首页 | 本学科首页   官方微博 | 高级检索  
相似文献
 共查询到20条相似文献,搜索用时 78 毫秒
1.

Background

Lectin-like oxidized low-density lipoprotein scavenger receptor-1 (LOX-1) is known to be involved in many pathophysiological events, such as inflammation.

Methods

To clarify the role of LOX-1 in mtDNA damage and NLRP3 inflammasome activation, we studied wild-type (WT) and LOX-1 knockout (KO) mice given thioglycollate, an inflammatory stimulus.

Results

We observed intense inflammatory response (CD45 and CD68 expression) and mtDNA damage in spleen and kidneys of WT mice given thioglycollate. The abrogation of LOX-1 (use of LOX-1 knockout mice) reduced the inflammatory response as well as mtDNA damage (P < 0.05 vs. WT mice). We also observed that mice with LOX-1 deletion had markedly reduced expression of caspase-1 (P10 and P20 subunits) as well as cleaved IL-1β and IL-18. These mice also had much less mtDNA damage and only limited NLRP3 inflammasome expression.

Conclusions

These in vivo observations indicate that LOX-1 plays a key role in mtDNA damage which then leads to NLRP3 inflammasome activation during inflammation.  相似文献   

2.

Aims

The purpose of the study was to establish if enzyme activities from key metabolic pathways and levels of markers of oxidative damage to proteins and lipids differed between distinct liver mitochondrial sub-populations, and which specific sub-populations contributed to these differences.

Main methods

Male C57BL/6J mice were fed non-purified diet for one month then separated into two groups, control and calorie-restricted (CR). The two groups were fed semi-purified diet (AIN93G), with the CR group receiving 40% less calories than controls. After two months, enzyme activities and markers of oxidative damage in mitochondria were determined.

Key findings

In all mitochondrial sub-populations, enzyme activities and markers of oxidative damage, from control and CR groups, showed a pattern of M1 > M3 > M10. Higher acyl-CoA dehydrogenase (β-oxidation) and β-hydroxybutyrate dehydrogenase (ketogenesis) activities and lower carbonyl and TBARS levels were observed in M1 and M3 fractions from CR mice. ETC enzyme activities did not show a consistent pattern. In the Krebs cycle, citrate synthase and aconitase activities decreased while succinate dehydrogenase and malate dehydrogenase activities increased in the M1 mitochondria from the CR versus control mice.

Significance

CR does not produce uniform changes in enzyme activities or markers of oxidative damage in mitochondrial sub-populations, with changes occurring primarily in the heavy mitochondrial populations. Centrifugation at 10,000 g to isolate mitochondria likely dilutes the mitochondrial populations which show the greatest response to CR. Use of lower centrifugal force (3000 g or lower) may be beneficial for some studies.  相似文献   

3.

Background

Mitochondrial defects have been associated with various human conditions including cancers.

Methods

We analyzed the mutations at the mitochondrial DNA (mtDNA) in patients with different thyroid lesions. In particular, in order to investigate if the accumulation of mtDNA mutations play a role in tumor progression, we studied the highly variable main control region of mtDNA, the displacement-loop (D-loop) in patients with non-tumor nodular goiters, with benign thyroid adenomas, and with malignant thyroid carcinomas. Total thyroid tumor or goiter samples were obtained from 101 patients, matched with nearby normal tissue and blood from the same subject.

Results

Noticeably, mitochondrial microsatellite instability (mtMSI) was detected in 2 of 19 nodular goiters (10.53%), and 8 of 77 (10.39%) malignant thyroid carcinomas. In addition, 6 patients, including 5 (6.49%) with malignant thyroid carcinomas and 1 (5.26%) with nodular goiter, were found to harbor point mutations. The majority of the mutations detected were heteroplasmic.

General significance

Our results indicate that mtDNA alterations in the D-loop region could happen before tumorigenesis in thyroid, and they might also accumulate during tumorigenesis.  相似文献   

4.

Background

Reduced cell spreading is a prominent feature of aged dermal fibroblasts in human skin in vivo. Mitochondrial DNA (mtDNA) common deletion has been reported to play a role in the human aging process, however the relationship between age-related reduced cell spreading and mtDNA common deletion has not yet been reported.

Results

To examine mtDNA common deletion in the dermis of aged human skin, the epidermis was removed from full-thickness human skin samples using cryostat. mtDNA common deletion was significantly elevated in the dermis of both naturally aged and photoaged human skin in vivo. To examine the relationship between age-related reduced cell spreading and mtDNA common deletion, we modulated the shape of dermal fibroblasts by disrupting the actin cytoskeleton. Reduced cell spreading was associated with a higher level of mtDNA common deletion and was also accompanied by elevated levels of endogenous reactive oxygen species (ROS). Boosting cellular antioxidant capacity by using antioxidants was found to be protective against mtDNA common deletion associated with reduced cell spreading.

Conclusion

mtDNA common deletion is highly prevalent in the dermis of both naturally aged and photoaged human skin in vivo. mtDNA common deletion in response to reduced cell spreading is mediated, at least in part, by elevated oxidative stress in human dermal fibroblasts. These data extend current understanding of the mitochondrial theory of aging by identifying the connection between mtDNA common deletion and age-related reduction of cell spreading.  相似文献   

5.

Background

Calorie restriction (CR) is accepted as an experimental anti-aging paradigm. Several important signal transduction pathways including AMPK and SIRT1 are implicated in the regulation of physiological processes of CR. However, the mechanisms responsible for adaptations remain unclear in humans.

Scope of review

Four overweight male participants were enrolled and treated with 25% CR of their baseline energy requirements for 7 weeks. Characteristics, including body weight (BW), body mass index (BMI), %fat, visceral fat area (VFA), mean blood pressure (MBP) and VO2 max, as well as metabolic parameters, such as insulin, lipid profiles and inflammatory makers and the expression of phosphorylated AMPK and SIRT1 in peripheral blood mononuclear cells (PBMNCs), were determined at baseline and then after 7 weeks. In addition, we assessed the effects of the serum collected from the participants on AMPK and SIRT1 activation and mitochondrial biogenesis in cultured human skeletal muscle cells.

Major conclusions

After CR, BW, BMI, %fat, VFA and MBP all significantly decreased, while VO2 max increased, compared to those at baseline. The levels of fasting insulin, free fatty acid, and inflammatory makers, such as interleukin-6 and visfatin, were significantly reduced, whereas the expression of phosphorylated AMPK and SIRT1 was significantly increased in PBMNCs collected after CR, compared to those at baseline. The skeletal muscle cells that were cultured in serum collected after CR showed an increase in AMPK and SIRT1 activity as well as mitochondrial biogenesis.

General significance

CR is beneficial for obesity-related metabolic alterations and induces cellular adaptations against aging, possibly through AMPK and SIRT1 activation via circulating factors.  相似文献   

6.

Background

Plagiochin E (PLE) is an antifungal macrocyclic bis(bibenzyl) isolated from liverwort Marchantia polymorpha L. Its antifungal mechanism is unknown. To elucidate the mechanism of action, its effect on mitochondria function in Candida albicans was studied.

Methods

We assayed the mitochondrial membrane potential (mtΔψ) using rhodamine 123, measured ATP level in mitochondria by HPLC, and detected the activities of mitochondrial F0F1-ATPase and dehydrogenases. Besides, the mitochondrial dysfunction-induced reactive oxygen species (ROS) production was determined by a fluorometric assay, and the effects of antioxidant L-cysteine on PLE-induced ROS production and the antifungal effect of PLE on C. albicans were also investigated.

Results

Exposure to PLE resulted in an elevation of mtΔψ, and a decrease of ATP level in mitochondria. The ATP depletion owed to PLE-induced enhancement of mitochondrial F0F1-ATPase and inhibition of the mitochondrial dehydrogenases. These dysfunctions of mitochondria caused ROS accumulation in C. albicans, and this increase in the level of ROS production and PLE-induced decrease in cell viability were prevented by addition of L-cysteine, indicating that ROS was an important mediator of the antifungal action of PLE.

Conclusions

PLE exerts its antifungal activity through mitochondrial dysfunction-induced ROS accumulation in C. albicans.

General significance

The effect of PLE on the mitochondria function in C. albicans was assayed for the first time. These results would conduce to elucidate its underlying antifungal mechanism.  相似文献   

7.

Background

Although causative mutations have been identified for numerous mitochondrial disorders, few disease-modifying treatments are available. Two examples of treatable mitochondrial disorders are coenzyme Q10 (CoQ10 or ubiquinone) deficiency and mitochondrial neurogastrointestinal encephalomyopathy (MNGIE).

Scope of review

Here, we describe clinical and molecular features of CoQ10 deficiencies and MNGIE and explain how understanding their pathomechanisms have led to rationale therapies. Primary CoQ10 deficiencies, due to mutations in genes required for ubiquinone biosynthesis, and secondary deficiencies, caused by genetic defects not directly related to CoQ10 biosynthesis, often improve with CoQ10 supplementation. In vitro and in vivo studies of CoQ10 deficiencies have revealed biochemical alterations that may account for phenotypic differences among patients and variable responses to therapy. In contrast to the heterogeneous CoQ10 deficiencies, MNGIE is a single autosomal recessive disease due to mutations in the TYMP gene encoding thymidine phosphorylase (TP). In MNGIE, loss of TP activity causes toxic accumulations of the nucleosides thymidine and deoxyuridine that are incorporated by the mitochondrial pyrimidine salvage pathway and cause deoxynucleoside triphosphate pool imbalances, which, in turn cause mtDNA instability. Allogeneic hematopoetic stem cell transplantation to restore TP activity and eliminate toxic metabolites is a promising therapy for MNGIE.

Major conclusions

CoQ10 deficiencies and MNGIE demonstrate the feasibility of treating specific mitochondrial disorders through replacement of deficient metabolites or via elimination of excessive toxic molecules.

General significance

Studies of CoQ10 deficiencies and MNGIE illustrate how understanding the pathogenic mechanisms of mitochondrial diseases can lead to meaningful therapies. This article is part of a Special Issue entitled: Biochemistry of Mitochondria, Life and Intervention 2010.  相似文献   

8.

Background

Disorders of the mitochondrial respiratory chain are heterogeneous in their symptoms and underlying genetics. Simple links between candidate mutations and expression of disease phenotype typically do not exist. It thus remains unclear how the genetic variation in the mitochondrial genome contributes to the phenotypic expression of complex traits and disease phenotypes.

Scope of review

I summarize the basic genetic processes known to underpin mitochondrial disease. I highlight other plausible processes, drawn from the evolutionary biological literature, whose contribution to mitochondrial disease expression remains largely empirically unexplored. I highlight recent advances to the field, and discuss common-ground and -goals shared by researchers across medical and evolutionary domains.

Major conclusions

Mitochondrial genetic variance is linked to phenotypic variance across a variety of traits (e.g. reproductive function, life expectancy) fundamental to the upkeep of good health. Evolutionary theory predicts that mitochondrial genomes are destined to accumulate male-harming (but female-friendly) mutations, and this prediction has received proof-of-principle support. Furthermore, mitochondrial effects on the phenotype are typically manifested via interactions between mitochondrial and nuclear genes. Thus, whether a mitochondrial mutation is pathogenic in effect can depend on the nuclear genotype in which is it expressed.

General significance

Many disease phenotypes associated with OXPHOS malfunction might be determined by the outcomes of mitochondrial–nuclear interactions, and by the evolutionary forces that historically shaped mitochondrial DNA (mtDNA) sequences. Concepts and results drawn from the evolutionary sciences can have broad, but currently under-utilized, applicability to the medical sciences and provide new insights into understanding the complex genetics of mitochondrial disease. This article is part of a Special Issue entitled Frontiers of Mitochondrial Research.  相似文献   

9.

Background

Mitochondrial DNA (mtDNA) mutations could lead to mitochondrial dysfunction, which plays a major role in aging, neurodegeneration, and cancer. Recently, we have highlighted G-quadruplex (G4) formation of putative G4-forming (PQF) mtDNA sequences in cells. Herein, we examine structural variation of G4 formation due to mutation of mtDNA sequences in vitro.

Methods

The combined circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE) results provide complementary insights into the structural variation of the studied G-rich sequence and its mutants.

Results

This study illustrates the structural diversity of mt10251, a G-rich mtDNA sequence with a 16-nt loop, (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including the coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures of mt10251 in 20?mM K+ solution. Moreover, a single-base mutation of mt10251 can cause significant changes in terms of structural populations and polymorphism. In addition, single-base mutations of near-but-not-PQF sequences can potentially change not-G4 to G4 structures. We further found 124 modified PQF sequences due to single-base mutations of near-but-not-PQF sequences in mtDNA.

Conclusions

Single-base mutations of mt10251 could make significant changes in its structural variation and some single-base mutated sequences in mtDNA could form G4 structures in vitro.

General significance

We illustrate the importance of single-base mutations of DNA sequences to the change of G4 formation in vitro. The use of single-base mutations by generating the fourth G-tract and followed by selection in shortening the longest loop size in the near-but-not-PQF sequences was conducted for the G4 formation.  相似文献   

10.
11.

Background

Somatic mutation in mitochondrial DNA (mtDNA) has been proposed to contribute to initiation and progression of human cancer. In our previous study, high frequency of somatic mutations was found in the D-loop region of mtDNA of gastric cancers. However, it is unclear whether somatic mutations occur in the coding region of mtDNA of gastric cancers.

Methods

Using DNA sequencing, we studied 31 gastric cancer specimens and corresponding non-cancerous stomach tissues. Moreover, a human gastric cancer SC-M1 cell line was treated with oligomycin to induce mitochondrial dysfunction. Cisplatin sensitivity and cell migration were analyzed.

Results

We identified eight somatic mutations in the coding region of mtDNAs of seven gastric cancer samples (7/31, 22.6%). Patients with somatic mutations in the entire mtDNA of gastric cancers did not show significant association with their clinicopathologic features. Among the eight somatic mutations, five point mutations (G3697A, G4996A, G9986A, C12405T and T13015C) are homoplasmic and three mutations (5895delC, 7472insC and 12418insA) are heteroplasmic. Four (4/8, 50%) of these somatic mutations result in amino acid substitutions in the highly conserved regions of mtDNA, which potentially lead to mitochondrial dysfunction. In addition, in vitro experiments in SC-M1 cells revealed that oligomycin-induced mitochondrial dysfunction promoted resistance to cisplatin and enhanced cell migration. N-acetyl cysteine was effective in the prevention of the oligomycin-enhanced migration, which suggests that reactive oxygen species generated by defective mitochondria may be involved in the enhanced migration of SC-M1 cells.

General Significance

Our results suggest that somatic mtDNA mutations and mitochondrial dysfunction may play an important role in the malignant progression of gastric cancer.  相似文献   

12.

Background

Recently, many studies have focused on microRNAs (miRNAs) expression profiling in liver cancer, due to the ability of these small RNAs to potently influence cellular behavior. In this study, to further investigate the relationship between them, the miRNA expression profiling of the cancer liver tissues and normal liver tissues were compared.

Methods

The datasets of miRNAs microarray in liver cancer and normal control were downloaded from Gene Expression Omnibus. Then the SOAP analysis was performed to identify the differentially expressed miRNAs.

Results

A total of 221 differentially expressed miRNAs were found. Five of them (including hsa-miR-15b, hsa-miR-1975, hsa-miR-199a-3p, hsa-miR-199b-3p and hsa-miR-421) were determined by t-test and may be involved in the pathogenesis of liver cancer.

Conclusion

There differentially expressed miRNAs may be potential molecular markers for liver cancer screening.  相似文献   

13.

Background

Obesity is associated with various progressive age-related diseases, including neurological disorders. However, underlying molecular basis for increased risk of neurodegeneration in obesity is unknown. A suitable animal model would immensely help in understanding the obesity-linked neurological problems.

Methods

A spontaneously developed obese rat (WNIN/Ob) which is highly vulnerable for a variety of degenerative diseases was isolated from the existing WNIN stock rats. Ultrastructure of neurons in the cerebral cortex of 12-month old obese rats was evaluated by transmission electron microscopy. qRT-PCR and immunoblotting of ubiquitin C-terminal hydrolases (UCHs), ubiquitin, proteasomal sub-units, markers of ER stress and apoptosis were performed in the cerebral cortex. Proteasome activity was assayed by fluorometric method. Immunohistochemistry was performed for mediators of apoptosis, which was further confirmed by TUNEL assay. These investigations were also carried in high-fat diet-induced obese rat model.

Results

Neurons in the cerebral cortex of 12-month obese rats showed swollen mitochondria, disrupted ER and degenerating axons, nucleus and finally neurons. Results showed altered UPS, existence of ER stress, up-regulation of apoptotic markers and apoptosis in the cerebral cortex of obese rats. It appears that UCHL-1 mediated apoptosis through stabilizing p53 might play a role in neuronal cell death in obese rat. Similar changes were observed in the brain of diet-induced obese WNIN rats.

Conclusion

Altered UPS could be one of the underlying mechanisms for the neuronal cell death in obese conditions.

General significance

This is the first report to highlight the role of altered UPS in neurodegeneration due to obesity.  相似文献   

14.

Background

Mitochondrial DNA (mtDNA) is important for energy production as it encodes some of the key genes of electron transfer chain, where the majority of cellular energy is generated through oxidative phosphorylation (OXPHOS). MtDNA replication is mediated by nuclear DNA-encoded proteins or enzymes, which translocate to the mitochondria, and is strictly regulated throughout development. It starts with approximately 200 copies in each primordial germ cell and these copies undergo expansion and restriction events at various stages of development.

Scope of review

I describe the patterns of mtDNA replication at key stages of development. I explain that it is essential to regulate mtDNA copy number and to establish the mtDNA set point in order that the mature, specialised cell acquires the appropriate numbers of mtDNA copy to generate sufficient adenosine triphosphate (ATP) through OXPHOS to undertake its specialised function. I discuss how these processes are dependent on the controlled expression of the nuclear-encoded mtDNA-specific replication factors and that this can be modulated by mtDNA haplotypes. I discuss how these events are altered by certain assisted reproductive technologies, some of which have been proposed to prevent the transmission of mutant mtDNA and others to overcome infertility. Furthermore, some of these technologies are predisposed to transmitting two or more populations of mtDNA, which can be extremely harmful.

Major conclusions

The failure to regulate mtDNA replication and mtDNA transmission during development is disadvantageous.

General significance

Manipulation of oocytes and embryos can lead to significant implications for the maternal-only transmission of mtDNA.This article is part of a Special Issue entitled Frontiers of mitochondrial research.  相似文献   

15.

Background

This investigation clearly clarified the synthesized and antimitotic compound, 2-(3′-methoxyphenyl)-6-pyrrolidinyl-4-quinazolinone (HMJ-38), addressing its target and precise mechanism of action. We hypothesized that HMJ-38 might sensitize apoptotic death of human oral carcinoma CAL 27 cells in vitro and inhibit xenograft tumor growth in vivo.

Methods

Cell viability was assessed utilizing MTT assay. HMJ-38-treated cells represented DNA fragmentation using agarose gel electrophoresis as further evidenced using TUNEL staining. Flow cytometric analyses, immunoblotting and quantitative RT-PCR were applied for protein and gene expression. Antitumor xenograft study was employed.

Results

HMJ-38 concentration- and time-dependently reduced viability of CAL 27 cells. The effect of intrinsic molecules was signalized during HMJ-38 exposure with disruption of ΔΨm, MPT pore opening and the release of various events from mitochondria undergoing cell apoptosis. HMJ-38 also markedly facilitated G2/M phase arrest. HMJ-38 stimulated the activation of CDK1 activity that modulated phosphorylation on Ser70 of Bcl-2-mediated mitotic arrest and apoptosis. HMJ-38 triggered intracellular Ca2 + release and activated related pivotal hallmarks of ER stress. HMJ-38 in nude mice bearing CAL 27 tumor xenografts decreased tumor growth. Furthermore, HMJ-38 enhanced caspase-3 gene expression and protein level in xenotransplanted tumors.

Conclusions

Early roles of mitotic arrest, unfolded protein response and mitochondria-dependent signaling contributed to apoptotic CAL 27 cell demise induced by HMJ-38. In in vivo experiments, HMJ-38 also efficaciously suppressed tumor volume in a xenotransplantation model.

General significance

This finding might fully support a critical event for HMJ-38 via induction of apoptotic machinery and ER stress against human oral cancer cells.  相似文献   

16.
17.
18.

Background

Tumor formation and spread via the circulatory and lymphatic drainage systems is associated with metabolic reprogramming that often includes increased glycolytic metabolism relative to mitochondrial energy production. However, cells within a tumor are not identical due to genetic change, clonal evolution and layers of epigenetic reprogramming. In addition, cell hierarchy impinges on metabolic status while tumor cell phenotype and metabolic status will be influenced by the local microenvironment including stromal cells, developing blood and lymphatic vessels and innate and adaptive immune cells. Mitochondrial mutations and changes in mitochondrial electron transport contribute to metabolic remodeling in cancer in ways that are poorly understood.

Scope of Review

This review concerns the role of mitochondria, mitochondrial mutations and mitochondrial electron transport function in tumorigenesis and metastasis.

Major Conclusions

It is concluded that mitochondrial electron transport is required for tumor initiation, growth and metastasis. Nevertheless, defects in mitochondrial electron transport that compromise mitochondrial energy metabolism can contribute to tumor formation and spread. These apparently contradictory phenomena can be reconciled by cells in individual tumors in a particular environment adapting dynamically to optimally balance mitochondrial genome changes and bioenergetic status.

General Significance

Tumors are complex evolving biological systems characterized by genetic and adaptive epigenetic changes. Understanding the complexity of these changes in terms of bioenergetics and metabolic changes will permit the development of better combination anticancer therapies. This article is part of a Special Issue entitled Frontiers of Mitochondrial Research.  相似文献   

19.
20.

Background

We examined the expression of the mitochondrial selenoenzyme TrxR2 in the endothelial cell line EAhy926 under conditions known to modify its cytoplasmic counterpart TrxR1.

Methods

Cells were cultured with varying concentrations of selenite, sulforaphane or the Ca2+ ionophore A23187 for 72-h, prior to assay of TrxR concentration and activity. Further cultures underwent prolonged (7-day) Se-depletion before selenoprotein measurement.

Results

In Se-deficient cultures, neither Se, A23187 or sulforaphane affected TrxR2 concentration, while these treatments induced TrxR1 concentration (< 0.05). When co-incubated, optimal concentrations of Se (40 nM) and sulforaphane (4 μM) only modestly increased TrxR2 protein (∼ 1.3-fold), compared with TrxR1 (∼ 4-fold). In Se-deficient cells, TrxR activity was unaffected by sulforaphane or A23187. Prolonged Se-depletion caused a comparatively small reduction in TrxR2 (66% TrxR2 retained) against TrxR1 and glutathione peroxidase-1 activity (38% and 17% retained, respectively).

Conclusions

The relative resistance of TrxR2 to Se-deprivation and induction by sulforaphane and A23187 suggests TrxR2 lies near the top of the selenoprotein hierarchy in EAhy926 cells and exhibits near maximum expression under a range of culture conditions. In Se deficiency an inactive (possibly truncated) TrxR1 is produced in response to stimulus by sulforaphane and A23187.

General significance

These observations underpin a likely critical antioxidant role for TrxR2 and TrxR1 in the endothelium.  相似文献   

设为首页 | 免责声明 | 关于勤云 | 加入收藏

Copyright©北京勤云科技发展有限公司  京ICP备09084417号