The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Nucleotide sequence of Lactobacillus viridescens 5S RNA

The nucleotide sequence of Lactobacillus viridescens ATCC 12706 5S RNA was determined to be pU-G-U-U-G-U-G-A-U-G-A-U-G-G-C-A-U-U-G-A-G-G-U-C-A-C-A-C C-U-G-U-U-C-C-C-A-U-A-C-C-G-A-A-C-A-C-A-G-A-A-G-U-U-A-A-G-C-U-C-A-A-U-A-G-C-G C-C-G-A-A-A-G-U-A-G-U-U-G-G-A-G-G-A-U-C-U-C-U-U-C-C-U-G-C-G-A-G-G-A-U-A-G-G-A C-G-U-C-G-C-A-A-U-G-COH. When compared with other published sequences of prokaryotic 5S RNA species, this sequence shows as much homology with that from B. substilis (80% homology when all variations included) and B. megaterium (77% homology) as with the 5S RNA from another member of Lactobacillaceae family (L. brevis, 79% homology). The sequence contains the proposed tRNA binding site (CGAAC, positions 41-45) and can accomodate most, but not all, of the more recently proposed helical regions of secondary structure.     

Sequence and conformation of 5 S RNA from Chlorella cytoplasmic ribosomes: comparison with other 5 S RNA molecules

The sequence of Chlorella cytoplasmic 5 S RNA has been determined by fingerprinting techniques. Partial digests were fractionated by a two-dimensional acrylamide gel electrophoretic technique, which indicates whether specific fragments are paired in the molecule. In this way, the four main base-paired regions of the molecule were located. The sequence of Chlorella cytoplasmic 5 S RNA is related to, but different from, that of other eukaryotic 5 S RNAs: it shows approximately 60% homology with vertebrate 5 S RNA and 40% homology with yeast 5 S RNA. In some respects the conformation of the molecule in solution is quite different from that of other sequenced 5 S RNAs: in particular, the highly accessible region found around position 40 in all other 5 S RNAs (prokaryotic and eukaryotic) does not exist in this molecule.     

Molecular evolution of 5S RNA

Summary Based on the comparative analyses of the primary structure of 5S RNAs from 19 organisms, a secondary structure model of 5S RNA is proposed. 5S RNA has essentially the same structure among all prokaryotic species. The same is true for eukaryotic 5S RNAs. Prokaryotic and eukaryotic 5S RNAs are also quite similar to each other, except for a difference in a specific region.By comparing the nucleotide alignment from the juxtaposed 5S RNA secondary structures, a phylogenic tree of nineteen organisms was constructed. The time of divergence between prokaryotes and eukaryotes was estimated to be 2.5×10⁹ years ago (minimum estimate: 2.1×10⁹).     

5S RNA may not have highly ordered structure like 4S RNAS

The rates of hydrolysis of the following polyribonucleotides as catalysed by RNase I, an enzyme specific for single stranded RNAs, follow the sequence shown; poly (A) > 23S RNA > 5S RNA ? 16S RNA > 4S RNA = poly (I). poly (C). The rates were measured by direct spectrophotometric as well as by trichloroacetic acid precipitation methods. The extents of inhibition of RNase I-catalysed hydrolysis of poly (A) by each of the above-mentioned polyribonucleotides follow the reverse order. Taking into account the fact that double stranded RNAs are inhibitory to RNase I it may be concluded from the above results that 5S RNA has much less ordered structure than 4S RNAs. This prediction is contrary to expectations and its validity will be known when the tertiary structure of 5S RNA will be worked out. These results also indicate that 16S RNA may have more folded structure than 23S RNA.     

Nucleotide sequence of 5S ribosomal RNA from rainbow trout (Salmo gairdnerii) liver.

Staring from low molecular weight RNA obtained from rainbow trout (Salmo gairdnerii) liver, 5S ribosomal RNA (rRNA) was highly purified by successive chromatography on columns of DEAE-Sephadex A50 and Sephadex G100. Products of complete and partial digestions on this RNA with pancreatic ribonuclease (RNase A) [EC 3.1.4.22] and RNase T [EC 3.1.4.8] were isolated and sequenced by conventional and high-performance liquid chromatography (HPLC) procedures. The nucleotide sequence of this RNA thus established was compared with those of five other vertebrae 5S rRNAs, and the rates of base substitution per site per year were found to be nearly constant in these RNAs. The analyses of the partial digests of the trout 5S rRNA revealed several sites susceptible to RNase attack, which could be accounted for by the secondary structure model for eukaryotic 5S rRNAs proposed by Nishikawa and Takemura (1).     

Phylogeny of the 5S ribosomal RNA from Synechococcus lividus II: the cyanobacterial/chloroplast 5S RNAs form a common structural class

The complete nucleotide sequence of the 5S ribosomal RNA from the cyanobacterium Synechococcus lividus II has been determined. The sequence is (sequence in text) This 5S RNA has the cyanobacterial- and chloroplast-specific nucleotide insertion between positions 30 and 31 (using the numbering system of the generalized eubacterial 5S RNA) and the chloroplast-specific nucleotide-deletion signature between positions 34 and 39. The 5S RNA of S. lividus II has 27 base differences compared with the 5S RNA of the related strain S. lividus III. This large difference may reflect an ancient divergence between these two organisms. The electrophoretic mobilities on nondenaturing polyacrylamide gels of renatured 5S RNAs from S. lividus II, S. lividus III, and spinach chloroplasts are identical, but differ considerably from that of Escherichia coli 5S RNA. This most likely reflects differences in higher-order structure between the 5S RNA of E. coli and these cyanobacterial and chloroplast 5S RNAs.     

Oocyte and somatic 5S ribosomal RNA and 5S RNA encoding genes in Xenopus tropicalis.

We have investigated the structure of oocyte and somatic 5S ribosomal RNA and of 5S RNA encoding genes in Xenopus tropicalis. The sequences of the two 5S RNA families differ in four positions, but only one of these substitutions, a C to U transition in position 79 within the internal control region of the corresponding 5S RNA encoding genes, is a distinguishing characteristic of all Xenopus somatic and oocyte 5S RNAs characterized to date, including those from Xenopus laevis and Xenopus borealis. 5S RNA genes in Xenopus tropicalis are organized in clusters of multiple repeats of a 264 base pair unit; the structural and functional organization of the Xenopus tropicalis oocyte 5S gene is similar to the somatic but distinct from the oocyte 5S DNA in Xenopus laevis and Xenopus borealis. A comparative sequence analysis reveals the presence of a strictly conserved pentamer motif AAAGT in the 5'-flanking region of Xenopus 5S genes which we demonstrate in a separate communication to serve as a binding signal for an upstream stimulatory factor.     

The nucleotide sequence of phenylalanine tRNA and 5S RNA from Rhodospirillum rubrum

The complete nucleotide sequence of tRNAPhe and 5S RNA from the photosynthetic bacterium Rhodospirillum rubrum has been elucidated. A combination of in vitro and in vivo labelling techniques was used. The tRNAPhe sequence is 76 nucleotides long, 7 of which are modified. The primary structure is typically prokaryotic and is most similar to the tRNAPhe of Escherichia coli and Anacystis nidulans (14 differences of 76 positions). The 5S ribosomal RNA sequence is 120 nucleotides long and again typical of other prokaryotic 5S RNAs. The invariable GAAC sequence is found starting at position 45. When aligned with other prokaryotic 5S RNA sequences, a surprising amount of nucleotide substitution is noted in the prokaryotic loop region of the R. rubrum 5S RNA. However, nucleotide complementarity is maintained reinforcing the hypothesis that this loop is an important aspect of prokaryotic 5S RNA secondary structure. The 5S and tRNAPhe are the first complete RNA sequences available from the photosynthetic bacteria.     

The evolution of 5S RNA secondary structures

We have applied the Pipas-McMahon algorithm based on free energy calculations to the search for a 5S RNA base-pair structure common to all known sequences. We find that a 'Y' shaped model is consistently among the structures having the lowest free energy using 5S RNA sequences from either eukaryotic or prokaryotic sources. Compaison of this 'Y' structure with models which have recently been proposed show these models to be remarkably similar, and the minor differences are explicable based on the technique used to obtain the model. That prokaryotic and eukaryotic 5S RNA can adopt a similar secondary structure is strong support for its resistance to change during evolution.     

Accessibility of phosphodiester bonds in the yeast ribosomal 5 S RNA protein complex

The tertiary structure of the protein-associated yeast ribosomal 5 S RNA was examined using ethylnitrosourea reactivity as a probe for phosphodiester bonds. A reduced reactivity was consistently observed in at least nine residues within four distinct regions of the RNA sequence. Seven of these were also observed in three regions of the free RNA molecule while two, A27 and G30, were only present in the ribonucleoprotein complex. The results strongly suggest that the tertiary structure of the free eukaryotic 5 S RNA is largely conserved in the 5 S RNA-protein complex although it appears to be further stabilized in interaction with the ribosomal protein.     

The nucleotide sequence of ribosomal 5S RNA from Rhizobium meliloti: comparison with 5S rRNA of Agrobacterium

The complete nucleotide sequence of R. meliloti 5S ribosomal RNA has been determined and compared with the already known sequence of A. tumefaciens 5S rRNA (Vandenberghe et al., 1985, Eur. J. Biochem., 149, 537-542) and of other 5S rRNAs from Rodobacteria Alpha-2 (Wolters et al., 1988, Nucleic Acids Res., 16, rl-r70). The differences found at eight positions (23, 73, 83, 72 in helical fragments; 16, 40, 88 in loops; 54 in bulge), which might affect secondary structures of 5S rRNA, are small. Moreover, the sequence analysis specifies both variable and common positions in 5S rRNA secondary structure of Rodobacteria Alpha-2.     

The nucleotide sequence of the 5S RNA of chicken embryo fibroblasts.

The nucleotide sequence of uniformly 32P-labelled chicken 5S RNA has been determined by analysing the end-products of T1 and pancreatic ribonuclease digestion. These oligonucleotides can be aligned by homology with the human sequence to give a sequence differing in only seven positions from that of Man. The sequence deduced here differs in two position from that previously published for chicken 5S RNA.     

The structure of the 5 S ribosomal RNA of a member of the phylum of green non-sulfur bacteria and relatives

The 5 S rRNA sequence was determined for the bacterium Herpetosiphon strain Senghas Wie 2. It is the first 5 S RNA sequence reported for a member of the eubacterial phylum defined by green non-sulfur bacteria. The sequence fits into a consensus secondary structure model for eubacterial 5 S RNA. At four positions, the sequence shows substitutions with respect to strongly conserved nucleotides found in other hitherto examined eubacterial 5 S RNAs.     

Phylogeny of the 5S ribosomal RNA fromSynechococcus lividus II: The cyanobacterial/chloroplast 5S RNAs form a common structural class

Summary The complete nucleotide sequence of the 5S ribosomal RNA from the cyanobacteriumSynechococcus lividus II has been determined. The sequence is 5-UGCCUAGUGUUUAUGGCGCG-GUGGAACCACGCUGAUCCAUCCCGAACUC-AGAGGUGAAACAUCGCAGCGGUGAAGAU-AGUUGGAGGGUAGCCUCCUGCAAAAAUA-GCUCAAUGCUAGGCA_OH-3. This 5S RNA has the cyanobacterial- and chloroplast-specific nucleotide insertion between positions 30 and 31 (using the numbering system of the generalized eubacterial 5S RNA) and the chloroplast-specific nucleotide-deletion signature between positions 34 and 39. The 5S RNA ofS. lividus II has 27 base differences compared with the 5S RNA of the related strainS. lividus III. This large difference may reflect an ancient divergence between these two organisms. The electrophoretic mobilities on nondenaturing polyacrylamide gels of renatured 5S RNAs fromS. lividus II,S. lividus III, and spinach chloroplasts are identical, but differ considerably from that ofEscherichia coli 5S RNA. This most likely reflects differences in higher-order structure between the 5S RNA ofE. coli and these cyanobacterial and chloroplast 5S RNAs.     

The nucleotide sequence of 5S rRNA from bovine liver.

We have determined the nucleotide sequence of ribosomal 5S RNA from bovine liver. The comparison of this sequence with those from other eukaryotic sources shows that a common secondary structure model for all eukaryotic 5S rRNAs may exist. Analysis of the evolutionary conserved nucleotides in metazoan 5S rRNAs suggests that the tertiary interactions, proposed earlier for plant 5S rRNA, are also possible.     

Nucleotide sequence of 5S ribosomal RNA from Aspergillus nidulans and Neurospora crassa

The nucleotide sequences of 5S rRNA molecules isolated from the cytosol and the mitochondria of the ascomycetes A. nidulans and N. crassa were determined by partial chemical cleavage of 3'-terminally labelled RNA. The sequence identity of the cytosolic and mitochondrial RNA preparations confirms the absence of mitochondrion-specific 5S rRNA in these fungi. The sequences of the two organisms differ in 35 positions, and each sequence differs from yeast 5S rRNA in 44 positions. Both molecules contain the sequence GCUC in place of GAAC or GAUY found in all other 5S rRNAs, indicating that this region is not universally involved in base-pairing to the invariant GTpsiC sequence of tRNAs.