Physico-chemical studies on DNA triplexes containing an alternate third strand with a non-nucleotide linker

Differential scanning calorimetric (DSC), circular dichroism (CD) and molecular mechanics studies have been performed on two triple helices of DNA. The target duplex consists of 16 base pairs in alternate sequence of the type 5′-(purine)_m(pyrimidine)_m-3′. In both the triplexes, the third oligopyrimidine strand crosses the major groove at the purine–pyrimidine junction, with a simultaneous binding of the adjacent purine tracts on alternate strands of the Watson–Crick duplex. The switch is ensured by a non-nucleotide linker, the 1,2,3 propanetriol residue, that joins two 3′–3′ phosphodiester ends. The third strands differ from each other for a nucleotide in the junction region. The resulting triple helices were termed 14-mer-PXP and 15-mer-PXP (where P=phosphate and X=1,2,3-propanetriol residue) according to the number of nucleotides that compose the third strand. DSC data show two independent processes: the first corresponding to the dissociation of the third strand from the target duplex, the second to the dissociation of the double helix in two single strands. The two triple helices show the same stability at pH 6.6. At pH 6.0, the 15-mer-PXP triplex is thermodynamically more stable than the 14-mer-PXP triplex. Thermodynamic data are discussed in relation to structural models. The results are useful when considering the design of oligonucleotides that can bind in an antigene approach to the DNA for therapeutic purposes.     

Secondary binding sites for triplex-forming oligonucleotides containing bulges, loops, and mismatches in the third strand

We have used DNase I footprinting to examine the binding of five different 17-mer oligonucleotides to a 53-base oligopurine tract containing four pyrimidine interruptions. Although all the expected triplexes formed with high affinity (K(d) approximately 10-50 nM), one oligonucleotide produced a footprint at a second site with about 20-fold lower affinity. We have explored the nature of this secondary binding site and suggest that it arises when each end of the third strand forms a 7-mer triplex with adjacent regions on the duplex, generating a contiguous 14-base triplex with a bulge in the center of the third strand oligonucleotide. This unusual binding mode was examined by use of oligonucleotides that were designed with the potential to form different length third-strand loops of various base composition. We find that triplexes containing single-base bulges are generally more stable than those with dinucleotide loops, though triplexes can be formed with loops of up to nine thymines, generating complexes with submicromolar dissociation constants. These structures are much more stable than those formed by adding two separate 7-mer oligonucleotides, which do not generate DNase I footprints, though a stable complex is generated when the two halves are covalently joined by a hexa(ethylene glycol) linker. MPE produces less clear footprints, presumably because this cleavage agent binds to triplex DNA, but confirms that the oligonucleotides can bind in unexpected places. These results suggest that extra care needs to be taken when designing long triplex-forming oligonucleotides so as to avoid triplex formation at shorter secondary sites.     

Evidence for a DNA triplex in a recombination-like motif: I. Recognition of Watson-Crick base pairs by natural bases in a high-stability triplex

Data are presented on a triplex type with two parallel homologous strands for which triplex formation is almost as strong as duplex formation at least for some sequences and even at pH 7 and 0.2 M NaCl. The evidence mainly rests upon comparing thermodynamic properties of similar systems. A paperclip oligonucleotide d(A12C4T12C4A12) with two linkers C4 obviously can form a triplex with parallel back-folded adenine strand regions, because the single melting transition of this complex splits in two transitions by introducing mismatches only in the third strand region. Respectively, a hairpin duplex d(A12C4T12) and a single strand d(A12) form a triplex as a 1:1 complex in which the second adenine strand is parallel oriented to the homologous one in the Watson-Crick paired duplex. In this system the melting temperature T(m) of the triplex is practically the same as that of the duplex d(A12)-d(T12), at least within a complex concentration range of 0.2-4.0 microM. The melting behaviour of complexes between triplex stabilizing ligand BePI and the system hairpin duplex plus single strand supports the triplex model. Non-denaturing gel electrophoresis suggests the existence of a triplex for a system in which five of the twelve A-T*A base triads are substituted by C-G*C base triads. The recognition between any substituted Watson-Crick base pair (X-Y) in the hairpin duplex d(A4XA7C4T7YT4) and the correspondingly replaced base (Z) in the third strand d(A4ZA7) is mutually selective. All triplexes with matching base substitutions (Z = X) have nearly the same stability (T(m) values from 29 to 33.5 degrees C), whereas triplexes with non-matching substitutions (Z not equal X) show a clearly reduced stability (T(m) values from 15 to 22 degrees C) at 2microM equimolar oligonucleotide concentration. Most nucleic acid triple helices hitherto known are limited to homopurine-homopyrimidine sequences in the target duplex. A stable triplex formation is demonstrated for inhomogeneous sequences tolerating at least 50% pyrimidine content in the homologous strands. On the basis of the surprisingly similar thermodynamic parameters for duplex and triplex, and of the fact that this triplex type seems to be more stable than many other natural DNA triplexes known, and on the basis of semiempirical and molecule mechanical calculations, we postulate bridging interactions of the third strand with the two other strands in the triplex according to the recombination motif. This triplex, denoted by us 'recombination-like form', tolerates heterogeneous base sequences.     

Nucleosides and nucleotides. 218. Alternate-strand triple-helix formation by the 3'-3'-linked oligodeoxynucleotides using a purine motif

In this paper, we describe the synthesis of the 3'-3'-linked TFOs that can form the antiparallel triplexes with the duplex DNA target by reverse Hoogsteen hydrogen bonds. Stability of the alternate-strand triplexes between these TFOs and the target DNAs was investigated using the electrophoretic mobility shift assay (EMSA). It was found that the alternate-strand triplexes were significantly stabilized by linking the TFO fragments with the pentaerythritol linker. And, unlike the alternate-strand triplexes composed of the pyrimidine motif, the terminal ammonium ion of the aminobutyl-linker and the intercalator of the TFOs did not contribute to the stability of the alternate-strand triplex comprised of the purine motif. We also tested the ability of the 3'-3'-linked TFOs to inhibit cleavage of the duplex DNA target 17 by the restriction enzyme EcoT14I and found that the 3'-3'-linked TFOs 12 and 13 inhibited the cleavage by the enzyme more effectively than the unlinked decamer 8. Thus, the TFOs linked with pentaerythritol may be useful as the antigene oligonucleotide to the DNA targets, which have alternating oligopyrimidine-oligopurine sequences.     

Nuclear magnetic resonance structural studies of intramolecular purine.purine.pyrimidine DNA triplexes in solution. Base triple pairing alignments and strand direction

Recently, P.A. Beal and P.B. Dervan, expanding on earlier observations by others, have established the formation of purine.purine.pyrimidine triple helices stabilized by G.GC, A.AT and T.AT base triples where the purine-rich third strand was positioned in the major groove of the Watson-Crick duplex and anti-parallel to its purine strand. The present nuclear magnetic resonance (n.m.r.) study characterizes the base triple pairing alignments and strand direction in a 31-mer deoxyoligonucleotide that intramolecularly folds to generate a 7-mer (R/Y-)n.(R+)n(Y-)n triplex with the strands linked by two T5 loops and stabilized by potential T.AT and G.GC base triples. (R and Y stand for purine and pyrimidine, respectively, while the signs establish the strand direction.) This intramolecular triplex gives well-resolved exchangeable and non-exchangeable proton spectra with Li+ as counterion in aqueous solution. These studies establish that the T1 to C7 pyrimidine and the G8 to A14 purine strands are anti-parallel to each other and align through Watson-Crick A.T and G.C pair formation. The T15 to G21 purine-rich third strand is positioned in the major groove of this duplex and pairs through Hoogsteen alignment with the purine strand to generate T.AT and G.GC triples. Several lines of evidence establish that the thymidine and guanosine bases in the T15 to G21 purine-rich third strand adopt anti glycosidic torsion angles under conditions where this strand is aligned anti-parallel to the G8 to A14 purine strand. We have also recorded imino proton n.m.r. spectra for an (R-)n.(R+)n(Y-)n triplex stabilized by G.GC and A.AT triples through intramolecular folding of a related 31-mer deoxyoligonucleotide with Li+ as counterion. The intramolecular purine.purine.pyrimidine triplexes containing unprotonated G.GC, A.AT and T.AT triples are stable at basic pH in contrast to pyrimidine.purine.pyrimidine triplexes containing protonated C+.GC and T.AT triples, which are only stable at acidic pH.     

Recognition of nucleic acid double helices by homopyrimidine 2', 5'-linked RNA.

We have studied the effect of a 2',5'-RNA third strand backbone on the stability of triple helices with a 'pyrimidine motif' targeting the polypurine strand of duplex DNA, duplex RNA and DNA/RNA hybrids. Comparative experiments were run in parallel with DNA and the regioisomeric RNA as third strands adopting the experimental design of Roberts and Crothers. The results reveal that 2',5'-RNA is indeed able to recognize double helical DNA (DD) and DNA (purine):RNA (pyrimidine) hybrids (DR). However, when the duplex purine strand is RNA and the duplex pyrimidine strand is DNA or RNA (i.e. RD or RR), triplex formation is not observed. These results exactly parallel what is observed for DNA third strands. Based on T m data, the affinities of 2',5'-RNA and DNA third strands towards DD and DR duplexes were similar. The RNA third strand formed triplexes with all four hairpins, as previously demonstrated. In analogy to the arabinose and 2'-deoxyribose third strands, the possible C2'- endo pucker of 2',5'-linked riboses together with the lack of an alpha-2'-OH group are believed to be responsible for the selective binding of 2',5'-RNA to DD and DR duplexes, over RR and RD duplexes. These studies indicate that the use of other oligonucleotide analogues will prove extremely useful in dissecting the contributions of backbone and/or sugar puckering to the recognition of nucleic acid duplexes.     

Quantitative analysis of the ion-dependent folding stability of DNA triplexes

A DNA triplex is formed through binding of a third strand to the major groove of a duplex. Due to the high charge density of a DNA triplex, metal ions are critical for its stability. We recently developed the tightly bound ion (TBI) model for ion-nucleic acids interactions. The model accounts for the potential correlation and fluctuations of the ion distribution. We now apply the TBI model to analyze the ion dependence of the thermodynamic stability for DNA triplexes. We focus on two experimentally studied systems: a 24-base DNA triplex and a pair of interacting 14-base triplexes. Our theoretical calculations for the number of bound ions indicate that the TBI model provides improved predictions for the number of bound ions than the classical Poisson-Boltzmann (PB) equation. The improvement is more significant for a triplex, which has a higher charge density than a duplex. This is possibly due to the higher ion concentration around the triplex and hence a stronger ion correlation effect for a triplex. In addition, our analysis for the free energy landscape for a pair of 14-mer triplexes immersed in an ionic solution shows that divalent ions could induce an attractive force between the triplexes. Furthermore, we investigate how the protonated cytosines in the triplexes affect the stability of the triplex helices.     

Design and simple routes of synthesis of oligonucleotide conjugates for studies of DNA triple helix formation

A series of oligonucleotides conjugated to intercalators, as well as fluorescent and lipophilic substances, minor groove binders and photoactive molecules were synthesized for studies of their ability to form a stable triple helix. Purine-rich short double stranded DNA fragments from HIV-1 genome and pyrimidine 16-mer oligodeoxyribonucleotide were used as models. A conjugate of a dipyrido[3,2-a:2',3'-c]phenazine-ruthenium (II) complex and a triple helix-forming oligonucleotide was constructed. Upon sequence-specific duplex and triplex formation of the conjugate, the ruthenium complex becomes highly fluorescent. The attached ruthenium complex induces a stabilization of the DNA triple helix and a significant increase of the time of residence of the third strand on the duplex.     

Triplex formation by a psoralen-conjugated oligodeoxyribonucleotide containing the base analog 8-oxo-adenine.

Oligodeoxyribonucleotides containing thymidine and 8-oxo-2'-deoxyadenosine can form pyr.pur.pyr type triplexes with double-stranded DNA. Unlike triplexes whose third strands contain thymidine and deoxycytidine, the stability of these triplexes is independent of pH. We have prepared d-ps-TAAATAAATTTTTAT-L [I(A)], where A is 8-oxo-2'-deoxyadenosine, ps is 4'-hydroxymethyl-4,5',8- trimethylpsoralen and L is a 6-amino-2-(hydroxymethyl)hexyl linker. The oligomer is designed to interact with a homopurine sequence in the promoter region of the human gene coding for the 92 kDa form of collagenase type IV. Oligomer I(A) and oligomer I(C), which contains 2'-deoxycytidine in place of 8-oxo-2'-deoxycytidine, both form stable triplexes at pH 6.2, but only I(A) forms a stable triplex with a model duplex DNA target at pH 7.5, as determined by UV melting experiments. Triplex formation is stabilized by the presence of the psoralen group. Upon irradiation both I(A) and I(C) form photoadducts with the DNA target at pH 6.2, but only I(A) forms a photoadduct at pH 7.5. In these photoreactions oligomer I(A) appears to selectively form a photoadduct with a C in the purine-rich strand of the duplex target. Although a T residue is present in the pyrimidine-rich strand of the target at the duplex/triplex junction, essentially no adduct formation takes place with this strand, nor is interstrand cross-linking observed. The extent of photoadduct formation decreases with increasing temperature, behavior which is consistent with the UV melting curve of the triplex. A tetramethylrhodamine derivative of I(A) was prepared and found to cross-link less extensively than I(A) itself. Oligomer I(A) is completely resistant to hydrolysis when incubated for 24h in the presence of 10% fetal bovine serum at 37 degree C, although it is hydrolyzed by S1 nuclease. The properties of oligomer I(A) suggest that 8-oxo- containing oligomers may find utility as antigene oligonucleotide reagents.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Alternate strand recognition of double-helical DNA by (T,G)-containing oligonucleotides in the presence of a triple helix-specific ligand.

Triple helix formation requires a polypurine- polypyrimidine sequence in the target DNA. Recent works have shown that this constraint can be circumvented by using alternate strand triplex-forming oligonucleotides. We have previously demonstrated that (T,G)-containing triplex- forming oligonucleotides may adopt a parallel or an antiparallel orientation with respect to an oligopurine target, depending upon the sequence and, in particular, upon the number of 5'-GpT-3' and 5'-TpG-3' steps [Sun et al. (1991) C.R. Acad. Sci. Paris Ser III, 313, 585-590]. A single (T,G)-containing oligonucleotide can therefore interact with two oligopurine stretches which alternate on the two strands of the target DNA. The (T,G) switch oligonucleotide contains a 5'-part targeted to one of the oligopurine sequences in a parallel orientation followed by a 3'-part that adopts an antiparallel orientation with respect to the second oligopurine sequence. We show that a limitation to the stability of such a triplex may arise from the instability of the antiparallel part, composed of reverse-Hoogsteen C.GxG and T.AxT base triplets. Using DNase I footprinting and ultraviolet absorption experiments, we report that a benzo[e]pyridoindole derivative [(3-methoxy- 7H-8-methyl-11-[(3'-amino-propyl) amino] benzo[e]pyrido [4,3-b]indole (BePI)], a drug interacting more tightly with a triplex than with a duplex DNA, strongly stabilizes triplexes with reverse-Hoogsteen C.GxG and T.AxT triplets thus allowing a stabilization of the triplex-forming switch (T,G) oligonucleotide on alternating oligopurine- oligopyrimidine 5'-(Pu)14(Py)14-3' duplex sequences. These results lead to an extension of the range of oligonucleotide sequences for alternate strand recognition of duplex DNA.     

Unwinding of a DNA triple helix by the Werner and Bloom syndrome helicases

Bloom syndrome and Werner syndrome are genome instability disorders, which result from mutations in two different genes encoding helicases. Both enzymes are members of the RecQ family of helicases, have a 3' --> 5' polarity, and require a 3' single strand tail. In addition to their activity in unwinding duplex substrates, recent studies show that the two enzymes are able to unwind G2 and G4 tetraplexes, prompting speculation that failure to resolve these structures in Bloom syndrome and Werner syndrome cells may contribute to genome instability. The triple helix is another alternate DNA structure that can be formed by sequences that are widely distributed throughout the human genome. Here we show that purified Bloom and Werner helicases can unwind a DNA triple helix. The reactions are dependent on nucleoside triphosphate hydrolysis and require a free 3' tail attached to the third strand. The two enzymes unwound triplexes without requirement for a duplex extension that would form a fork at the junction of the tail and the triplex. In contrast, a duplex formed by the third strand and a complement to the triplex region was a poor substrate for both enzymes. However, the same duplex was readily unwound when a noncomplementary 5' tail was added to form a forked structure. It seems likely that structural features of the triplex mimic those of a fork and thus support efficient unwinding by the two helicases.     

Thermodynamic and kinetic effects of N3'-->P5' phosphoramidate modification on pyrimidine motif triplex DNA formation

I have investigated the thermodynamic and kinetic effects of N3'-->P5' phosphoramidate (PN) backbone modification of triplex-forming oligonucleotide (TFO) on the pyrimidine motif triplex formation between a 23-bp target duplex and a 15-mer TFO using electrophoretic mobility shift assay, UV melting, isothermal titration calorimetry, and interaction analysis system. The thermodynamic and kinetic analyses have clearly indicated that the PN modification of TFO not only significantly increased the thermal stability of the pyrimidine motif triplex at neutral pH but also increased the binding constant of the pyrimidine motif triplex formation at room temperature and neutral pH by nearly 2 orders of magnitude. The consideration of the observed thermodynamic parameters has suggested that the more rigidity of the PN TFO in the free state relative to the unmodified TFO may enable the significant increase in the binding constant of the pyrimidine motif triplex formation at neutral pH. Kinetic data have also demonstrated that the observed PN modification-mediated promotion of pyrimidine motif triplex formation at neutral pH resulted from the considerable decrease in the dissociation rate constant rather than the increase in the association rate constant. This information will present an effective approach for designing chemically modified TFO with higher binding affinity in the triplex formation under physiological conditions, which may eventually lead to progress in therapeutic applications of the antigene strategy in vivo.     

FTIR and UV spectroscopy studies of triplex formation between alpha-oligonucleotides with non-ionic phoshoramidate linkages and DNA targets

The triplexes formed by pyrimidine alpha-oligodeoxynucleotides, 15mers alpha dT(15) or 12mers alpha dCT having dimethoxyethyl (PNHdiME), morpholino (PMOR) or propyl (PNHPr) non-ionic phosphoramidate linkages with DNA duplex targets have been investigated by UV and FTIR spectroscopy. Due to the decrease in the electrostatic repulsion between partner strands of identical lengths all modifications result in triplexes more stable than those formed with unmodified phosphodiester beta-oligodeoxynucleotides (beta-ODNs). Among the alpha-ODN third strands having C and T bases and non-ionic phosphoramidate linkages (alpha dCTPN) the most efficient modification is (PNHdiME). The enhanced third strand stability of the alpha dCTPN obtained as diastereoisomeric mixtures is attenuated by the steric hindrance of the PMOR linkages or by the hydrophobicity of the PNHPr linkages. All alpha dCTPN strands form triplexes even at neutral pH. In the most favorable case (PNHdiME), we show by FTIR spectroscopy that the triplex formed at pH 7 is held by Hoogsteen T*A.T triplets and in addition by an hydrogen bond between O6 of G and C of the third strand (Tm = 30 degrees C). The detection of protonated cytosines is correlated at pH 6 with a high stabilization of the triplex (Tm = 65 degrees C). While unfavorable steric effects are overcome with alpha anomers, the limitation of the pH dependence is not completely suppressed. Different triplexes are evidenced for non pH dependent phosphoramidate alpha-thymidilate strands (alpha dT(15)PN) interacting with a target duplex of identical length. At low ionic strength and DNA concentration we observe the binding to beta dA(15) either of alpha dT(15)PN as duplex strand and beta dT(15) as third strand, or of two hydrophobic alpha dT(15)PNHPr strands. An increase in the DNA and counterion concentration stabilizes the anionic target duplex and then the alpha dT(15)PN binds as Hoogsteen third strand.     

DESIGN AND SIMPLE ROUTES OF SYNTHESIS OF OLIGONUCLEOTIDE CONJUGATES FOR STUDIES OF DNA TRIPLE HELIX FORMATION

A series of oligonucleotides conjugated to intercalators, as well as fluorescent and lipophilic substances, minor groove binders and photoactive molecules were synthesized for studies of their ability to form a stable triple helix. Purine-rich short double stranded DNA fragments from HIV-1 genome and pyrimidine 16-mer oligodeoxyribonucleotide were used as models. A conjugate of a dipyrido[3,2-a:2′,3′-c]phenazine-ruthenium (II) complex and a triple helix-forming oligonucleotide was constructed. Upon sequence-specific duplex and triplex formation of the conjugate, the ruthenium complex becomes highly fluorescent. The attached ruthenium complex induces a stabilization of the DNA triple helix and a significant increase of the time of residence of the third strand on the duplex.     

DNA-templated formation and luminescence of diphenylacetylene dimeric and trimeric complexes

We report on spectral features for two and three diphenylacetylene chromophores aligned in close proximity in aqueous solution by self assembly of attached oligonucleotide arms. Two duplex systems were examined in detail. One was formed by hybridization (Watson-Crick base pairing) of two oligonucleotide 10-mers, each containing the diphenylacetylene insert. The other was generated by self-folding of a 36-mer oligonucleotide containing two diphenylacetylene inserts. The triplex system was obtained by hybridization (Hoogsteen base pairing) of a 16-mer oligonucleotide diphenylacetylene conjugate to the folded 36-mer hairpin. Formation of duplex and triplex entities from these conjugates was demonstrated experimentally by thermal dissociation and spectroscopic studies. The UV and CD spectra for the duplex systems exhibit bands in the 300-350 nm region attributable to exciton coupling between the two chromophores, and the emission spectra show a strong band centered at 410 nm assigned to excimer fluorescence. Addition of the third strand to the hairpin duplex has little effect on the CD spectrum in the 300-350 nm region, but leads to a negative band at short wavelengths characteristic of a triplex and to a strongly enhanced band at 410 nm in the fluorescence spectrum. The third strand alone shows a broad fluorescence band at approximately 345-365 nm, but this band is virtually absent in the triplex system. A model for the triplex system is proposed in which two of the three aligned diphenylacetylenes function as a ground state dimer that on excitation gives rise to the exciton coupling observed in the UV and CD spectra and to the excimer emission observed in the fluorescence spectrum. Excitation of the third chromophore results in enhanced excimer fluorescence, as a consequence of energy transfer from the locally excited singlet of one chromophore to the ground state dimer formed by the other two chromophores.     

Relative specificities in binding of Watson-Crick base pairs by third strand residues in a DNA pyrimidine triplex motif.

The specificity of binding of Watson-Crick base pairs by third strand nucleic acid residues via triple helix formation was investigated in a DNA pyrimidine triplex motif by thermal melting experiments. The host duplex was of the type A10-X-A10: T10-Y-T10, and the third strand T10-Z-T10, giving rise to 16 possible triplexes with Z:XY inserts, 4 duplexes with the Watson-Crick base pairs (XY) and 12 duplexes with mismatch pairs (XZ), all of whose stabilities were compared. Two Z:XY combinations confirm the primary binding of AT and GC target pairs in homopurine.homopyrimidine sequences by T and C residues, respectively. All other Z:XY combinations in the T:AT environment result in triplex destabilization. While some related observations have been reported, the present experiments differ importantly in that they were performed in a T:AT nearest neighbor environment and at physiological ionic strength and pH, all of which were previously untested. The conclusions now drawn also differ substantially from those in previous studies. Thus, by evaluating the depression in Tm due to base triplet mismatches strictly in terms of third strand residue affinity and specificity for the target base pair, it is shown that none of the triplet combinations that destabilize qualify for inclusion in the third strand binding code for the pyrimidine triplex motif. Hence, none of the mismatch triplets afford a general way of circumventing the requirement for homopurine.homopyrimidine targets when third strands are predominated by pyrimidines, as others have suggested. At the same time, the applicability of third strand binding is emphasized by the finding that triplexes are equally or much more sensitive to base triplet mismatches than are Watson-Crick duplexes to base pair mismatches.     

Oligonucleotide-directed triple helix formation at adjacent oligopurine and oligopyrimidine DNA tracts by alternate strand recognition.

A significant limitation to the practical application of triplex DNA is its requirement for oligopurine tracts in target DNA sequences. The repertoire of triplex-forming sequences can potentially be expanded to adjacent blocks of purines and pyrimidines by allowing the third strand to pair with purines on alternate strands, while maintaining the required strand polarities by combining the two major classes of base triplets, Py.PuPy and Pu.PuPy. The formation of triplex DNA in this fashion requires no unusual bases or backbone linkages on the third strand. This approach has previously been demonstrated for target sequences of the type 5'-(Pu)n(Py)n-3' in intramolecular complexes. Using affinity cleaving and DNase I footprinting, we show here that intermolecular triplexes can also be formed at both 5'-(Pu)n(Py)n-3' and 5'-(Py)n(Pu)n-3' target sequences. However, triplex formation at a 5'-(Py)n(Pu)n-3' sequence occurs with lower yield. Triplex formation is disfavored, even at acid pH, when a number of contiguous C+.GC base triplets are required. These results suggest that triplex formation via alternate strand recognition at sequences made up of blocks of purines and pyrimidines may be generally feasible.     

Presence of divalent cation is not mandatory for the formation of intramolecular purine-motif triplex containing human c-jun protooncogene target

Modulation of endogenous gene function, through sequence-specific recognition of double helical DNA via oligonucleotide-directed triplex formation, is a promising approach. Compared to the formation of pyrimidine motif triplexes, which require relatively low pH, purine motif appears to be the most gifted for their stability under physiological conditions. Our previous work has demonstrated formation of magnesium-ion dependent highly stable intermolecular triplexes using a purine third strand of varied lengths, at the purine?pyrimidine (Pu?Py) targets of SIV/HIV-2 (vpx) genes (Svinarchuk, F., Monnot, M., Merle, A., Malvy, C., and Fermandjian, S. (1995) Nucleic Acids Res. 23, 3831-3836). Herein, we show that a designed intramolecular version of the 11-bp core sequence of the said targets, which also constitutes an integral, short, and symmetrical segment (G(2)AG(5)AG(2))?(C(2)TC(5)TC(2)) of human c-jun protooncogene forms a stable triplex, even in the absence of magnesium. The sequence d-C(2)TC(5)TC(2)T(5)G(2)AG(5)AG(2)T(5)G(2)AG(5)AG(2) (I-Pu) folds back twice onto itself to form an intramolecular triple helix via a double hairpin formation. The design ensures that the orientation of the intact third strand is antiparallel with respect to the oligopurine strand of the duplex. The triple helix formation has been revealed by non-denaturating gel assays, UV-thermal denaturation, and circular dichroism (CD) spectroscopy. The monophasic melting curve, recorded in the presence of sodium, represented the dissociation of intramolecular triplex to single strand in one step; however, the addition of magnesium bestowed thermal stability to the triplex. Formation of intramolecular triple helix at neutral pH in sodium, with or without magnesium cations, was also confirmed by gel electrophoresis. The triplex, mediated by sodium alone, destabilizes in the presence of 5'-C(2)TC(5)TC(2)-3', an oligonucleotide complementary to the 3'-oligopurine segments of I-Pu, whereas in the presence of magnesium the triplex remained impervious. CD spectra showed the signatures of triplex structure with A-like DNA conformation. We suggest that the possible formation of pH and magnesium-independent purine-motif triplexes at genomic Pu?Py sequences may be pertinent to gene regulation.