Mismatch cleavage by single-strand specific nucleases

We have investigated the ability of single-strand specific (sss) nucleases from different sources to cleave single base pair mismatches in heteroduplex DNA templates used for mutation and single-nucleotide polymorphism analysis. The TILLING (Targeting Induced Local Lesions IN Genomes) mismatch cleavage protocol was used with the LI-COR gel detection system to assay cleavage of amplified heteroduplexes derived from a variety of induced mutations and naturally occurring polymorphisms. We found that purified nucleases derived from celery (CEL I), mung bean sprouts and Aspergillus (S₁) were able to specifically cleave nearly all single base pair mismatches tested. Optimal nicking of heteroduplexes for mismatch detection was achieved using higher pH, temperature and divalent cation conditions than are routinely used for digestion of single-stranded DNA. Surprisingly, crude plant extracts performed as well as the highly purified preparations for this application. These observations suggest that diverse members of the S₁ family of sss nucleases act similarly in cleaving non-specifically at bulges in heteroduplexes, and single-base mismatches are the least accessible because they present the smallest single-stranded region for enzyme binding. We conclude that a variety of sss nucleases and extracts can be effectively used for high-throughput mutation and polymorphism discovery.     

Large non-homology in heteroduplex DNA is processed differently than single base pair mismatches

Summary Unmethylated DNA heteroduplexes with a large single stranded loop in one strand have been prepared from separated strands of DNA from two different strains of bacteriophage , one of which has a 800 base pair IS1 insertion in the cI gene. The results of transfections with these heteroduplexes into wild-type and mismatch repair deficient bacteria indicate that such large non-homologies are not repaired by the Escherichia coli mismatch repair system. However, the results do suggest that some process can act to repair such large non-homologies in heteroduplex DNA. Transfections of a series of recombination and excision repair deficient mutants suggest that known excision or recombination repair systems of E. coli are not responsible for the repair. Repair of large non-homologies may play a role in gene conversion involving large insertion or deletion mutations.     

Extensive Recombination Due to Heteroduplexes Generates Large Amounts of Artificial Gene Fragments during PCR

Artificial recombinants can be generated during PCR when more than two genetically distinct templates coexist in a single PCR reaction. These recombinant amplicons can lead to the false interpretation of genetic diversity and incorrect identification of biological phenotypes that do not exist in vivo. We investigated how recombination between 2 or 35 genetically distinct HIV-1 genomes was affected by different PCR conditions using the parallel allele-specific sequencing (PASS) assay and the next generation sequencing method. In a standard PCR condition, about 40% of amplicons in a PCR reaction were recombinants. The high recombination frequency could be significantly reduced if the number of amplicons in a PCR reaction was below a threshold of 10¹³–10¹⁴ using low thermal cycles, fewer input templates, and longer extension time. Heteroduplexes (each DNA strand from a distinct template) were present at a large proportion in the PCR products when more thermal cycles, more templates, and shorter extension time were used. Importantly, the majority of recombinants were identified in heteroduplexes, indicating that the recombinants were mainly generated through heteroduplexes. Since prematurely terminated extension fragments can form heteroduplexes by annealing to different templates during PCR amplification, recombination has a better chance to occur with samples containing different genomes when the number of amplicons accumulate over the threshold. New technologies are warranted to accurately characterize complex quasispecies gene populations.     

Recombination following transformation of Escherichia coli by heteroduplex plasmid DNA molecules

Circular heteroduplex DNA molecules introduced into Escherichia coli-competent cells are converted to new recombinant plasmids as a result of enzymatic actions in vivo. A pair of plasmids with partial sequence homology were each linearized at a different position with restriction enzymes, and the termini were made flush with the single-strand-specific S1 nuclease. Duplex molecules were then formed by melting and annealing these plasmid DNAs together. In contrast to linear homoduplex molecules, heteroduplexes circularize and therefore transform E. coli efficiently. Unique DNA sequences on each of the parental strands in the transforming heteroduplexes can be selectively incorporated or deleted as a result of in vivo enzymatic activities in transformed cells. This method permits the generation of new recombinant sequences in vivo without relying solely on the presence of convenient restriction sites for manipulation of DNA fragments in vitro.     

EVOLUTIONARY INFERENCES FROM A COMPARISON OF COCKROACH NUCLEAR DNA AND DNA FROM THEIR FAT-BODY AND EGG ENDOSYMBIONTS

DNA was isolated from muscle tissue and from concentrations of the egg and fat-body endosymbionts of the cockroaches Periplaneta americana, Blatta orientalis, Blaberus giganteus, Gromphadorhina portentosa, Leucophaea maderae, Cryptocercus punctulatus, and Nyctibora lutzi. Denatured DNA from each was immobilized on nitrocellulose membranes and reassociated with labeled probe DNAs from egg endosymbionts and muscle nuclei of B. orientalis. The DNAs were compared by extent of binding and by the thermal melting profiles of the DNA duplexes. The DNAs from the endosymbionts in the eggs and fat body in both P. americana and B. orientalis were shown to be virtually identical, confirming that transovarial transmission of the bacteria does take place. The thermal stabilities of the heteroduplexes formed with the probe DNA from egg endosymbionts of B. orientalis differed from the homologous duplexes by only 1°–11°C, indicating a close relationship among the endosymbiont strains. The heteroduplexes of the nuclear DNAs differ from the homologous duplexes by 2°–7°C. Compared with known systems in bacterial and Drosophila species, these results indicate similar base-pair mismatches for host and endosymbiont DNAs. From these correlations, we deduce that the endosymbionts have probably been associated with their host cockroaches since before the latter speciated.     

Analysis of an RNA Pseudoknot Structure by CD Spectroscopy

Abstract

The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A · C opposition at higher temperatures (J. Mol. Biol. 214, 455–470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A · U, G · C, and G · U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373–384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A · C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A · C oppositions.     

The PNA-DNA hybrid I-motif: implications for sugar-sugar contacts in i-motif tetramerization

We have created a hybrid i-motif composed of two DNA and two peptide nucleic acid (PNA) strands from an equimolar mixture of a C-rich DNA and analogous PNA sequence. Nano-electrospray ionization mass spectrometry confirmed the formation of a tetrameric species, composed of PNA–DNA heteroduplexes. Thermal denaturation and CD experiments revealed that the structure was held together by C-H⁺-C base pairs. High resolution NMR spectroscopy confirmed that PNA and DNA form a unique complex comprising five C-H⁺-C base pairs per heteroduplex. The imino protons are protected from D₂O exchange suggesting intercalation of the heteroduplexes as seen in DNA₄ i-motifs. FRET established the relative DNA and PNA strand polarities in the hybrid. The DNA strands were arranged antiparallel with respect to one another. The same topology was observed for PNA strands. Fluorescence quenching revealed that both PNA–DNA parallel heteroduplexes are intercalated, such that both DNA strands occupy one of the narrow grooves. H1′–H1′ NOEs show that both heteroduplexes are fully intercalated and that both DNA strands are disposed towards a narrow groove, invoking sugar–sugar interactions as seen in DNA₄ i-motifs. The hybrid i-motif shows enhanced thermal stability, intermediate pH dependence and forms at relatively low concentrations making it an ideal nanoscale structural element for pH-based molecular switches. It also serves as a good model system to assess the contribution of sugar–sugar contacts in i-motif tetramerization.     

Comparison of different cationic probes for electron microscopic visualization of bacterial polyanionic capsular material

We have isolated from the ovine rumen eight bacterial strains belonging to the speciesButyrivibrio fibrisolvens. DNA hybridization studies showed that the eight strains could be divided into four homology groups, of which none was closely related to the type strain ATCC 19171. Measurement of cross-hybridization between selected pairs of bacterial strains showed that DNA types which produced low, but significant, cross-hybridization on dot-blots were able to form heteroduplexes with between 8.4% and 32.9% of the efficiency of homoduplex formation. Thermal denaturation of the same heteroduplexes resulted in Tm values 6.4–7.5°C lower than those of the homologous duplexes formed under the same conditions. In some cases, hybridization between strains was below the level of reliable measurement. Similar experiments with ten recently isolated strains ofBacteroides ruminicola sub-sp.brevis revealed a similar degree of genetic divergence between isolates.     

Underwound loops in self-renatured DNA can be diagnostic of inverted duplications and translocated sequences

DNA that contains inverted duplications separated by non-inverted sequences often can form characteristic “underwound loops” when it is denatured and reannealed. An underwound loop is a partially double-stranded, partially denatured segment between the inverted duplications and is produced as follows. During the early stages of the reannealing, intrastrand stem-loop structures form with first-order kinetics when the inverted duplications pair. In a slower second-order reaction, complementary strands (each with a stem-loop) reanneal. The stem-loop structures produce a cruciform in the hybrid. Because of the unpaired sequences in the loop, the cruciform is unstable. It can isomerize to a linear duplex by double-strand exchange of complementary sequences in the stems. This process requires co-ordinated axial rotation of the stems and the flanking duplexes as well as rotation of the loops. If, however, complementary sequences in the loops start to pair, axial rotation is prevented and the stem-loop structures are trapped in a metastable state. The strands of separate, closed rings cannot interwind when they pair. Consequently, the loops observed by electron microscopy have variable patterns of single-stranded denaturation bubbles and duplex segments with both right-handed and left-handed winding.We have used underwound loops to identify a short inverted duplication flanking the γδ recombination sequence of Escherichia coli F factor (isolated on φ80 d₃ilv⁺ transducing phage) and to study DNA from phages Mu and P1 in which the G segments are flanked by inverted duplications. When deproteinized adenovirus-2 DNA was denatured and reannealed, some underwound circles the length of the entire chromosome were observed by electron microscopy. These resulted from the restricted interaction of complementary single-stranded rings generated when pairing of the short inverted terminal duplications closed the ends of single strands. Another type of underwound loop was seen in heteroduplexes containing complementary insertion loops located at different positions in the hybridized strands, such as occurs with P1 cam DNAs. All these underwound structures are similar in appearance to the hybrids formed when topologically separate, complementary single-stranded circles of Colicin E₁ DNA were allowed to anneal.     

Reduction of the number of mutant copies of mitochondrial DNA in tissues of irradiated mice in the postradiation period

Changes in the number of mutant copies of mitochondrial DNA (mtDNA) were studied in the brain and spleen tissues of mice after their X-irradiation at a dose of 5 Gy. For this purpose, heteroduplexes obtained via hybridization of the products of PCR amplification of mtDNA (ND3 gene and two D-loop regions) from irradiated and control mice were digested with the CelI nuclease capable of specific mismatch cleavage. Heteroduplexes obtained via hybridization of the products of PCR amplification of mtDNA from irrradiated and control mice were digested by the CelI nuclease to a greater degree than heteroduplexes of the PCR products of mtDNA of mice from the control group. This suggests the presence of mutations in mtDNA regions in irradiated mice. Digestion by the CelI nuclease of heteroduplexes obtained via hybridization of the PCR products of mtDNA (ND3 gene and D-loop regions) on day 8 after irradiation is essentially more efficient than digestion of heteroduplexes obtained via hybridization of the PCR products of mtDNA isolated from mouse tissues on days 14 and 28 of the postradiation period. These results indicate a reduction in the number of mtDNA copies with mutations in tissues of irradiated mice by day 28 of the postradiation period. The reduction in the level of mutant mtDNA copies by this term is especially significant in the spleen. The total number of mtDNA copies in the mouse brain and spleen tissues estimated by real-time PCR, relative to the nuclear β-actin gene, is also decreased by 30–50% as compared to the control on days 8 to 28 after irradiation. The results of the study suggest that mutant mtDNA copies are eliminated from tissues of irradiated animals in the postradiation period. This elimination can be regarded either as a result of selective degradation of mitochondria carrying mutant DNA copies or as a result of cell death being continued in tissues of irradiated animals.     

A rapid PCR-based method for genetically mapping ESTs

A simple, semi-automatable procedure was developed for converting expressed sequence tags (ESTs) into mappable genetic markers. The polymerase chain reaction is used to amplify regions immediately 5′ or 3′ to the coding regions of genes in order to maximise sequence variability between alleles. Fragment length and nucleotide substitution polymorphisms among amplified alleles can be detected using either ethidium bromide staining or automated laser-based fluorescence. A 6% non-denaturing acrylamide gel, analysed with an ABI 377 DNA sequencer, proved capable of resolving homoduplexes and heteroduplexes formed between amplified alleles containing nucleotide substitutions as well as resolving allelic length differences. With this approach 75% of 60 ESTs from a range of Pinus species could be genetically mapped in each of three pedigrees from P. radiata and P. taeda. Furthermore, three or four alleles were detected in each pedigree for 42% of the EST markers. Received: 4 January 2000 / Accepted: 26 May 2000     

A polymorphism in a region with enhancer activity in the second intron of the human apolipoprotein B gene

A 443-base pair fragment (+622 to +1064) from the second intron of the human apolipoprotein B gene was shown to contain a tissue-specific enhancer when placed in front of an apolipoprotein B promoter-chloramphenicol acetyltransferase construct in transfection experiments. To identify potential regulatory mutations in this region of the gene, DNA from various subjects was examined for the presence of point mutations by means of chemical cleavage of mismatched heteroduplexes. An A----G substitution within the second intron of the gene at position +722 was identified in three unrelated subjects and confirmed by DNA sequencing. Although the base substitution was contained within a nuclear protein-binding site, as determined by DNase I footprinting, it did not appear to affect the protein/DNA interaction in its vicinity, as shown by gel retardation experiments. The single base substitution at position +722 abolishes a StyI restriction site, thus creating a StyI polymorphism. Using allele-specific oligonucleotides, we screened the DNA of 172 subjects for the presence of this polymorphism: two other subjects carrying the polymorphism were found. In each of the five unrelated subjects, the polymorphism was associated with the same haplotype.     

Transfection of heteroduplexes containing uracil · guanine or thymine · guanine mispairs into plant cells

We have compared the fate of U · G mispairs or analogous T · G mispairs in DNA heteroduplexes transfected into tobacco protoplasts. The heteroduplex DNA consisted of tomato golden mosaic virus DNA sequences in theEscherichia coli vectors pUC118 or pUC119. After transfection, the mismatched U residues were lost with an efficiency of greater than 95%, probably as a result of the uracil-DNA glycosylase pathway for excision of U residues in any sequence context. In contrast to the preferential removal of the mispaired U residues, biased removal of T residues from analogous heteroduplexes was not seen in the transfected plant cells. Also, we investigated the effect of extensively methylating one strand of the heteroduplex DNA used for transfection. Surprisingly, such methylation resulted in highly biased loss of the mismatched base from the 5-methylcytosine-rich strand of T · G-containing heteroduplexes.Deceased. We dedicate this paper to the memory of this young scientist.     

Analysis of cooperativity and ion effects in the interaction of quinacrine with DNA

The interaction of quinacrine with calf thymus DNA was monitored at several different ionic strengths using spectrophotometric and equilibrium dialysis techniques. The binding results can be explained, assuming each base pair is a potential binding site, using a model containing two negative cooperative effects: (1) ligand exclusion at binding sites adjacent to a filled binding site and (2) ligand–ligand negative cooperativity at adjacent filled binding sites. The logarithm of the observed equilibrium constant (K_obs) determined by this model varies linearily with log[Na⁺], as predicted by the ion condensation theory for polyelectrolytes. When the log K_obs plot is correlated for sodium release by DNA in the intercalation conformational change, the predicted number of ion pairs between the ligand and DNA is approximately two, as expected for the quinacrine dication. Even though K_obs depends strongly on ionic strength, the ligand negative cooperativity parameter ω was found to be indpendent of ionic strength within experimental error. This finding is also in agreement with the ion condensation theory, which predicts a relatively constant amount of condensed counterion on the DNA double helix over this ionic strength range. Drugs would, therefore, experience a relatively constant ionic environment when complexed to DNA even though the ionic conditions of the solvent could change considerably.     

DNA replication,3H-cRNA in situ hybridization and C-band patterns in the polycentric chromosomes ofLuzula purpurea Link

DNA late-replication,³H-cRNA in situ hybridization, and C-band distribution patterns were studied inLuzula purpurea Link chromosomes (2n=6). With each technique it was possible to identify homologous chromosomes. DNA late-replicating regions were present at the ends and in the middle of one chromosome pair (pair 1), on both ends of another chromosome pair with one end having more late-replicating regions than the other end (pair 2), and all along the length of the final pair (pair 3). The distribution of label following in situ hybridization of³H-cRNA complementary to Cot 1-reassociated DNA was similar to the DNA late-replication patterns. One chromosome pair had grains concentrated at the ends and in the middle of the chromosomes; another pair had grains at both ends with a greater grain concentration at one end; the final chromosome pair had grains distributed all along the length. C-band distribution patterns were also similar to the DNA late-replication and³H-cRNA in situ-hybridized ones. The results demonstrate that the constitutive heterochromatin ofL. purpurea polycentric chromosomes is similar to the constitutive heterochromatin of monocentric animal chromosomes in that it consists of highly repeated DNA sequences which are replicated late in the S stage of interphase.     

Genetic analysis of the Hsm3 protein domain structure in yeast <Emphasis Type="Italic">Saccharomyces cerevisiae</Emphasis>

Gene HSM3 encodes the Hsm3 protein involved in the minor branch in the system responsible for the correction of mismatched bases in DNA structure and controls replicative and reparative spontaneous mutagenesis in yeast Saccharomyces cerevisiae. Spontaneous and UV-induced mutagenesis was studied in three mutant alleles of gene HSM3, and repair effectivity of artificial heteroduplexes was assessed in DNA molecule. The resuts of these studies allowed establishment of the protein domain structure of protein Hsm3 and functions of each domain: the N-terminal domain is responsible for binding to mispaired bases, and the C-terminal domain ensures the interaction with other proteins involved in the system of mismatched base correction.     

Evaluation of PCR-Generated Chimeras, Mutations, and Heteroduplexes with 16S rRNA Gene-Based Cloning

To evaluate PCR-generated artifacts (i.e., chimeras, mutations, and heteroduplexes) with the 16S ribosomal DNA (rDNA)-based cloning approach, a model community of four species was constructed from alpha, beta, and gamma subdivisions of the division Proteobacteria as well as gram-positive bacterium, all of which could be distinguished by HhaI restriction digestion patterns. The overall PCR artifacts were significantly different among the three Taq DNA polymerases examined: 20% for Z-Taq, with the highest processitivity; 15% for LA-Taq, with the highest fidelity and intermediate processitivity; and 7% for the conventionally used DNA polymerase, AmpliTaq. In contrast to the theoretical prediction, the frequency of chimeras for both Z-Taq (8.7%) and LA-Taq (6.2%) was higher than that for AmpliTaq (2.5%). The frequencies of chimeras and of heteroduplexes for Z-Taq were almost three times higher than those of AmpliTaq. The total PCR artifacts increased as PCR cycles and template concentrations increased and decreased as elongation time increased. Generally the frequency of chimeras was lower than that of mutations but higher than that of heteroduplexes. The total PCR artifacts as well as the frequency of heteroduplexes increased as the species diversity increased. PCR artifacts were significantly reduced by using AmpliTaq and fewer PCR cycles (fewer than 20 cycles), and the heteroduplexes could be effectively removed from PCR products prior to cloning by polyacrylamide gel purification or T7 endonuclease I digestion. Based upon these results, an optimal approach is proposed to minimize PCR artifacts in 16S rDNA-based microbial community studies.     

Mitotic recombination: Mismatch correction and replicational resolution of holliday structures formed at the two strand stage in Saccharomyces

Summary In a preliminary report (Esposito 1978), evidence was presented which showed that heteroallelic recombination resulting in prototrophic colonies occurs at the 2-strand stage. A model utilizing replicative resolution of Holliday structures was proposed to explain how gene conversion at the 2-strand stage can result in exchange of outside markers. The object of the experiments reported herein was to present detailed genetic evidence for 2-strand recombination. In addition, we examined the features of mitotic recombination with respect to symmetry, length and polarity of heteroduplexes in wild type strains (REM1/REM1) and in strains bearing the hyper-recombination mutation rem1-1. To do this, we constructed strains so that prototrophs arising from heteroallelic recombination and recombinant for outside markers were detected by visual inspection. By analyzing these colonies genetically, we have inferred several features of mitotic recombination which distinguish it from its meiotic counterpart. Firstly, mototic heteroduplexes are often symmetric while meiotic heteroduplexes are almost exclusively asymmetric. Secondly, heteroduplexes tend to be longer in mitosis than in meiosis. Thirdly, unlike meiotic conversion, mitotic conversion does not show strong polarity. Recombination in strains homozygous for the rem1-1 mutation also takes place at the 2-strand stage. The rem1-1 mutation, however, appears to alter the features of mismatch correction.     

Structure of branched DNA molecules: gel retardation and atomic force microscopy studies.

DNA heteroduplexes as models for slipped strand DNA have been analyzed by polyacrylamide gel migration and atomic force microscopy (AFM). All heteroduplexes containing one hairpin or loop have reduced electrophoretic mobilities compared with that expected for their molecular weights. The retarded gel mobility correlates with the formation of a sharp kink detected by AFM. Increasing the hairpin length from 7 bp to 50 bp results in a monotonous decrease in gel mobility of heteroduplexes. This secondary retardation effect appears to depend only on the hairpin size since the AFM data show no dependence of the kink angle on the hairpin length. Heteroduplex isomers with a loop or hairpin in opposite strands migrate with distinct mobilities. Analysis of gel migration of heteroduplexes with altered hairpin orientations as well as of truncated heteroduplexes indicates that the difference in mobility is due to an inherent curvature in one of the long arms. This is confirmed by the end-to-end distance measurements from AFM images. In addition, significant variation of the end-to-end distances is consistent with a dynamic structure of heteroduplexes at the three-way junction. Double heteroduplexes containing one hairpin in each of the complementary strands also separate in a gel as two isomers. Their appearance in AFM showed a complicated pattern of flat representations of the three-dimensional structure and may indicate a certain degree of interaction between complementary parts of the hairpins that are several helical turns apart.