共查询到20条相似文献，搜索用时 78 毫秒
1.
I-Te Chu Chia-Chuan Wu Ta-Chau Chang 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(2):418-425
Background
Mitochondrial DNA (mtDNA) mutations could lead to mitochondrial dysfunction, which plays a major role in aging, neurodegeneration, and cancer. Recently, we have highlighted G-quadruplex (G4) formation of putative G4-forming (PQF) mtDNA sequences in cells. Herein, we examine structural variation of G4 formation due to mutation of mtDNA sequences in vitro.Methods
The combined circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE) results provide complementary insights into the structural variation of the studied G-rich sequence and its mutants.Results
This study illustrates the structural diversity of mt10251, a G-rich mtDNA sequence with a 16-nt loop, (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including the coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures of mt10251 in 20?mM K+ solution. Moreover, a single-base mutation of mt10251 can cause significant changes in terms of structural populations and polymorphism. In addition, single-base mutations of near-but-not-PQF sequences can potentially change not-G4 to G4 structures. We further found 124 modified PQF sequences due to single-base mutations of near-but-not-PQF sequences in mtDNA.Conclusions
Single-base mutations of mt10251 could make significant changes in its structural variation and some single-base mutated sequences in mtDNA could form G4 structures in vitro.General significance
We illustrate the importance of single-base mutations of DNA sequences to the change of G4 formation in vitro. The use of single-base mutations by generating the fourth G-tract and followed by selection in shortening the longest loop size in the near-but-not-PQF sequences was conducted for the G4 formation. 相似文献2.
Annika Wahl Silva Kasela Elena Carnero-Montoro Maarten van Iterson Jerko Štambuk Sapna Sharma Erik van den Akker Lucija Klaric Elisa Benedetti Genadij Razdorov Irena Trbojević-Akmačić Frano Vučković Ivo Ugrina Marian Beekman Joris Deelen Diana van Heemst Bastiaan T. Heijmans Christian Gieger 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(3):637-648
Background
Glycosylation is one of the most common post-translation modifications with large influences on protein structure and function. The effector function of immunoglobulin G (IgG) alters between pro- and anti-inflammatory, based on its glycosylation. IgG glycan synthesis is highly complex and dynamic.Methods
With the use of two different analytical methods for assessing IgG glycosylation, we aim to elucidate the link between DNA methylation and glycosylation of IgG by means of epigenome-wide association studies. In total, 3000 individuals from 4 cohorts were analyzed.Results
The overlap of the results from the two glycan measurement panels yielded DNA methylation of 7 CpG-sites on 5 genomic locations to be associated with IgG glycosylation: cg25189904 (chr.1, GNG12); cg05951221, cg21566642 and cg01940273 (chr.2, ALPPL2); cg05575921 (chr.5, AHRR); cg06126421 (6p21.33); and cg03636183 (chr.19, F2RL3). Mediation analyses with respect to smoking revealed that the effect of smoking on IgG glycosylation may be at least partially mediated via DNA methylation levels at these 7 CpG-sites.Conclusion
Our results suggest the presence of an indirect link between DNA methylation and IgG glycosylation that may in part capture environmental exposures.General significance
An epigenome-wide analysis conducted in four population-based cohorts revealed an association between DNA methylation and IgG glycosylation patterns. Presumably, DNA methylation mediates the effect of smoking on IgG glycosylation. 相似文献3.
Tiesheng Han Megumu Yamada-Mabuchi Gong Zhao Li Li Guang liu Hong-Yu Ou Zixin Deng Yu Zheng Xinyi He 《Nucleic acids research》2015,43(2):1147-1159
SET and RING-finger-associated (SRA) domain is involved in establishment and maintenance of DNA methylation in eukaryotes. Proteins containing SRA domains exist in mammals, plants, even microorganisms. It has been established that mammalian SRA domain recognizes 5-methylcytosine (5mC) through a base-flipping mechanism. Here, we identified and characterized two SRA domain-containing proteins with the common domain architecture of N-terminal SRA domain and C-terminal HNH nuclease domain, Sco5333 from Streptomyces coelicolor and Tbis1 from Thermobispora bispora. Both sco5333 and tbis1 cannot establish in methylated Escherichia coli hosts (dcm+), and this in vivo toxicity requires both SRA and HNH domain. Purified Sco5333 and Tbis1 displayed weak DNA cleavage activity in the presence of Mg2+, Mn2+ and Co2+ and the cleavage activity was suppressed by Zn2+. Both Sco5333 and Tbis1 bind to 5mC-containing DNA in all sequence contexts and have at least a preference of 100 folds in binding affinity for methylated DNA over non-methylated one. We suggest that linkage of methyl-specific SRA domain and weakly active HNH domain may represent a universal mechanism in competing alien methylated DNA but to maximum extent minimizing damage to its own chromosome. 相似文献
4.
Inhibition of Echis carinatus venom by DNA,a promising therapeutic molecule for snakebite management
Basavarajaiah Swethakumar Somanathapura K. NaveenKumar Gajanan D. Katkar Kesturu S. Girish Kempaiah Kemparaju 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(5):1115-1125
Background
E. carinatus bite is a serious threat to South-Asian countries including India, as it causes the highest number of deaths and debilitating sustained tissue necrosis at the bite site. One of our previous studies has demonstrated the strong interaction between DNA and E. carinatus venom. Therefore, in this study, the effect of DNA on E. carinatus venom has been examined.Methods
Here we show that calf thymus DNA interact strongly with E. carinatus venom and inhibits its enzymatic and pharmacological activities such as proteolytic, hemolytic, hyaluronidase, L-amino acid oxidase, NETosis, hemorrhage, pro-coagulant, and lethality. Further, using immunoblots and immunofluorescence, the study demonstrates the inhibition of proteolytic cleavage of several surface receptors on PMNs, PBMCs, and platelets by the DNA.Conclusions
This study for the first time explored the efficient inhibition of enzymatic, pharmacological and lethal properties of E. carinatus venom by the naked DNA and demonstrates the possible therapeutic application of it during snakebite management.General significance
This study identifies naked DNA as an effective defense weapon that has got the therapeutic potential to inhibit the detrimental effects of E. carinatus bite. 相似文献5.
Bita Zamiri Mila Mirceta Rashid Abu-Ghazalah Marc S. Wold Christopher E. Pearson Robert B. Macgregor 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(6):1482-1491
Background
Expansion of the C9orf72 hexanucleotide repeat (GGGGCC)n·(GGCCCC)n is the most common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Both strands of the C9orf72 repeat have been shown to form unusual DNA and RNA structures that are thought to be involved in mutagenesis and/or pathogenesis. We previously showed that the C-rich DNA strands from the C9orf72 repeat can form four-stranded quadruplexes at neutral pH. The cytosine residues become protonated under slightly acidic pH (pH?4.5–6.2), facilitating the formation of intercalated i-motif structures.Methods
Using CD spectroscopy, UV melting, and gel electrophoresis, we demonstrate a pH-induced structural transition of the C-rich DNA strand of the C9orf72 repeat at pHs reported to exist in living cells under stress, including during neurodegeneration and cancer.Results
We show that the repeats with lengths of 4, 6, and 8?units, form intercalated quadruplex i-motifs at low pH (pH?<?5) and monomolecular hairpins and monomolecular quadruplexes under neutral-basic conditions (pH?≥?8). Furthermore, we show that the human replication protein A (RPA) binds to the G-rich and C-rich DNA strands under acidic conditions, suggesting that it can bind to i-motif structures.Conclusions
In the proper sequence context, i-motif structures can form at pH values found in some cells in vivo.General significance
DNA conformational plasticity exists over broad range of solution conditions. 相似文献6.
Wataru Yoshida Mizuki Terasaka Saowalak Laddachote Isao Karube 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(9):1933-1937
Background
DNA methylation at the 5-position of cytosine is an epigenetic modification of CpG dinucleotides. In addition to CpG methylation, the G-quadruplex (G4) structure has been reported as a regulator of gene expression. The identification of G4 forming sequences in CpG islands suggests an involvement of CpG-methylated G4 structures in biological processes; however, few reports have addressed the effects of CpG methylation on G4 structure.Methods
The thermostability of a methylated, 21-mer G4 structure located on the vascular endothelial growth factor (VEGF) gene promoter containing four CpG sites (C1, C6, C11, and C17) were investigated using circular dichroism (CD) spectral analysis.Results
CD melting analysis revealed that VEGF G4 was stabilized by a single CpG methylation on C11 in the presence of Na+ and Mg2+. However, either C1 or C11 methylation enhanced VEGF G4 thermal stability in the presence of K+.Conclusions
Single CpG methylation appears to enhance VEGF G4 thermostability in a manner dependent on both the CpG methylation site and cation type.General significance
These results are expected to contribute to the elucidation of the roles of CpG methylation-stabilized G4 structures in biological processes. 相似文献7.
Background
DNA double-strand breaks (DSBs) are highly cytotoxic and mutagenic. MRE11 plays an essential role in repairing DNA by cleaving broken ends through its 3′ to 5′ exonuclease and single-stranded DNA endonuclease activities.Methods
The present study aimed to in silico characterization and molecular modeling of MRE11 from Phoenix dactylifera L cv deglet nour (DnMRE11) by various bioinformatic approaches. To identify DnMRE11 cDNA, assembled contigs from our cDNA libraries were analysed using the Blast2GO2.8 program.Results
The DnMRE11 protein length was 726 amino acids. The results of HUMMER show that DnMRE11 is formed by three domains: the N-terminal core domain containing the nuclease and capping domains, the C-terminal half containing the DNA binding and coiled coil region. The structure of DnMRE11 is predicted using the Swiss-Model server, which contains the nuclease and capping domains. The obtained model was verified with the structure validation programs such as ProSA and QMEAN servers for reliability. Ligand binding studies using COACH indicated the interaction of DnMRE11 protein with two Mn2+ ions and dAMP. The ConSurf server predicted that residues of the active site and Nbs binding site have high conservation scores between plant species.Conclusions
A model structure of DnMRE11 was constructed and validated with various bioinformatics programs which suggested the predicted model to be satisfactory. Further validation studies were conducted by COACH analysis for active site ligand prediction, and revealed the presence of six ligands binding sites and two ligands (2 Mn2+ and dAMP).8.
Hongbo Chen Hongxia Sun Yahong Chai Suge Zhang Aijiao Guan Qian Li Li Yao Yalin Tang 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(1):31-38
Background
G-quadruplex has been viewed as a promising therapeutic target in oncology due to its potentially important roles in physiological and pathological processes. Emerging evidence suggests that the biological functions of G-quadruplexes are closely related to the binding of some proteins. Insulin-like growth factor type I (IGF-1), as a significant modulator of cell growth and development, may serve as a quadruplex-binding protein.Methods
The binding affinity and selectivity of IGF-1 to different DNA motifs in solution were measured by using fluorescence spectroscopy, Surface Plasmon Resonance (SPR), and force-induced remnant magnetization (FIRM). The effects of IGF-1 on the formation and stability of G-quadruplex structures were evaluated by circular dichroism (CD) and melting fluorescence resonance energy transfer (FRET) spectroscopy. The influence of quadruplex-specific ligands on the binding of G-quadruplexes with IGF-1 was determined by FIRM.Results
IGF-1 shows a binding specificity for G-quadruplex structures, especially the G-quadruplex structure with a parallel topology. The quadruplex-specific ligands TMPyP4 and PDS (Pyridostatin) can inhibit the interaction between G-quadruplexes and proteins.Conclusions
IGF-1 is demonstrated to selectively bind with G-quadruplex structures. The use of quadruplex-interactive ligands could modulate the binding of IGF-1 to G-quadruplexes.General significance
This study provides us with a new perspective to understand the possible physiological relationship between IGF-1 and G-quadruplexes and also conveys a strategy to regulate the interaction between G-quadruplex DNA and proteins. 相似文献9.
Dunja Urbančič Anita Kotar Alenka Šmid Marko Jukič Stanislav Gobec Lars-Göran Mårtensson Janez Plavec Irena Mlinarič-Raščan 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(1):182-190
Background
Methylation driven by thiopurine S-methylatransferase (TPMT) is crucial for deactivation of cytostatic and immunosuppressant thiopurines. Despite its remarkable integration into clinical practice, the endogenous function of TPMT is unknown.Methods
To address the role of TPMT in methylation of selenium compounds, we established the research on saturation transfer difference (STD) and 77Se NMR spectroscopy, fluorescence measurements, as well as computational molecular docking simulations.Results
Using STD NMR spectroscopy and fluorescence measurements of tryptophan residues in TPMT, we determined the binding of selenocysteine (Sec) to human recombinant TPMT. By comparing binding characteristics of Sec in the absence and in the presence of methyl donor, we confirmed S-adenosylmethionine (SAM)-induced conformational changes in TPMT. Molecular docking analysis positioned Sec into the active site of TPMT with orientation relevant for methylation reaction. Se-methylselenocysteine (MeSec), produced in the enzymatic reaction, was detected by 77Se NMR spectroscopy. A direct interaction between Sec and SAM in the active site of rTPMT and the formation of both products, MeSec and S-adenosylhomocysteine, was demonstrated using NMR spectroscopy.Conclusions
The present study provides evidence on in vitro methylation of Sec by rTPMT in a SAM-dependant manner.General significance
Our results suggest novel role of TPMT and demonstrate new insights into enzymatic modifications of the 21st amino acid. 相似文献10.
Samantha F.H. De Witte Fleur S. Peters Ana Merino Sander S. Korevaar Joyce B.J. Van Meurs Lisa O&#x;Flynn Steve J. Elliman Philip N. Newsome Karin Boer Carla C. Baan Martin J. Hoogduijn 《Cytotherapy》2018,20(7):919-929
Background
Mesenchymal stromal cells (MSCs) are studied for their immunotherapeutic potential. Prior to therapeutic use, MSCs are culture expanded to obtain the required cell numbers and, to improve their efficacy, MSCs may be primed in vitro. Culture expansion and priming induce phenotypical and functional changes in MSCs and thus standardisation and quality control measurements come in need. We investigated the impact of priming and culturing on MSC DNA methylation and examined the use of epigenetic profiling as a quality control tool.Methods
Human umbilical cord–derived MSCs (ucMSCs) were cultured for 3 days with interferon (IFN)γ, transforming growth factor (TGF)β or a multi-factor combination (MC; IFNγ, TGFβ and retinoic acid). In addition, ucMSCs were culture expanded for 14 days. Phenotypical changes and T-cell proliferation inhibition capacity were examined. Genome-wide DNA methylation was measured with Infinium MethylationEPIC Beadchip.Results
Upon priming, ucMSCs exhibited a different immunophenotype and ucMSC(IFNγ) and ucMSC(MC) had an increased capacity to inhibit T-cell proliferation. DNA methylation patterns were minimally affected by priming, with only one significantly differentially methylated site (DMS) in IFNγ- and MC-primed ucMSCs associated with autophagy activity. In contrast, 14 days after culture expansion, ucMSCs displayed minor phenotypical and functional changes but showed >4000 significantly DMSs, mostly concerning genes involved in membrane composition, cell adhesion and transmembrane signalling.Discussion
These data show that DNA methylation of MSCs is only marginally affected by priming, whereas culture expansion and subsequent increased cellular interactions have a large impact on methylation. On account of this study, we suggest that DNA methylation analysis is a useful quality control tool for culture expanded therapeutic MSCs. 相似文献11.
Ignacio Fernández Jorge M.O. Fernandes Vânia P. Roberto Martina Kopp Catarina Oliveira Marta F. Riesco Jorge Dias Cymon J. Cox M. Leonor Cancela Elsa Cabrita Paulo Gavaia 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(1):39-51
Background
Vitamin K (VK) is a fat-soluble vitamin known for its essential role in blood coagulation, but also on other biological processes (e.g. reproduction, brain and bone development) have been recently suggested. Nevertheless, the molecular mechanisms behind its particular function on reproduction are not yet fully understood.Methods
The potential role of VK on reproduction through nutritional supplementation in Senegalese sole (Solea senegalensis) was assessed by gonadal maturation and 11-ketosterone, testosterone and estriol plasma levels when fed with control or VK supplemented (1250?mg?kg?1 of VK1) diets along a six month trial. At the end, sperm production and quality (viability and DNA fragmentation) were evaluated. Circulating small non-coding RNAs (sncRNAs) in blood plasma from males were also studied through RNA-Seq.Results
Fish fed with dietary VK supplementation had increased testosterone levels and lower sperm DNA fragmentation. SncRNAs from blood plasma were found differentially expressed when nutritional and sperm quality conditions were compared. PiR-675//676//4794//5462 and piR-74614 were found up-regulated in males fed with dietary VK supplementation. Let-7g, let-7e(18nt), let-7a-1, let-7a-3//7a-2//7a-1, let-7e(23nt) and piR-675//676//4794//5462 were found to be up-regulated and miR-146a and miR-146a-1//146a-2//146a-3 down-regulated when fish with low and high sperm DNA fragmentation were compared. Bioinformatic analyses of predicted mRNAs targeted by sncRNAs revealed the potential underlying pathways.Conclusions
VK supplementation improves fish gonad maturation and sperm quality, suggesting an unexpected and complex regulation of the nutritional status and reproductive performance through circulating sncRNAs.General significance
The use of circulating sncRNAs as reliable and less-invasive physiological biomarkers in fish nutrition and reproduction has been unveiled. 相似文献12.
Shruti Chakraborty Sayak Ganguli Aritra Chowdhury Michael Ibba Rajat Banerjee 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(8):1801-1809
Background
Under oxidative stress cytoplasmic aminoacyl-tRNA synthetase (aaRSs) substrate specificity can be compromised, leading to tRNA mischarging and mistranslation of the proteome. Whether similar processes occur in mitochondria, which are major cellular sources of reactive oxygen species (ROS), is unknown. However, relaxed substrate specificity in yeast mitochondrial phenylalanyl-tRNA synthetase (ScmitPheRS) has been reported to increase tRNA mischarging and blocks mitochondrial biogenesis.Methods
Non-reducing denaturing PAGE, cysteine reactivity studies, MALDI-TOF mass spectrometry, enzyme assay, western blot, growth assay, circular dichroism, dynamic light scattering and fluorescence spectroscopy were used to study the effect of oxidative stress on ScmitPheRS activity.Results
ScmitPheRS is reversibly inactivated under oxidative stress. The targets for oxidative inactivation are two conserved cysteine residues resulting in reversible intra-molecular disulfide bridge formation. Replacement of either conserved cysteine residue increased viability during growth under oxidative stress.Conclusion
Formation of intra-molecular disulfide bridge under oxidative stress hinders the tRNAPhe binding of the enzyme, thus inactivating ScmitPheRS reversibly.General significance
The ScmitPheRS activity is compromised under oxidative stress due to formation of intra-molecular disulfide bridge. The sensitivity of ScmitPheRS to oxidation may provide a protective mechanism against error-prone translation under oxidative stress. 相似文献13.
Yue Liu James Clement Ross Grant Perminder Sachdev Nady Braidy 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(12):2527-2532
Background
Nicotinamide adenine dinucleotide (NAD+) is an essential pyridine nucleotide that is currently investigated as an important target to extend lifespan and health span. Age-related NAD+ depletion due to the accumulation of oxidative stress is associated with reduced energy production, impaired DNA repair and genomic instability.Scope of review
NAD+ levels can be elevated therapeutically using NAD+ precursors or through lifestyle modifications including exercise and caloric restriction. However, high amounts of NAD+ may be detrimental in cancer progression and may have deleterious immunogenic roles.Major conclusions
Standardized quantitation of NAD+ and related metabolites may therefore represent an important component of NAD+ therapy.General significance
Quantitation of NAD+ may serve dual roles not only as an ageing biomarker, but also as a diagnostic tool for the prevention of malignant disorders. 相似文献14.
15.
V. Guru KrishnaKumar Lokesh Baweja Krittika Ralhan Sharad Gupta 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(12):2590-2604
Background
Carbamylation is a non-enzymatic post-translational modification (PTM), which involves the covalent modification of N-terminus of protein or ε-amino group of Lys. The role of carbamylation in several age-related disorders is well documented, however, the relationship between carbamylation and neurodegenerative disorders including Alzheimer's disease remains uncharted.Methods
In the present study, using aggregation-prone tau-core hexapeptide fragments 306VQIVYK311 (PHF6) and 275VQIINK280 (PHF6*) as models, we have elucidated the effect of carbamylation on aggregation kinetics and the changes occurring in the 3-dimensional architecture of fibrils using biophysical assays and molecular dynamics simulations.Results
We found that carbamylation aids in amyloid formation and can convert the unstructured off-pathway aggregates into robust amyloids, which were toxic to cells. Electron microscopy images and molecular dynamics simulations of PHF6 fibrils showed that carbamylated peptides can form excess hydrogen bonds and modulate the pitch length and twist of peptides fibrils. We have also compared N-terminal carbamylation to acetylation and further extended our finding to full length tau that exhibits aggregation upon carbamylation even in the absence of any external inducer.Conclusion
Our in vitro and in silico results together suggest that carbamylation can modulate the aggregation pathway of the amyloidegenic sequences and cause structural changes in fibril assemblies.General significance
Carbamylation acts as a switch, which triggers the aggregation in short amyloidogenic peptide fragments and modulate the structural changes in resulting amyloid fibrils. 相似文献16.
17.
Brunna Xavier Martins Raul Ferraz Arruda Gildeíde Aparecida Costa Hassan Jerdy Sávio Bastos de Souza Julianna Maria Santos William Rodrigues de Freitas Milton Masahiko Kanashiro Eulógio Carlos Queiroz de Carvalho Nadir Francisca Sant&#x;Anna Fernanda Antunes Raul Martinez-Zaguilan Sennoune Souad Anna Lvovna Okorokova-Fa?anha Arnoldo Rocha Fa?anha 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(1):1-12
Background
Metastatic tumor cells have acidic extracellular pH and differential electrochemical H+ gradients generated across their cell membranes by V-type H+-ATPases. This study shows that inhibition of the V-ATPases by the plant-derived monoterpene Myrtenal results in tumor cell death and decreased metastatic dissemination in mice.Methods
The Myrtenal anticancer toxicity was evaluated in vitro using murine (B16F0 and B16F10) and human (SkMel-5) melanoma cell lines, and in in vivo mouse metastatic dissemination model. Proton flux and extracellular acidification were directly evaluated at the surface of living cells using a non-invasive selective ion electrode approach.Results
The inhibition of V-ATPases by 100?μM Myrtenal disrupted the electrochemical H+ gradient across the cell membranes, strongly induced cell death (4–5 fold), and decreased tumor cells migration and invasion in vitro. Myrtenal (15?mg/kg) also significantly reduced metastasis induced by B16F10 in vivo, further reinforcing that V-ATPase is a molecular target to halt the progression of cancers.Conclusions
These data revealed the therapeutic potential of Myrtenal as inhibitor of melanoma progression proposing a mechanism of action by which once inhibited by this monoterpene the proton pumps fail to activate cancer-related differential electrochemical gradients and H+ fluxes across the tumor cell membranes, disrupting pH signatures inherent in tumor progression, resulting in reprogrammed cell death and metastasis inhibition.General significance
The work represents a new mechanistic strategy for contention of melanoma, the most aggressive and deadly form of cutaneous neoplasm, and highlights Myrtenal, other related monoterpenes and derivatives as promising proton pump inhibitors with high chemotherapeutic potential. 相似文献18.
Flavien Zannini Anna Moseler Raphaël Bchini Tiphaine Dhalleine Andreas J. Meyer Nicolas Rouhier Jérémy Couturier 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(2):426-436
Background
Glutaredoxins (GRXs) are oxidoreductases involved in diverse cellular processes through their capacity to reduce glutathionylated proteins and/or to coordinate iron?sulfur (Fe-S) clusters. Among class II GRXs, the plant-specific GRXS16 is a bimodular protein formed by an N-terminal endonuclease domain fused to a GRX domain containing a 158CGFS signature.Methods
The biochemical properties (redox activity, sensitivity to oxidation, pKa of cysteine residues, midpoint redox potential) of Arabidopsis thaliana GRXS16 were investigated by coupling oxidative treatments to alkylation shift assays, activity measurements and mass spectrometry analyses.Results
Activity measurements using redox-sensitive GFP2 (roGFP2) as target protein did not reveal any significant glutathione-dependent reductase activity of A. thaliana GRXS16 whereas it was able to catalyze the oxidation of roGFP2 in the presence of glutathione disulfide. Accordingly, Arabidopsis GRXS16 reacted efficiently with oxidized forms of glutathione, leading to the formation of an intramolecular disulfide between Cys158 and the semi-conserved Cys215, which has a midpoint redox potential of - 298?mV at pH?7.0 and is reduced by plastidial thioredoxins (TRXs) but not GSH. By promoting the formation of this disulfide, Cys215 modulates GRXS16 oxidoreductase activity.Conclusion
The reduction of AtGRXS16, which is mandatory for its oxidoreductase activity and the binding of Fe-S clusters, depends on light through the plastidial FTR/TRX system. Hence, disulfide formation may constitute a redox switch mechanism controlling GRXS16 function in response to day/night transition or oxidizing conditions.General significance
From the in vitro data obtained with roGFP2, one can postulate that GRXS16 would mediate protein glutathionylation/oxidation in plastids but not their deglutathionylation. 相似文献19.
Anna Rita Bizzarri Ilaria Moscetti Salvatore Cannistraro 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(2):342-350
Background
The p28 peptide, derived from the blue copper protein Azurin, exerts an anticancer action due to interaction with the tumor suppressor p53, likely interfering with its down-regulators. Knowledge of both the kinetics and topological details of the interaction, could greatly help to understand the peptide anticancer mechanism.Methods
Fluorescence and Förster resonance energy transfer (FRET) were used to determine both the binding affinity and the distance between the lone tryptophan (FRET donor) of DNA Binding Domain (DBD) of p53 and the Iaedens dye (FRET acceptor) bound to the p28 peptide. Docking, Molecular Dynamic simulations and free energy binding calculations were used to single out the best complex model, compatible with the distance measured by FRET.Results
Tryptophan fluorescence quenching provided a 105?M?1 binding affinity for the complex. Both FRET donor fluorescence quenching and acceptor enhancement are consistent with a donor-acceptor distance of about 2.6?nm. Docking and molecular dynamics simulations allowed us to select the best complex, enlightening the contact regions between p28 and DBD.Conclusions
p28 binds to DBD partially engaging the L1 loop, at the same region of the p53 down-regulator COP1, leaving however the DNA binding site available for functional interactions.General significance
Elucidation of the DBD-p28 complex gets insights into the functional role of p28 in regulating the p53 anticancer activity, also offering new perspectives to design new drugs able to protect the p53 anticancer function. 相似文献20.
Sabine Güsewell 《Plant and Soil》2017,415(1-2):57-72