2-4 internal and 5′ mismatches in other lineages | |
Primer set B | None | |||
BaltD.42F | ATCACTGGGCGTAAAGGGAG | 540 | Perfect match in Kosmotoga olearia; one or two 3′ mismatches in most other Thermotogales lineages | |
BaltD.494R | GTGGTCGTTCCTCTTTCAAT | 992 | No match in other Thermotogaleslineages. The primer is located in heterogeneity hot spot helices 33 and 34. This primer also fails to amplify some mesotoga M1 sequences. | |
Primer set C | 9 (all 9 regions) | |||
TSSU-3F | TATGGAGGGTTTGATCCTGG | 3 | Perfect match in Thermotoga spp., Kosmotoga olearia, and Petrotoga mobilis; two or three 5′ mismatches in other Thermotogales lineages; one 5′ mismatch to mesotoga M1 16S rRNA genes | |
Mes16S.R | ACCAACTCGGGTGGCTTGAC | 1390 | One 5′ mismatch in Kosmotoga olearia; 1-3 internal or 5′ mismatches in other Thermotogales lineages |
TABLE 2.
Mesotoga clade sequences detected in environmental samples and enrichment cultures screened in this studyaSite (abbreviation) | Temp in situ(°C) | Waterflooded | Environmental samplesb | Enrichment cultures | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Primer set A | Primer set B | Primer set C | Thermotogalesdetected by primer setc: | Lineage(s) detected | ||||||||
No. of OTUs (no. of clones) | Lineage | No. of OTUs (no. of clones) | Lineage | No. of OTUs (no. of clones) | Lineage | A | B | C | ||||
Sidney Tar Ponds sediment (TAR) | Temperate | NA | 1 (5) | M1 | 1 | M1 | — | — | + | + | + | M1, M2, M5 |
Oil sands settling basin tailings (05mlsb) | ∼12d | NA | — | — | 1 (6) | M1 | — | — | − | + | − | M1 |
Grosmont A produced water (GrosA) | 20 | No | 1 (15) | M1 | 1 (22) | M1 | 2 (14) | M1 | + | + | + | M1 |
Foster Creek produced water (FC) | 14 | No | 1 (21) | M1 | 1 (23) | M1 | 1 (1) | M1 | + | ND | − | M1 |
Oil field D wellhead water (DWH)e,f | 52-53g | Yes | 1 (14) | Kosmotogai | 1 (6) | M1i | 1 (1) | Kosmotogai | NA | NA | NA | NA |
Oil field D FWKO water (DF)f,h | 20-30 | Yes | 1 (45) | Kosmotogai | 1 (17) | M1i | — | — | + | + | − | M1, Kosmotoga, Petrotoga |
Oil field H FWKO water (HF)j | 30-32 | Yes | 7 (59) | M1, M2, M3, M4, Kosmotoga | 1 (29) | M1 | — | — | + | + | − | M1, Petrotoga |
Oil field H satellite water (HSAT)e,j | 41 and 50g | Yes | 1 (8) | M1 | — | — | 2 (16) | Kosmotoga, Thermotoga | NA | NA | NA | NA |
Oil field H wellhead water (HWH)e,j | 41 and 50g | Yes | NA | — | — | NA | NA | NA | + | + | + | M1, Petrotoga |
10.
11.
Dione B. Rolim Marcos F. G. Rocha Raimunda S. N. Brilhante Rossana A. Cordeiro Natanael P. Leit?o-Junior Timothy J. J. Inglis José J. C. Sidrim 《Applied and environmental microbiology》2009,75(4):1215-1218
Melioidosis has been considered an emerging disease in Brazil since the first cases were reported to occur in the northeast region. This study investigated two municipalities in Ceará state where melioidosis cases have been confirmed to occur. Burkholderia pseudomallei was isolated in 26 (4.3%) of 600 samples in the dry and rainy seasons.Melioidosis is an endemic disease in Southeast Asia and northern Australia (2, 4) and also occurs sporadically in other parts of the world (3, 7). Human melioidosis was reported to occur in Brazil only in 2003, when a family outbreak afflicted four sisters in the rural part of the municipality of Tejuçuoca, Ceará state (14). After this episode, there was one reported case of melioidosis in 2004 in the rural area of Banabuiú, Ceará (14). And in 2005, a case of melioidosis associated with near drowning after a car accident was confirmed to occur in Aracoiaba, Ceará (11).The goal of this study was to investigate the Tejuçuoca and Banabuiú municipalities, where human cases of melioidosis have been confirmed to occur, and to gain a better understanding of the ecology of Burkholderia pseudomallei in this region.We chose as central points of the study the residences and surrounding areas of the melioidosis patients in the rural areas of Banabuiú (5°18′35″S, 38°55′14″W) and Tejuçuoca (03°59′20″S, 39°34′50′W) (Fig. (Fig.1).1). There are two well-defined seasons in each of these locations: one rainy (running from January to May) and one dry (from June to December). A total of 600 samples were collected at five sites in Tejuçuoca (T1, T2, T3, T4, and T5) and five in Banabuiú (B1, B2, B3, B4, and B5), distributed as follows (Fig. (Fig.2):2): backyards (B1 and T1), places shaded by trees (B2 and T2), water courses (B3 and T3), wet places (B4 and T4), and stock breeding areas (B5 and T5).Open in a separate windowFIG. 1.Municipalities of Banabuiú (5°18′35″S, 38°55′14″W) and Tejuçuoca (03°59′20″S, 39°34′50″W).Open in a separate windowFIG. 2.Soil sampling sites in Banabuiú and Tejuçuoca.Once a month for 12 months (a complete dry/rainy cycle), five samples were gathered at five different depths: at the surface and at 10, 20, 30 and 40 cm (Table (Table1).1). The samples were gathered according to the method used by Inglis et al. (9). Additionally, the sample processing and B. pseudomallei identification were carried out as previously reported (1, 8, 9).
Open in a separate windowaSites designated with B are in Banabuiú, and sites designated with T are in Tejuçuoca. See the text for details.The data on weather and soil composition were obtained from specialized government institutions, such as FUNCEME, IPECE, and EMBRAPA. The average annual temperature in both municipalities is between 26 and 28°C. In 2007, the annual rainfall in Tejuçuoca was 496.8 mm, and that in Banabuiú was 766.8 mm. There are a range of soil types in both Tejuçuoca and Banabuiú: noncalcic brown, sodic planossolic, red-yellow podzolic, and litholic. In Banabuiú, there are also alluvial and cambisol soils. The characteristic vegetation in both municipalities is caatinga (scrublands).There were isolates of B. pseudomallei in 26 (4.3%) of the 600 samples collected. The bacterium was isolated at a rate (3%) similar to that previously reported (9). The bacterium isolation occurred in both the dry (53.8%) and the rainy (46.2%) seasons. Tejuçuoca represented 76.9% (20/26) of the strains isolated. Four sites in Tejuçuoca (T1, T3, T4, and T5) and three in Banabuiú (B1, B2, and B4) presented isolates of the bacterium (Table (Table1).1). The isolation of the B. pseudomallei strains varied from the surface down to 40 cm. However, 17 of the 26 positive samples (65.3%) were found at depths between 20 and 40 cm (Table (Table1).1). Only two isolates were found at the surface during the dry season.A study in Vietnam (13) and one in Australia (9) reported the presence of B. pseudomallei near the houses of melioidosis patients. In our study, the same thing happened. Site T3 (15/26; 57.6%) was located 290 m from the patient''s house, as reported by the Rolim group (14).B. pseudomallei was isolated from a sheep paddock in Australia, where animals sought shelter below mango and fig trees (17). In our study, the bacterium was isolated at site T5, a goat corral alongside the house where the outbreak occurred in Tejuçuoca. Four sites in places shaded by trees yielded positive samples (30.7%) in both Tejuçuoca (palm trees) and Banabuiú (mango trees). Additionally, B. pseudomallei was isolated on three occasions from a cornfield (site 4B) located alongside the house of the melioidosis patient in Banabuiú.In the main areas of endemicity, the disease is more prevalent in the rainy season (4, 5, 16). The outbreak in Tejuçuoca was related to rainfall (14). Besides the association of cases of the disease with rainfall itself, the isolation of B. pseudomallei in soil and water was also demonstrated during the dry season (12, 15). An Australian study isolated strains from soil and water during the dry and rainy seasons (17). A Thai study also reported B. pseudomallei in the dry season (18). In our study, the isolation of B. pseudomallei took place either at the end of the wet season or in the dry months. Fourteen of the positive samples (53.8%) were collected during the dry season, albeit near a river or reservoir (sites T3 and B4).Physical, biological, and chemical soil features appear to influence the survival of B. pseudomallei (6, 10). In the present study, the soil was classified as litholic with sandy or clayey textures. It is susceptible to erosion, and when there is a lack of water, it is subject to salinization. During the dry season, the clay layer becomes dried, cracked, and very hard. During the rainy season, it becomes soggy and sticky. The isolation of B. pseudomallei in the dry season is possibly related to the capacity for adaptation of this soil, since the extreme conditions of lithosols do not prevent the bacterial growth and survival.It has been shown that B. pseudomallei is more often isolated at depths between 25 and 45 cm (17). In our study, 65.3% of the positive samples were taken at depths between 20 and 40 cm. Moreover, of these 17 samples, 10 (58.8%) were collected during the dry months. Also, unlike in other regions, two positive samples were taken from the surface in the period without rainfall.The rainfall in Tejuçuoca and Banabuiú is generally low, and temperatures do not vary significantly during the year. Therefore, the isolation of B. pseudomallei in these places occurs outside the rainfall, temperature, and moisture conditions observed in other regions of endemicity. Our data thus suggest that peculiar environmental features, such as soil composition, might favor the multiplication of B. pseudomallei in northeast Brazil. 相似文献
TABLE 1.
Distribution of samples with isolates by site and soil depthSitesa and depth (cm) | No. of B. pseudomallei isolates in samples from:
| ||
---|---|---|---|
Banabuiú (n = 300) | Tejuçuoca (n = 300) | Total (n = 600) | |
B1/T1 | 3 | ||
Surface | 2 | ||
10 | |||
20 | 1 | ||
30 | |||
40 | |||
B2/T2 | 1 | ||
Surface | 1 | ||
10 | |||
20 | |||
30 | |||
40 | |||
B3/T3 | 15 | ||
Surface | 2 | ||
10 | 2 | ||
20 | 4 | ||
30 | 3 | ||
40 | 4 | ||
B4/T4 | 5 | ||
Surface | |||
10 | 1 | ||
20 | 1 | ||
30 | 1 | 1 | |
40 | 1 | ||
B5/T5 | 2 | ||
Surface | |||
10 | |||
20 | |||
30 | 2 | ||
40 | |||
Total | 6 | 20 | 26 |
12.
13.
Aurelio Cafaro Stefania Bellino Fausto Titti Maria Teresa Maggiorella Leonardo Sernicola Roger W. Wiseman David Venzon Julie A. Karl David O'Connor Paolo Monini Marjorie Robert-Guroff Barbara Ensoli 《Journal of virology》2010,84(17):8953-8958
The effects of the challenge dose and major histocompatibility complex (MHC) class IB alleles were analyzed in 112 Mauritian cynomolgus monkeys vaccinated (n = 67) or not vaccinated (n = 45) with Tat and challenged with simian/human immunodeficiency virus (SHIV) 89.6Pcy243. In the controls, the challenge dose (10 to 20 50% monkey infectious doses [MID50]) or MHC did not affect susceptibility to infection, peak viral load, or acute CD4 T-cell loss, whereas in the chronic phase of infection, the H1 haplotype correlated with a high viral load (P = 0.0280) and CD4 loss (P = 0.0343). Vaccination reduced the rate of infection acquisition at 10 MID50 (P < 0.0001), and contained acute CD4 loss at 15 MID50 (P = 0.0099). Haplotypes H2 and H6 were correlated with increased susceptibility (P = 0.0199) and resistance (P = 0.0087) to infection, respectively. Vaccination also contained CD4 depletion (P = 0.0391) during chronic infection, independently of the challenge dose or haplotype.Advances in typing of the major histocompatibility complex (MHC) of Mauritian cynomolgus macaques (14, 20, 26) have provided the opportunity to address the influence of host factors on vaccine studies (13). Retrospective analysis of 22 macaques vaccinated with Tat or a Tat-expressing adenoviral vector revealed that monkeys with the H6 or H3 MHC class IB haplotype were overrepresented among aviremic or controller animals, whereas macaques with the H2 or H5 haplotype clustered in the noncontrollers (12). More recently, the H6 haplotype was reported to correlate with control of chronic infection with simian immunodeficiency virus (SIV) mac251, regardless of vaccination (18).Here, we performed a retrospective analysis of 112 Mauritian cynomolgus macaques, which included the 22 animals studied previously (12), to evaluate the impact of the challenge dose and class IB haplotype on the acquisition and severity of simian/human immunodeficiency virus (SHIV) 89.6Pcy243 infection in 45 control monkeys and 67 monkeys vaccinated with Tat from different protocols (Table (Table11).
Open in a separate windowaAll animals were inoculated with the indicated dose of Tat plasmid DNA (pCV-tat [8], adenovirus-tat [Ad-tat] [27]) or protein, Gag protein, or empty vectors (pCV-0, adenovirus [Ad]) by the indicated route. Doses are in micrograms unless indicated otherwise.bAlum, aluminum phosphate (4); RIBI oil-in-water emulsions containing squalene, bacterial monophosphoryl lipid A, and refined mycobacterial products (4); Iscom, immune-stimulating complex (4); H1D are biocompatible anionic polymeric microparticles used for vaccine delivery (10, 12, 25a).cs.c., subcutaneous; i.m., intramuscular; i.d., intradermal; i.n., intranasal; i.t., intratracheal.dAll animals were inoculated intravenously with the indicated dose of the same SHIV89.6.Pcy243 stock.eAccording to the virological outcome upon challenge, monkeys were grouped as aviremic (A), controllers (C), or viremic (V).fBecause of the short follow-up, controller status could not be determined and all infected monkeys of the ISS-TG protocol were therefore considered viremic.gNA, not applicable. 相似文献
TABLE 1.
Summary of treatment, challenge dose, and outcome of infection in cynomolgus monkeysProtocol code | No. of monkeys | Immunogen (dose)a | Adjuvantb | Schedule of immunization (wk) | Routec | Challenged (MID50) | Virological outcomee | Reference(s) or source | ||
---|---|---|---|---|---|---|---|---|---|---|
A | C | V | ||||||||
ISS-ST | 6 | Tat (10) | Alum or RIBI | 0, 2, 6, 12, 15, 21, 28, 32, 36 | s.c., i.m. | 10 | 4 | 1 | 1 | 4, 17 |
ISS-ST | 1 | Tat (6) | None | 0, 5, 12, 17, 22, 27, 32, 38, 42, 48 | i.d. | 10 | 1 | 0 | 0 | 4, 17 |
ISS-PCV | 3 | pCV-tat (1 mg) | Bupivacaine + methylparaben | 0, 2, 6, 11, 15, 21, 28, 32, 36 | i.m. | 10 | 3 | 0 | 0 | 6 |
ISS-ID | 3 | Tat (6) | none | 0, 4, 8, 12, 16, 20, 24, 28, 39, 43, 60 | i.d. | 10 | 1 | 1 | 1 | B. Ensoli, unpublished data |
ISS-TR | 6 | Tat (10) | Alum-Iscom | 0, 2, 6, 11, 16, 21, 28, 32, 36 | s.c., i.d., i.m. | 10 | 4 | 2 | 0 | Ensoli, unpublished |
ISS-TGf | 3 | Tat (10) | Alum | 0, 4, 12, 22 | s.c. | 15 | 0 | 3 | Ensoli, unpublished | |
ISS-TG | 3 | Tatcys22 (10) | Alum | 15 | 0 | 3 | Ensoli, unpublished | |||
ISS-TG | 4 | Tatcys22 (10) + Gag (60) | Alum | 15 | 0 | 4 | Ensoli, unpublished | |||
ISS-TG | 4 | Tat (10) + Gag (60) | Alum | 15 | 0 | 4 | Ensoli, unpublished | |||
ISS-MP | 3 | Tat (10) | H1D-Alum | 0, 4, 12, 18, 21, 38 | s.c., i.m. | 15 | 0 | 2 | 1 | Ensoli, unpublished |
ISS-MP | 3 | Tat (10) | Alum | s.c. | 15 | 0 | 0 | 3 | Ensoli, unpublished | |
ISS-GS | 6 | Tat (10) | H1D-Alum | 0, 4, 12, 18, 21, 36 | s.c., i.m. | 15 | 1 | 3 | 2 | Ensoli, unpublished |
NCI-Ad-tat/Tat | 7 | Ad-tat (5 × 108 PFU), Tat (10) | Alum | 0, 12, 24, 36 | i.n., i.t., s.c. | 15 | 2 | 3 | 2 | Ensoli, unpublished |
NCI-Tat | 9 | Tat (6 and 10) | Alum/Iscom | 0, 2, 6, 11, 15, 21, 28, 32, 36 | s.c., i.d., i.m. | 15 | 2 | 4 | 3 | 12 |
ISS-NPT | 3 | pCV-tat (1 mg) | Bupivacaine + methylparaben-Iscom | 0, 2, 8, 13, 17, 22, 28, 46, 71 | i.m. | 20 | 0 | 0 | 3 | Ensoli, unpublished |
ISS-NPT | 3 | pCV-tatcys22 (1 mg) | Bupivacaine + methylparaben-Iscom | 0, 2, 8, 13, 17, 22, 28, 46, 71 | i.m. | 20 | 1 | 1 | 1 | |
Total vaccinated | 67 | 19 | 17 | 31 | ||||||
Naive | 11 | None | None | NAg | NA | 10 or 15 | 1 | 3 | 7 | |
Control | 34 | None, Ad, or pCV-0 | Alum, RIBI, H1D, Iscom or bupivacaine + methylparaben-Iscom | s.c., i.d., i.n., i.t., i.m. | 10, 15, or 20 | 5 | 13 | 16 | ||
Total controls | 45 | 6 | 16 | 23 | ||||||
Total | 112 | 25 | 33 | 54 |
14.
Dahrouge S Hogg WE Russell G Tuna M Geneau R Muldoon LK Kristjansson E Fletcher J 《CMAJ》2012,184(2):E135-E143
Background:
Several jurisdictions attempting to reform primary care have focused on changes in physician remuneration. The goals of this study were to compare the delivery of preventive services by practices in four primary care funding models and to identify organizational factors associated with superior preventive care.Methods:
In a cross-sectional study, we included 137 primary care practices in the province of Ontario (35 fee-for-service practices, 35 with salaried physicians [community health centres], 35 practices in the new capitation model [family health networks] and 32 practices in the established capitation model [health services organizations]). We surveyed 288 family physicians. We reviewed 4108 randomly selected patient charts and assigned prevention scores based on the proportion of eligible preventive manoeuvres delivered for each patient.Results:
A total of 3284 patients were eligible for at least one of six preventive manoeuvres. After adjusting for patient profile and contextual factors, we found that, compared with prevention scores in practices in the new capitation model, scores were significantly lower in fee-for-service practices (β estimate for effect on prevention score = −6.3, 95% confidence interval [CI] −11.9 to −0.6) and practices in the established capitation model (β = −9.1, 95% CI −14.9 to −3.3) but not for those with salaried remuneration (β = −0.8, 95% CI −6.5 to 4.8). After accounting for physician characteristics and organizational structure, the type of funding model was no longer a statistically significant factor. Compared with reference practices, those with at least one female family physician (β = 8.0, 95% CI 4.2 to 11.8), a panel size of fewer than 1600 patients per full-time equivalent family physician (β = 6.8, 95% CI 3.1 to 10.6) and an electronic reminder system (β = 4.6, 95% CI 0.4 to 8.7) had superior prevention scores. The effect of these three factors was largely but not always consistent across the funding models; it was largely consistent across the preventive manoeuvres.Interpretation:
No funding model was clearly associated with superior preventive care. Factors related to physician characteristics and practice structure were stronger predictors of performance. Practices with one or more female physicians, a smaller patient load and an electronic reminder system had superior prevention scores. Our findings raise questions about reform initiatives aimed at increasing patient numbers, but they support the adoption of information technology.Primary care providers are increasingly interested in ensuring that preventive health care be part of their work routines.1 This reorientation fits with the evidence that recommendations from family practitioners increase substantially the likelihood of patients undergoing preventive manoeuvres,2 whereas the lack of such recommendations has been linked with patient noncompliance.3,4Studies evaluating adherence to recommended preventive care suggest that the most pervasive barriers rest with the organization of the health care system and the practice itself, such as the absence of external financial incentives for the work done and the lack of a reminder system in the office.3,5–9Countries attempting to reform their delivery of primary care and improve the delivery of preventive services have often directed their efforts in finding alternatives to the traditional fee-for-service model, in which providers receive payment for each service provided. There are two predominant alternative funding models: capitation (providers receive a fixed lump-sum payment per patient per period, independent of the number of services performed) and salaried remuneration. Some health care systems blend components of fee for service with either of these models or offer additional incentives for reaching defined quality-of-care targets. Despite considerable rhetoric, there is little evidence to point to the remuneration models associated with superior delivery of primary care services.10 The complexity of health care systems makes the evaluation of models through international comparisons difficult.In Canada, the province of Ontario has four primary care funding models (11Table 1:
Characteristics of the four primary care models in the province of Ontario in 2005/06Fee for service | Capitation | ||||
---|---|---|---|---|---|
Characteristic | Salaried (community health centres)* | Traditional* | Reformed† | New (family health networks) | Established (health services organizations) |
Year introduced | 1970s | – | 2004 | 2001 | 1970s |
Group size, no. of physicians | > 1 (no specific size requirement) | 1 | ≥ 3 | ≥ 3 | ≥ 3 |
Physician remuneration | Salary | Fee for service | Fee for service and incentives | Capitation with 10% fee- for-service component, and incentives | Capitation and incentives |
Patient enrolment | Required; no limit on size of roster | Not required | Required; no limit on size of roster | Required; disincentive to enrol > 2400 | Required; disincentive to enrol > 2400 |
Incentive for enhanced preventive care‡ | |||||
Influenza immunization (age ≥ 65 yr) | None | None | None | April 2002 | July 2003 |
Colorectal cancer screening (age 50–74 yr) | None | None | April 2006 | April 2006 | April 2006 |
Breast cancer screening (age 50–70 yr) | None | None | None | April 2002 | April 2003 |
Cervical cancer screening (age 35–70 yr) | None | None | None | April 2002 | April 2003 |
15.
16.
17.
Sandra Wydau Guillaume van der Rest Caroline Aubard Pierre Plateau Sylvain Blanquet 《The Journal of biological chemistry》2009,284(21):14096-14104
Several l-aminoacyl-tRNA synthetases can transfer a
d-amino acid onto their cognate tRNA(s). This harmful reaction is
counteracted by the enzyme d-aminoacyl-tRNA deacylase. Two distinct
deacylases were already identified in bacteria (DTD1) and in archaea (DTD2),
respectively. Evidence was given that DTD1 homologs also exist in nearly all
eukaryotes, whereas DTD2 homologs occur in plants. On the other hand, several
bacteria, including most cyanobacteria, lack genes encoding a DTD1 homolog.
Here we show that Synechocystis sp. PCC6803 produces a third type of
deacylase (DTD3). Inactivation of the corresponding gene (dtd3)
renders the growth of Synechocystis sp. hypersensitive to the
presence of d-tyrosine. Based on the available genomes, DTD3-like
proteins are predicted to occur in all cyanobacteria. Moreover, one or several
dtd3-like genes can be recognized in all cellular types, arguing in
favor of the nearubiquity of an enzymatic function involved in the defense of
translational systems against invasion by d-amino acids.Although they are detected in various living organisms (reviewed in Ref.
1), d-amino acids
are thought not to be incorporated into proteins, because of the
stereospecificity of aminoacyl-tRNA synthetases and of the translational
machinery, including EF-Tu and the ribosome
(2). However, the
discrimination between l- and d-amino acids by
aminoacyl-tRNA synthetases is not equal to 100%. Significant
d-aminoacylation of their cognate tRNAs by Escherichia
coli tyrosyl-, tryptophanyl-, aspartyl-, lysyl-, and histidyl-tRNA
synthetases has been characterized in vitro
(3–9).
Recently, using a bacterium, transfer of d-tyrosine onto
tRNATyr was shown to occur in vivo
(10).With such misacylation reactions, the resulting
d-aminoacyl-tRNAs form a pool of metabolically inactive molecules,
at best. At worst, d-aminoacylated tRNAs infiltrate the protein
synthesis machinery. Although the latter harmful possibility has not yet been
firmly established, several cells were shown to possess a
d-tyrosyl-tRNA deacylase, or DTD, that should help them counteract
the accumulation of d-aminoacyl-tRNAs. This enzyme shows a broad
specificity, being able to remove various d-aminoacyl moieties from
the 3′-end of a tRNA
(4–6,
11). Such a function makes the
deacylase a member of the family of enzymes capable of editing in
trans mis-aminoacylated tRNAs. This family includes several homologs
of aminoacyl-tRNA synthetase editing domains
(12), as well as peptidyl-tRNA
hydrolase (13,
14).Two distinct deacylases have already been discovered. The first one, called
DTD1, is predicted to occur in most bacteria and eukaryotes (see
d-amino acids, including
d-tyrosine (6). In
fact, in an E. coli Δdtd strain grown in the presence
of 2.4 mm d-tyrosine, as much as 40% of the cellular
tRNATyr pool becomes esterified with d-tyrosine
(10).
Open in a separate windowHomologs of dtd/DTD1 are not found in the available archaeal
genomes except that of Methanosphaera stadtmanae. A search for
deacylase activity in Sulfolobus solfataricus and Pyrococcus
abyssi led to the detection of another enzyme (DTD2), completely
different from the DTD1 protein
(15). Importing dtd2
into E. coli functionally compensates for dtd deprivation.
As shown in 16).Several cells contain neither dtd nor dtd2 homologs
(d-tyrosyl-tRNA deacylase
(DTD3). This protein, encoded by dtd3, behaves as a metalloenzyme.
Sensitivity of the growth of Synechocystis to external
d-tyrosine is strongly exacerbated by the disruption of
dtd3. Moreover, expression of the Synechocystis DTD3 in a
Δdtd E. coli strain, from a plasmid, restores the resistance of
the bacterium to d-tyrosine. Finally, using the available genomes,
we examined the occurrence of DTD3 in the living world. The prevalence of
DTD3-like proteins is surprisingly high. It suggests that the defense of
protein synthesis against d-amino acids is universal. 相似文献
TABLE 1
Distribution of DTD1 and DTD2 homologs in various phylogenetic groupsHomologs of DTD1 and DTD2 were searched for using a genomic Blast analysis against complete genomes in the NCBI Database (www.ncbi.nlm.nih.gov). Values in the table are number of species. For instance, E. coli is counted only once in γ-proteobacteria despite the fact that several E. coli strains have been sequenced.DTD1 | DTD2 | DTD1 + DTD2 | None | |
---|---|---|---|---|
Bacteria | ||||
Acidobacteria | 2 | 0 | 0 | 0 |
Actinobacteria | 27 | 0 | 0 | 8 |
Aquificae | 1 | 0 | 0 | 0 |
Bacteroidetes/Chlorobi | 12 | 0 | 0 | 5 |
Chlamydiae | 1 | 0 | 0 | 6 |
Chloroflexi | 4 | 0 | 0 | 0 |
Cyanobacteria | 5 | 0 | 0 | 16 |
Deinococcus/Thermus | 4 | 0 | 0 | 0 |
Firmicutes | ||||
Bacillales | 19 | 0 | 0 | 0 |
Clostridia | 19 | 0 | 0 | 0 |
Lactobacillales | 23 | 0 | 0 | 0 |
Mollicutes | 0 | 0 | 0 | 15 |
Fusobacteria/Planctomycetes | 2 | 0 | 0 | 0 |
Proteobacteria | ||||
α | 6 | 0 | 0 | 55 |
β | 24 | 0 | 0 | 11 |
γ | 80 | 0 | 0 | 8 |
δ | 15 | 0 | 0 | 0 |
ε | 1 | 0 | 0 | 12 |
Spirochaetes | 0 | 0 | 0 | 7 |
Thermotogae | 5 | 0 | 0 | 0 |
Archaea | ||||
Crenarchaeota | 0 | 13 | 0 | 0 |
Euryarchaeota | 1 | 26 | 0 | 2 |
Nanoarchaeota | 0 | 0 | 0 | 1 |
Eukaryota | ||||
Dictyosteliida | 1 | 0 | 0 | 0 |
Fungi/Metazoa | ||||
Fungi | 13 | 0 | 0 | 1 |
Metazoa | 19 | 0 | 0 | 0 |
Kinetoplastida | 3 | 0 | 0 | 0 |
Viridiplantae | 4 | 4 | 4 | 0 |
18.
In Vivo Fitness Cost of the M184V Mutation in Multidrug-Resistant Human Immunodeficiency Virus Type 1 in the Absence of Lamivudine 总被引:1,自引:0,他引:1
Roger Paredes Manish Sagar Vincent C. Marconi Rebecca Hoh Jeffrey N. Martin Neil T. Parkin Christos J. Petropoulos Steven G. Deeks Daniel R. Kuritzkes 《Journal of virology》2009,83(4):2038-2043
19.
20.
Banumathi Sankaran Shilah A. Bonnett Kinjal Shah Scott Gabriel Robert Reddy Paul Schimmel Dmitry A. Rodionov Valérie de Crécy-Lagard John D. Helmann Dirk Iwata-Reuyl Manal A. Swairjo 《Journal of bacteriology》2009,191(22):6936-6949
GTP cyclohydrolase I (GCYH-I) is an essential Zn2+-dependent enzyme that catalyzes the first step of the de novo folate biosynthetic pathway in bacteria and plants, the 7-deazapurine biosynthetic pathway in Bacteria and Archaea, and the biopterin pathway in mammals. We recently reported the discovery of a new prokaryotic-specific GCYH-I (GCYH-IB) that displays no sequence identity to the canonical enzyme and is present in ∼25% of bacteria, the majority of which lack the canonical GCYH-I (renamed GCYH-IA). Genomic and genetic analyses indicate that in those organisms possessing both enzymes, e.g., Bacillus subtilis, GCYH-IA and -IB are functionally redundant, but differentially expressed. Whereas GCYH-IA is constitutively expressed, GCYH-IB is expressed only under Zn2+-limiting conditions. These observations are consistent with the hypothesis that GCYH-IB functions to allow folate biosynthesis during Zn2+ starvation. Here, we present biochemical and structural data showing that bacterial GCYH-IB, like GCYH-IA, belongs to the tunneling-fold (T-fold) superfamily. However, the GCYH-IA and -IB enzymes exhibit significant differences in global structure and active-site architecture. While GCYH-IA is a unimodular, homodecameric, Zn2+-dependent enzyme, GCYH-IB is a bimodular, homotetrameric enzyme activated by a variety of divalent cations. The structure of GCYH-IB and the broad metal dependence exhibited by this enzyme further underscore the mechanistic plasticity that is emerging for the T-fold superfamily. Notably, while humans possess the canonical GCYH-IA enzyme, many clinically important human pathogens possess only the GCYH-IB enzyme, suggesting that this enzyme is a potential new molecular target for antibacterial development.The Zn2+-dependent enzyme GTP cyclohydrolase I (GCYH-I; EC 3.5.4.16) is the first enzyme of the de novo tetrahydrofolate (THF) biosynthesis pathway (Fig. (Fig.1)1) (38). THF is an essential cofactor in one-carbon transfer reactions in the synthesis of purines, thymidylate, pantothenate, glycine, serine, and methionine in all kingdoms of life (38), and formylmethionyl-tRNA in bacteria (7). Recently, it has also been shown that GCYH-I is required for the biosynthesis of the 7-deazaguanosine-modified tRNA nucleosides queuosine and archaeosine produced in Bacteria and Archaea (44), respectively, as well as the 7-deazaadenosine metabolites produced in some Streptomyces species (33). GCYH-I is encoded in Escherichia coli by the folE gene (28) and catalyzes the conversion of GTP to 7,8-dihydroneopterin triphosphate (55), a complex reaction that begins with hydrolytic opening of the purine ring at C-8 of GTP to generate an N-formyl intermediate, followed by deformylation and subsequent rearrangement and cyclization of the ribosyl moiety to generate the pterin ring in THF (Fig. (Fig.1).1). Notably, the enzyme is dependent on an essential active-site Zn2+ that serves to activate a water molecule for nucleophilic attack at C-8 in the first step of the reaction (2).Open in a separate windowFIG. 1.Reaction catalyzed by GCYH-I, and metabolic fate of 7,8-dihydroneopterin triphosphate.A homologous GCYH-I is found in mammals and other higher eukaryotes, where it catalyzes the first step of the biopterin (BH4) pathway (Fig. (Fig.1),1), an essential cofactor in the biosynthesis of tyrosine and neurotransmitters, such as serotonin and l-3,4-dihydroxyphenylalanine (3, 52). Recently, a distinct class of GCYH-I enzymes, GCYH-IB (encoded by the folE2 gene), was discovered in microbes (26% of sequenced Bacteria and most Archaea) (12), including several clinically important human pathogens, e.g., Neisseria and Staphylococcus species. Notably, GCYH-IB is absent in eukaryotes.The distribution of folE (gene product renamed GCYH-IA) and folE2 (GCYH-IB) in bacteria is diverse (12). The majority of organisms possess either a folE (65%; e.g., Escherichia coli) or a folE2 (14%; e.g., Neisseria gonorrhoeae) gene. A significant number (12%; e.g., B. subtilis) possess both genes (a subset of 50 bacterial species is shown in Table Table1),1), and 9% lack both genes, although members of the latter group are mainly intracellular or symbiotic bacteria that rely on external sources of folate. The majority of Archaea possess only a folE2 gene, and the encoded GCYH-IB appears to be necessary only for the biosynthesis of the modified tRNA nucleoside archaeosine (44) except in the few halophilic Archaea that are known to synthesize folates, such as Haloferax volcanii, where GCYH-IB is involved in both archaeosine and folate formation (13, 44).