Regulation of coliphage f1 single-stranded DNA synthesis by a DNA-binding protein

Control of single-strand DNA synthesis in coliphage f1 was studied with the use of mutants which are temperature sensitive in gene 2, a gene essential for phage DNA replication. Cells were infected at a restrictive temperature with such a mutant, and the DNA synthesized after a shift to permissive temperature was examined. When cells were held at 42 °C for ten or more minutes after infection, only single-stranded DNA was synthesized immediately after the shift to permissive temperature. This indicated that the accumulation of a pool of double-stranded, replicative form DNA molecules is not an absolute requirement for the synthesis of single-stranded DNA, although replicative form DNA accumulation precedes single-strand synthesis in cells infected with wild-type phage. Cells infected at restrictive temperature with the mutant phage do not replicate the infecting DNA, but do accumulate a substantial amount of gene 5 protein, a DNA-binding protein essential for single-strand synthesis. It is proposed that this accumulated gene 5 protein, by binding to the limited number of replicating DNA molecules formed following the shift to the permissive temperature, acts to prevent the synthesis of double-stranded replicative form DNA, thus causing the predominant appearance of single strands. This explanation implies an intermediate common to both single and double-stranded DNA synthesis. The kinetics of gene 5 protein synthesis indicates that it is the ratio of the gene 5 protein to replicating DNA molecules which determines whether an intermediate will synthesize double or single-stranded DNA.     

DNA damage detection by an archaeal single-stranded DNA-binding protein

Archaeal DNA repair pathways are not well defined; in particular, there are no convincing candidate proteins for detection of DNA mismatches or the bulky lesions removed by excision repair pathways. Single-stranded DNA-binding proteins (SSBs) play a central role in DNA replication, recombination and repair. The crenarchaeal SSB is a monomer with a single oligonucleotide-binding fold for single-stranded DNA binding coupled to a flexible C-terminal tail reminiscent of bacterial SSB that mediates interactions with other proteins. We demonstrate that Sulfolobus solfataricus SSB can melt DNA containing a mismatch or DNA lesion specifically in vitro. We suggest that a potential role for SSB in archaea is the detection of DNA damage due to local destabilisation of the DNA double helix, followed by recruitment of specific repair proteins. Proteins interacting specifically with a single-stranded DNA:SSB complex include several known or putative DNA repair proteins and DNA helicases.     

HeLa cell single-stranded DNA-binding protein increases the accuracy of DNA synthesis by DNA polymerase alpha in vitro.

To determine whether cellular replication factors can influence the fidelity of DNA replication, the effect of HeLa cell single-stranded DNA-binding protein (SSB) on the accuracy of DNA replication by HeLa cell DNA polymerase alpha has been examined. An in vitro gap-filling assay, in which the single-stranded gap contains the supF target gene, was used to measure mutagenesis. Addition of SSB to the in vitro DNA synthesis reaction increased the accuracy of DNA polymerase alpha by 2- to 8-fold. Analysis of the products of DNA synthesis indicated that SSB reduces pausing by the polymerase at specific sites in the single-stranded supF template. Sequence analysis of the types of errors resulting from synthesis in the absence or presence of SSB reveals that, while the errors are primarily base substitutions under both conditions, SSB reduces the number of errors found at 3 hotspots in the supF gene. Thus, a cellular replication factor (SSB) can influence the fidelity of a mammalian DNA polymerase in vitro, suggesting that the high accuracy of cellular DNA replication may be determined in part by the interaction between replication factors, DNA polymerase and the DNA template in the replication complex.     

The process of displacing the single-stranded DNA-binding protein from single-stranded DNA by RecO and RecR proteins

The regions of single-stranded (ss) DNA that result from DNA damage are immediately coated by the ssDNA-binding protein (SSB). RecF pathway proteins facilitate the displacement of SSB from ssDNA, allowing the RecA protein to form protein filaments on the ssDNA region, which facilitates the process of recombinational DNA repair. In this study, we examined the mechanism of SSB displacement from ssDNA using purified Thermus thermophilus RecF pathway proteins. To date, RecO and RecR are thought to act as the RecOR complex. However, our results indicate that RecO and RecR have distinct functions. We found that RecR binds both RecF and RecO, and that RecO binds RecR, SSB and ssDNA. The electron microscopic studies indicated that SSB is displaced from ssDNA by RecO. In addition, pull-down assays indicated that the displaced SSB still remains indirectly attached to ssDNA through its interaction with RecO in the RecO-ssDNA complex. In the presence of both SSB and RecO, the ssDNA-dependent ATPase activity of RecA was inhibited, but was restored by the addition of RecR. Interestingly, the interaction of RecR with RecO affected the ssDNA-binding properties of RecO. These results suggest a model of SSB displacement from the ssDNA by RecF pathway proteins.     

High-affinity RNA binding by a hyperthermophilic single-stranded DNA-binding protein

Single-stranded DNA-binding proteins (SSBs), including replication protein A (RPA) in eukaryotes, play a central role in DNA replication, recombination, and repair. SSBs utilise an oligonucleotide/oligosaccharide-binding (OB) fold domain to bind DNA, and typically oligomerise in solution to bring multiple OB fold domains together in the functional SSB. SSBs from hyperthermophilic crenarchaea, such as Sulfolobus solfataricus, have an unusual structure with a single OB fold coupled to a flexible C-terminal tail. The OB fold resembles those in RPA, whilst the tail is reminiscent of bacterial SSBs and mediates interaction with other proteins. One paradigm in the field is that SSBs bind specifically to ssDNA and much less strongly to RNA, ensuring that their functions are restricted to DNA metabolism. Here, we use a combination of biochemical and biophysical approaches to demonstrate that the binding properties of S. solfataricus SSB are essentially identical for ssDNA and ssRNA. These features may represent an adaptation to a hyperthermophilic lifestyle, where DNA and RNA damage is a more frequent event.

     

Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.     

Interaction between Escherichia coli DNA polymerase IV and single-stranded DNA-binding protein is required for DNA synthesis on SSB-coated DNA

DNA polymerase IV (Pol IV) is one of three translesion polymerases in Escherichia coli. A mass spectrometry study revealed that single-stranded DNA-binding protein (SSB) in lysates prepared from exponentially-growing cells has a strong affinity for column-immobilized Pol IV. We found that purified SSB binds directly to Pol IV in a pull-down assay, whereas SSBΔC8, a mutant protein lacking the C-terminal tail, failed to interact with Pol IV. These results show that the interaction between Pol IV and SSB is mediated by the C-terminal tail of SSB. When polymerase activity was tested on an SSBΔC8-coated template, we observed a strong inhibition of Pol IV activity. Competition experiments using a synthetic peptide containing the amino acid sequence of SSB tail revealed that the chain-elongating capacity of Pol IV was greatly impaired when the interaction between Pol IV and SSB tail was inhibited. These results demonstrate that Pol IV requires the interaction with the C-terminal tail of SSB to replicate DNA efficiently when the template ssDNA is covered with SSB. We speculate that at the primer/template junction, Pol IV interacts with the tail of the nearest SSB tetramer on the template, and that this interaction allows the polymerase to travel along the template while disassembling SSB.     

Mechanisms of single-stranded DNA-binding protein functioning in cellular DNA metabolism

This review deals with analysis of mechanisms involved in coordination of DNA replication and repair by SSB proteins; characteristics of eukaryotic, prokaryotic, and archaeal SSB proteins are considered, which made it possible to distinguish general mechanisms specific for functioning of proteins from organisms of different life domains. Mechanisms of SSB protein interactions with DNA during metabolism of the latter are studied; structural organization of the SSB protein complexes with DNA, as well as structural and functional peculiarities of different SSB proteins are analyzed.     

Equilibrium binding of single-stranded DNA with herpes simplex virus type I-coded single-stranded DNA-binding protein, ICP8

We have carried out solution equilibrium binding studies of ICP8, the major single-stranded DNA (ssDNA)-binding protein of herpes simplex virus type I, in order to determine the thermodynamic parameters for its interaction with ssDNA. Fluorescence anisotropy measurements of a 5'-fluorescein-labeled 32-mer oligonucleotide revealed that ICP8 formed a nucleoprotein filament on ssDNA with a binding site size of 10 nucleotides/ICP8 monomer, an association constant at 25 degrees C, K = 0.55 +/- 0.05 x 10(6) M(-1), and a cooperativity parameter, omega = 15 +/- 3. The equilibrium constant was largely independent of salt, deltalog(Komega)/deltalog([NaCl]) = -2.4 +/- 0.4. Comparison of these parameters with other ssDNA-binding proteins showed that ICP8 reacted with an unusual mechanism characterized by low cooperativity and weak binding. In addition, the reaction product was more stable at high salt concentrations, and fluorescence enhancement of etheno-ssDNA by ICP8 was higher than for other ssDNA-binding proteins. These last two characteristics are also found for protein-DNA complexes formed by recombinases in their active conformation. Given the proposed role of ICP8 in promoting strand transfer reactions, they suggest that ICP8 and recombinase proteins may catalyze homologous recombination by a similar mechanism.     

Replication protein A as a major eukaryotic single-stranded DNA-binding protein and its role in DNA repair

Replication protein A (RPA) is a key regulator of eukaryotic DNA metabolism. RPA is a highly conserved heterotrimeric protein and contains multiple oligonucleotide/oligosaccharide-binding folds. The major RPA function is binding to single-stranded DNA (ssDNA) intermediates forming in DNA replication, repair, and recombination. Although binding ssDNA with high affinity, RPA can rapidly diffuse along ssDNA and destabilizes the DNA secondary structure. A highly dynamic RPA binding to ssDNA allows other proteins to access ssDNA and to displace RPA from the RPA–ssDNA complex. As has been shown recently, RPA in complex with ssDNA is posttranslationally modified in response to DNA damage. These modifications modulate the RPA interactions with its protein partners and control the DNA damage signaling pathways. The review considers up-to-date data on the RPA function as an active coordinator of ssDNA intermediate processing within DNA metabolic pathways, DNA repair in particular.     

Functional interactions of mitochondrial DNA polymerase and single-stranded DNA-binding protein. Template-primer DNA binding and initiation and elongation of DNA strand synthesis.

Functional interactions between mitochondrial DNA polymerase (pol gamma) and mitochondrial single-stranded DNA-binding protein (mtSSB) from Drosophila embryos have been evaluated with regard to the overall activity of pol gamma and in partial reactions involving template-primer binding and initiation and idling in DNA strand synthesis. Both the 5' --> 3' DNA polymerase and 3' --> 5' exonuclease in pol gamma are stimulated 15-20-fold on oligonucleotide-primed single-stranded DNA by native and recombinant forms of mtSSB. That the extent of stimulation is similar for both enzyme activities over a broad range of KCl concentrations suggests their functional coordination and a similar mechanism of stimulation by mtSSB. At the same time, the high mispair specificity of pol gamma in exonucleolytic hydrolysis is maintained, indicating that enhancement of pol gamma catalytic efficiency is likely not accompanied by increased nucleotide turnover. DNase I footprinting of pol gamma.DNA complexes and initial rate measurements show that mtSSB enhances primer recognition and binding and stimulates 30-fold the rate of initiation of DNA strands. Dissociation studies show that productive complexes of the native pol gamma heterodimer with template-primer DNA are formed and remain stable in the absence of replication accessory proteins.     

A single-stranded DNA-binding protein of bacteriophage T7 defective in DNA annealing

The annealing of complementary strands of DNA is a vital step during the process of DNA replication, recombination, and repair. In bacteriophage T7-infected cells, the product of viral gene 2.5, a single-stranded DNA-binding protein, performs this function. We have identified a single amino acid residue in gene 2.5 protein, arginine 82, that is critical for its DNA annealing activity. Expression of gene 2.5 harboring this mutation does not complement the growth of a T7 bacteriophage lacking gene 2.5. Purified gene 2.5 protein-R82C binds single-stranded DNA with a greater affinity than the wild-type protein but does not mediate annealing of complementary strands of DNA. A carboxyl-terminal-deleted protein, gene 2.5 protein-Delta26C, binds even more tightly to single-stranded DNA than does gene 2.5 protein-R82C, but it anneals homologous strands of DNA as well as does the wild-type protein. The altered protein forms dimers and interacts with T7 DNA polymerase comparable with the wild-type protein. Gene 2.5 protein-R82C condenses single-stranded M13 DNA in a manner similar to wild-type protein when viewed by electron microscopy.     

Mechanism of stimulation of DNA replication by bacteriophage phi 29 single-stranded DNA-binding protein p5

Protein p5 is a Bacillus subtilis phage phi 29-encoded protein required for phi 29 DNA replication in vivo. Protein p5 has single-stranded DNA binding (SSB) capacity and stimulates in vitro DNA replication severalfold when phi 29 DNA polymerase is used to replicate either the natural phi 29 DNA template or primed M13 single-stranded DNA (ssDNA). Furthermore, other SSB proteins, including Escherichia coli SSB, T4 gp32, adenovirus DNA-binding protein, and human replication factor A, can functionally substitute for protein p5. The stimulatory effect of phi 29 protein p5 is not due to an increase of the DNA replication rate. When both phi 29 DNA template and M13 competitor ssDNA are added simultaneously to the replication reaction, phi 29 DNA replication is strongly inhibited. This inhibition is fully overcome by adding protein p5, suggesting that protein p5-coated M13 ssDNA is no longer able to compete for replication factors, probably phi 29 DNA polymerase, which has a strong affinity for ssDNA. Electron microscopy demonstrates that protein p5 binds to M13 ssDNA forming saturated complexes with a smoothly contoured appearance and producing a 2-fold reduction of the DNA length. Protein p5 also binds to ssDNA in the phi 29 replicative intermediates produced in vitro, which are similar in structure to those observed in vivo. Our results strongly suggest that phi 29 protein p5 is the phi 29 SSB protein active during phi 29 DNA replication.     

Physiological and biochemical defects in functional interactions of mitochondrial DNA polymerase and DNA-binding mutants of single-stranded DNA-binding protein

Functional interactions between mitochondrial DNA polymerase (pol gamma) and mitochondrial single-stranded DNA-binding protein (mtSSB) from Drosophila embryos greatly enhance the overall activity of pol gamma by increasing primer recognition and binding and stimulating the rate of initiation of DNA strands (Farr, C. L., Wang, Y., and Kaguni, L. S. (1999) J. Biol. Chem. 274, 14779-14785). We show here that DNA-binding mutants of mtSSB are defective in stimulation of DNA synthesis by pol gamma. RNAi knock-down of mtSSB reduces expression to <5% of its normal level in Schneider cells, resulting in growth defects and in the depletion of mitochondrial DNA (mtDNA). Overexpression of mtSSB restores cell growth rate and the copy number of mtDNA, whereas overexpression of a DNA-binding and functionally impaired form of mtSSB neither rescues the cell growth defect nor the mtDNA depletion phenotype. Further development of Drosophila animal models, in which induced mtDNA depletion is manipulated by controlling exogenous expression of wild-type or mutant forms, will offer new insight into the mechanism and progression of human mtDNA depletion syndromes and possible intervention schemes.     

A dimeric mutant of the homotetrameric single-stranded DNA binding protein from Escherichia coli

A single amino acid substitution (Y78R) at the dimer-dimer interface of homotetrameric single stranded DNA binding protein from E. coli (EcoSSB) renders the protein a stable dimer. This dimer can bind single-stranded DNA albeit with greatly reduced affinity. In vivo this dimeric SSB cannot replace homotetrameric EcoSSB. Amino acid changes at the rim of the dimer-dimer interface nearby (Q76K, Q76E) show an electrostatic interaction between a charged amino acid at position 76 and bound nucleic acid. In conclusion, nucleic acid binding to homotetrameric SSB must take place across both dimers to achieve functionally correct binding.     

Dual functions of single-stranded DNA-binding protein in helicase loading at the bacteriophage T4 DNA replication fork

Semi-conservative DNA synthesis reactions catalyzed by the bacteriophage T4 DNA polymerase holoenzyme are initiated by a strand displacement mechanism requiring gp32, the T4 single-stranded DNA (ssDNA)-binding protein, to sequester the displaced strand. After initiation, DNA helicase acquisition by the nascent replication fork leads to a dramatic increase in the rate and processivity of leading strand DNA synthesis. In vitro studies have established that either of two T4-encoded DNA helicases, gp41 or dda, is capable of stimulating strand displacement synthesis. The acquisition of either helicase by the nascent replication fork is modulated by other protein components of the fork including gp32 and, in the case of the gp41 helicase, its mediator/loading protein gp59. Here, we examine the relationships between gp32 and the gp41/gp59 and dda helicase systems, respectively, during T4 replication using altered forms of gp32 defective in either protein-protein or protein-ssDNA interactions. We show that optimal stimulation of DNA synthesis by gp41/gp59 helicase requires gp32-gp59 interactions and is strongly dependent on the stability of ssDNA binding by gp32. Fluorescence assays demonstrate that gp59 binds stoichiometrically to forked DNA molecules; however, gp59-forked DNA complexes are destabilized via protein-protein interactions with the C-terminal "A-domain" fragment of gp32. These and previously published results suggest a model in which a mobile gp59-gp32 cluster bound to lagging strand ssDNA is the target for gp41 helicase assembly. In contrast, stimulation of DNA synthesis by dda helicase requires direct gp32-dda protein-protein interactions and is relatively unaffected by mutations in gp32 that destabilize its ssDNA binding activity. The latter data support a model in which protein-protein interactions with gp32 maintain dda in a proper active state for translocation at the replication fork. The relationship between dda and gp32 proteins in T4 replication appears similar to the relationship observed between the UL9 helicase and ICP8 ssDNA-binding protein in herpesvirus replication.