Novel sequencing strategy for repetitive DNA in a Drosophila BAC clone reveals that the centromeric region of the Y chromosome evolved from a telomere

The centromeric and telomeric heterochromatin of eukaryotic chromosomes is mainly composed of middle-repetitive elements, such as transposable elements and tandemly repeated DNA sequences. Because of this repetitive nature, Whole Genome Shotgun Projects have failed in sequencing these regions. We describe a novel kind of transposon-based approach for sequencing highly repetitive DNA sequences in BAC clones. The key to this strategy relies on physical mapping the precise position of the transposon insertion, which enables the correct assembly of the repeated DNA. We have applied this strategy to a clone from the centromeric region of the Y chromosome of Drosophila melanogaster. The analysis of the complete sequence of this clone has allowed us to prove that this centromeric region evolved from a telomere, possibly after a pericentric inversion of an ancestral telocentric chromosome. Our results confirm that the use of transposon-mediated sequencing, including positional mapping information, improves current finishing strategies. The strategy we describe could be a universal approach to resolving the heterochromatic regions of eukaryotic genomes.     

Organization and evolution of alpha satellite DNA from human chromosome 11

The human alpha satellite repetitive DNA family is organized as distinct chromosomal subsets located at the centromeric regions of each human chromosome. Here, we describe a subset of the alpha satellite which is localized to human chromosome 11. The principal unit of repetition of this alpha satellite subset is an 850 bp XbaI fragment composed of five tandem diverged alphoid monomers, each 171 bp in length. The pentamer repeat units are themselves tandemly reiterated, present in 500 copies per chromosome 11. In filter hybridization experiments, the Alpha 11 probes are specific for the centromeric alpha satellite sequences of human chromosome 11. The complete nucleotide sequences of two independent copies of the XbaI pentamer reveal a pentameric configuration shared with the alphoid repeats of chromosomes 17 and X, consistent with the existence of an ancestral pentameric repeat common to the centromeric arrays of at least these three human chromosomes.     

Genomic organization of alpha satellite DNA on human chromosome 7: evidence for two distinct alphoid domains on a single chromosome.

A complete understanding of chromosomal disjunction during mitosis and meiosis in complex genomes such as the human genome awaits detailed characterization of both the molecular structure and genetic behavior of the centromeric regions of chromosomes. Such analyses in turn require knowledge of the organization and nature of DNA sequences associated with centromeres. The most prominent class of centromeric DNA sequences in the human genome is the alpha satellite family of tandemly repeated DNA, which is organized as distinct chromosomal subsets. Each subset is characterized by a particular multimeric higher-order repeat unit consisting of tandemly reiterated, diverged alpha satellite monomers of approximately 171 base pairs. The higher-order repeat units are themselves tandemly reiterated and represent the most recently amplified or fixed alphoid sequences. We present evidence that there are at least two independent domains of alpha satellite DNA on chromosome 7, each characterized by their own distinct higher-order repeat structure. We determined the complete nucleotide sequences of a 6-monomer higher-order repeat unit, which is present in approximately 500 copies per chromosome 7, as well as those of a less-abundant (approximately 10 copies) 16-monomer higher-order repeat unit. Sequence analysis indicated that these repeats are evolutionarily distinct. Genomic hybridization experiments established that each is maintained in relatively homogeneous tandem arrays with no detectable interspersion. We propose mechanisms by which multiple unrelated higher-order repeat domains may be formed and maintained within a single chromosomal subset.     

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.     

New evidence for tandem chromosome fusions in the karyotypic evolution of Asian muntjacs

A clone of highly repetitive DNA, designated C5, was isolated from DNA of female Chinese muntjac cells. The nucleotide sequence of this clone is 80%–85% homologous to that of the satellite IA clone and other highly repetitive DNA clones previously obtained from the Indian muntjac. Using C5 as a probe for in situ hybridizations to chromosome preparations of cells of both the Chinese and Indian muntjacs, we were able to show that these repeated sequences occur in centromeric heterochromatin of the chromosomes of both Chinese and indian muntjac species. More significantly, non-random clusters of hybridization signals were detected on the arms of chromosomes of the Indian muntjac. These latter hybridization sites are postulated to be regions of interstitial heterochromatin and could be the remnants of centromeric heterochromatin from ancestral Chinese muntjac chromosomes. Our observations provide new supportive evidence for the tandem chromosome fusion theory that has been proposed for the evolution of the Indian muntjac karyotype.by P.B. Moens     

Structure, organization, and sequence of alpha satellite DNA from human chromosome 17: evidence for evolution by unequal crossing-over and an ancestral pentamer repeat shared with the human X chromosome.

The centromeric regions of all human chromosomes are characterized by distinct subsets of a diverse tandemly repeated DNA family, alpha satellite. On human chromosome 17, the predominant form of alpha satellite is a 2.7-kilobase-pair higher-order repeat unit consisting of 16 alphoid monomers. We present the complete nucleotide sequence of the 16-monomer repeat, which is present in 500 to 1,000 copies per chromosome 17, as well as that of a less abundant 15-monomer repeat, also from chromosome 17. These repeat units were approximately 98% identical in sequence, differing by the exclusion of precisely 1 monomer from the 15-monomer repeat. Homologous unequal crossing-over is suggested as a probable mechanism by which the different repeat lengths on chromosome 17 were generated, and the putative site of such a recombination event is identified. The monomer organization of the chromosome 17 higher-order repeat unit is based, in part, on tandemly repeated pentamers. A similar pentameric suborganization has been previously demonstrated for alpha satellite of the human X chromosome. Despite the organizational similarities, substantial sequence divergence distinguishes these subsets. Hybridization experiments indicate that the chromosome 17 and X subsets are more similar to each other than to the subsets found on several other human chromosomes. We suggest that the chromosome 17 and X alpha satellite subsets may be related components of a larger alphoid subfamily which have evolved from a common ancestral repeat into the contemporary chromosome-specific subsets.     

Isolation and identification of a novel tandemly repeated DNA sequence in the centromeric region of human chromosome 8

EcoRI subclones, designated as 50E1 and 50E4, were independently obtained from a cosmid clone previously mapped to the centromeric region of human chromosome 8. Southern blot hybridization analyses suggested that both subclones contain repetitive DNA sequences different from the chromosome 8 specific alphoid DNA. DNA sequence analysis of the 704 bp insert of 50E1 and the 1, 962 bp insert of 50E4 revealed that both inserts contained tandemly repeated units of 220 bp. Fluorescence in situ hybridization studies confirmed these two subclones to be specifically located on the centromeric region of chromosome 8. A 220 bp consensus sequence, derived from nine monomeric repeats, showed no significant homology to alphoid consensus sequences or to other currently known human centromeric DNA sequence. Furthermore, no significant homology was found with any other DNA sequence deposited in the EMBL or GenBank databases, indicating that this chromosome 8 specific repetitive DNA sequence is novel. From slot blot experiments it was estimated that 0.013% of the human genome comprises 1,750 of these monomeric repeats, residing on the centromeric region of chromosome 8 in tandem array(s).     

Isolation and chromosomal localization of a germ line-specific highly repetitive DNA family in Acricotopus lucidus (Diptera, Chironomidae)

. In the chironomid Acricotopus lucidus, parts of the genome, the germ line-limited chromosomes, are eliminated from the future soma cells during early cleavage divisions. A highly repetitive, germ line-specific DNA sequence family was isolated, cloned and sequenced. The monomers of the tandemly repeated sequences range in size from 175 to 184 bp. Analysis of sequence variation allowed the further classification of the germ line-restricted repetitive DNA into two related subfamilies, A and B. Fluorescence in situ hybridization to gonial metaphases demonstrated that the sequence family is highly specific for the paracentromeric heterochromatin of the germ line-limited chromosomes. Restriction analysis of genomic soma DNA of A. lucidus revealed another tandem repetitive DNA sequence family with monomers of about 175 bp in length. These DNA elements are found only in the centromeric regions of all soma chromosomes and one exceptional germ line-limited chromosome by in situ hybridization to polytene soma chromosomes and gonial metaphase chromosomes. The sequences described here may be involved in recognition, distinction and behavior of soma and germ line-limited chromosomes during the complex chromosome cycle in A. lucidus and may be useful for the genetic and cytological analysis of the processes of elimination of the germ line-limited chromosomes in the soma and germ line. Received: 12 April 1997; in revised form 26 June 1997 / Accepted: 29 June 1997     

Study of alpha-satellite DNA in cosmid libraries, specific for chromosomes 13, 21, and 22, using fluorescence in situ hybridization

Fluorescent in situ hybridization (FISH) was employed in mapping the alpha-satellite DNA that was revealed in the cosmid libraries specific for human chromosomes 13, 21, and 22. In total, 131 clones were revealed. They contained various elements of centromeric alphoid DNA sequences of acrocentric chromosomes, including those located close to SINEs, LINEs, and classical satellite sequences. The heterochromatin of acrocentric chromosomes was shown to contain two different groups of alphoid sequences: (1) those immediately adjacent to the centromeric regions (alpha 13-1, alpha 21-1, and alpha 22-1 loci) and (2) those located in the short arm of acrocentric chromosomes (alpha 13-2, alpha 21-2, and alpha 22-2 loci). Alphoid DNA sequences from the alpha 13-2, alpha 21-2, and alpha 22-2 loci are apparently not involved in the formation of centromeres and are absent from mitotically stable marker chromosomes with a deleted short arm. Robertsonian translocations t(13q; 21q) and t(14q; 22q), and chromosome 21p-. The heterochromatic regions of chromosomes 13, 21, and 22 were also shown to contain relatively chromosome-specific repetitive sequences of various alphoid DNA families, whose numerous copies occur in other chromosomes. Pools of centromeric alphoid cosmids can be of use in further studies of the structural and functional properties of heterochromatic DNA and the identification of centromeric sequences. Moreover, these clones can be employed in high-resolution mapping and in sequencing the heterochromatic regions of the human genome. The detailed FISH analysis of numerous alphoid cosmid clones allowed the identification of several new, highly specific DNA probes of molecular cytogenetic studies--in particular, the interphase and metaphase analyses of chromosomes 2, 9, 11, 14, 15, 16, 18, 20, 21-13, 22-14, and X.     

Characterisation of a boundary between satellite III and alphoid sequences on human chromosome 10.

Alphoid and satellite III sequences are arranged as large tandem arrays in the centromeric regions of human chromosomes. Several recent studies using in situ hybridisation to investigate the relative positions of these sequences have shown that they occupy adjacent but non-overlapping domains in metaphase chromosomes. We have analysed the DNA sequence at the junction between alphoid and satellite III sequences in a cosmid previously mapped to chromosome 10. The alphoid sequence consists of tandemly arranged dimers which are distinct from the known chromosome 10-specific alphoid family. Polymerase chain reaction experiments confirm the integrity of the sequence data. These results, together with pulsed field gel electrophoresis data place the boundary between alphoid and satellite III sequences in the mapping interval 10 centromere-10q11.2. The sequence data shows that these repetitive sequences are separated by a partial L1 interspersed repeat sequence less than 500bp in length. The arrangement of the junction suggests that a recombination event has brought these sequences into close proximity.     

Chromosome-specific alpha satellite DNA: nucleotide sequence analysis of the 2.0 kilobasepair repeat from the human X chromosome.

The pericentromeric region of the human X chromosome is characterized by a tandemly repeated family of 2.0 kilobasepair (kb) DNA fragments, initially revealed by cleavage of human DNA with the restriction enzyme BamHI. We report here the complete nucleotide sequence of a cloned member of the repeat family and establish that this X-linked DNA family consists entirely of alpha satellite DNA. Our data indicate that the 2.0 kb repeat consists of twelve alpha satellite monomers arranged in imperfect, direct repeats. Each of the alpha X monomers is approximately 171 basepairs (bp) in length and is 60-75% identical in sequence to previously described primate alpha satellite DNAs. The twelve alpha X monomers are 65-85% identical in sequence to each other and are organized as two adjacent, related blocks of five monomers, plus an additional two monomers also related to monomers within the pentamer blocks. Partial nucleotide sequence of a second, independent copy of the 2.0 kb BamHI fragment established that the 2.0 kb repeat is, in fact, the unit of amplification on the X. Comparison of the sequences of the twelve alpha X monomers allowed derivation of a 171 bp consensus sequence for alpha satellite DNA on the human X chromosome. These sequence data, combined with the results of filter hybridization experiments of total human DNA and X chromosome DNA, using subregions within the 2.0 kb repeat as probes, provide strong support for the hypothesis that individual human chromosomes are characterized by different alpha satellite families, defined both by restriction enzyme periodicity and by chromosome-specific primary sequence.     

A satellite DNA containing CENP-B box-like motifs is present in the antarctic scallop Adamussium colbecki

The DNA of the Antarctic scallop Adamussium colbecki was found to contain a highly repeated sequence identifiable upon restriction with endonuclease BglII. The monomeric unit - denominated pACS (about 170bp long) - was cloned. Southern blot hybridization yielded a ladder-like banding pattern, indicating that the repeated elements are tandemly arranged in the genome and therefore represent a sequence of satellite DNA.Sequence analysis of five different clones revealed the presence of various subfamilies, some of which showed a high degree of divergence. In each clone, regions homologous to the mammalian CENP-B box were observed. A region homologous to the CDEIII centromeric sequence of yeast was also found in one of the clones. These observations suggest a relationship of the pACS family to the centromeric area in A. colbecki.     

Direct visualization of the genomic distribution and organization of two cervid centromeric satellite DNA families

Several repetitive DNA fragments were generated from PCR amplifications of caribou DNA using primer sequences derived from the white-tailed deer satellite II DNA clone OvDII. Two fragments, designated Rt-0.5 and Rt-0.7, were sequenced and found to have 96% sequence similarity. These caribou clones also had 85% sequence similarity with OvDII. Multiple-colored fluorescence in situ hybridization (FISH) studies with satellite I and satellite II DNA probes to caribou metaphase chromosomes and extended chromatin fibers provided direct visualization of the genomic organization of these two satellite DNA families, with the following findings: (1) Cervid satellite I DNA is confined to the centromeric regions of the acrocentric autosomes, whereas satellite II DNA is found at the centromeric regions of all chromosomes except for the Y. (2) For most acrocentric chromosomes, the satellite I signal appeared to be medially located at the primary constriction, in contrast to that of satellite II, which appeared to be oriented toward the lateral sides as two separate fluorescent dots. (3) The satellite II clone Rt-0.7 appeared to be enriched in the centromeric region of the caribou X chromosome, a pair of biarmed autosomes, and a number of other acrocentric autosomes. (4) Fiber-FISH demonstrated that the satellite I and satellite II arrays were juxtaposed. On highly extended chromatin fibers, the total length of the hybridization signals for the two satellite DNA arrays often reached 300-400 microm. The length of a given satellite II array usually reached 200 microm, corresponding to 2 x 10(3) kb of DNA in a given centromere.     

Whole-genome fractionation rapidly purifies DNA from centromeric regions

The condensed centromeric regions of higher eukaryotic chromosomes contain satellite sequences, transposons and retroelements, as well as transcribed genes that perform a variety of functions. These chromosomal domains nucleate kinetochores, mediate sister chromatid cohesion and inhibit recombination, yet their characterization has often lagged behind that of chromosome arms. Here, we describe a whole-genome fractionation technique that rapidly identifies bacterial artificial chromosome (BAC) clones derived from plant centromeric regions. This approach, which relies on hybridization of methylated genomic DNA, revealed BACs that correspond to the genetically mapped and sequenced Arabidopsis thaliana centromeric regions. Extending this method to other species in the Brassicaceae family identified centromere-linked clones and provided genome-wide estimates of methylated DNA abundance. Sequencing these clones will elucidate the changes that occur during plant centromere evolution. This genomic fractionation technique could identify centromeric DNA in genomes with similar methylation and repetitive DNA content, including those from crops and mammals.     

Chromosome-specific organization of human alpha satellite DNA

Restriction endonuclease analysis of human genomic DNA has previously revealed several prominent repeated DNA families defined by regularly spaced enzyme recognition sites. One of these families, termed alpha satellite DNA, was originally identified as tandemly repeated 340- or 680-base pair (bp) EcoRI fragments that hybridize to the centromeric regions of human chromosomes. We have investigated the molecular organization of alpha satellite DNA on individual human chromosomes by filter hybridization and in situ hybridization analysis of human DNA and DNA from rodent/human somatic cell hybrids, each containing only a single human chromosome. We used as probes a cloned 340-bp EcoRI alpha satellite fragment and a cloned alpha satellite-containing 2.0-kilobase pair (kbp) BamHI fragment from the pericentromeric region of the human X chromosome. In each somatic cell hybrid DNA, the two probes hybridized to a distinct subset of DNA fragments detected in total human genomic DNA. Thus, alpha satellite DNA on each of the human chromosomes examined--the X and Y chromosomes and autosomes 3, 4, and 21--is organized in a specific and limited number of molecular domains. The data indicate that subsets of alpha satellite DNA on individual chromosomes differ from one another, both with respect to restriction enzyme periodicities and with respect to their degree of sequence relatedness. The results suggest that some, and perhaps many, human chromosomes are characterized by a specific organization of alpha satellite DNA at their centromeres and that, under appropriate experimental conditions, cloned representatives of alpha satellite subfamilies may serve as a new class of chromosome-specific DNA markers.     

PCR amplification of tandemly repeated DNA: analysis of intra- and interchromosomal sequence variation and homologous unequal crossing-over in human alpha satellite DNA.

Tandemly repeated DNA can comprise several percent of total genomic DNA in complex organisms and, in some instances, may play a role in chromosome structure or function. Alpha satellite DNA is the major family of tandemly repeated DNA found at the centromeres of all human and primate chromosomes. Each centromere is characterized by a large contiguous array of up to several thousand kb which can contain several thousand highly homogeneous repeat units. By using a novel application of the polymerase chain reaction (repPCR), we are able to amplify a representative sampling of multiple repetitive units simultaneously, allowing rapid analysis of chromosomal subsets. Direct sequence analysis of repPCR amplified alpha satellite from chromosomes 17 and X reveals positions of sequence heterogeneity as two bands at a single nucleotide position on a sequencing ladder. The use of TdT in the sequencing reactions greatly reduces the background associated with polymerase pauses and stops, allowing visualization of heterogeneous bases found in as little as 10% of the repeat units. Confirmation of these heterogeneous positions was obtained by comparison to the sequence of multiple individual cloned copies obtained both by PCR and non-PCR based methods. PCR amplification of alpha satellite can also reveal multiple repeat units which differ in size. Analysis of repPCR products from chromosome 17 and X allows rapid determination of the molecular basis of these repeat unit length variants, which appear to be a result of unequal crossing-over. The application of repPCR to the study of tandemly repeated DNA should allow in-depth analysis of intra- and interchromosomal variation and unequal crossing-over, thus providing insight into the biology and genetics of these large families of DNA.     

Novel repeated DNA sequences in safflower (Carthamus tinctorius L.) (Asteraceae): cloning, sequencing, and physical mapping by fluorescence in situ hybridization

Two novel repetitive DNA sequences, pCtKpnI-1 and pCtKpnI-2, were isolated from Carthamus tinctorius (2n = 2x = 24) and cloned. Both represent tandemly repeated sequences. The pCtKpnI-1 and pCtKpnI-2 clones constitute repeat units of 343-345 bp and 367 bp, respectively, with 63% sequence heterogeneity between the two. Fluorescence in situ hybridization (FISH) was employed on metaphase chromosomes of C. tinctorius using, simultaneously, pCtKpnI-1 and pCtKpnI-2 repeated sequences. The pCtKpnI-1 sequence was found to be exclusively localized at subtelomeric regions on most of the chromosomes. On the other hand, sequence of the pCtKpnI-2 clone was distributed on two nucleolar and one nonnucleolar chromosome pairs. The satellite, and the intervening chromosome segment between the primary and secondary constrictions, in the two nucleolar chromosome pairs were wholly constituted by pCtKpnI-2 repeated sequence. The pCtKpnI-2 repeated sequence, showing partial homology to intergenic spacer (IGS) of 18S-25S ribosomal RNA genes of an Asteraceae taxon (Centaurea stoebe), and the 18S-25S rRNA gene clusters were located at independent, but juxtaposed sites in the nucleolar chromosomes. Variability in the number, size, and location of the two repeated sequences provided identification of most of the chromosomes in the otherwise not too distinctive homologues within the complement. This article reports the start of a molecular cytogenetics program targeting the genome of safflower, a major world oil crop about whose genetics very little is known.     

Alpha satellite DNA in neotropical primates (Platyrrhini)

The alpha satellite DNA of Old World (catarhine) primates usually consists of similar, but not identical, ca. 170 bp sequences repeated tandemly hundreds to thousands of times. The 170 bp monomeric repeats are components of higher-order repeats, many of which are chromosome specific. Alpha satellites are found exclusively in centromeric regions where they appear to play a role in centromere function. We have found that alpha satellite DNA in neotropical (New World; platyrrhine) primates is very similar to its Old World counterpart: it consists of divergent ca. 170 bp subsequences that are arranged in tandem arrays with a ca. 340 bp periodicity. New and Old World alpha satellites share about 64% sequence identity overall, and contain several short sequence motifs that appear to be highly conserved. One exception to the tandemly arrayed 340 bp motif has been found: the major alpha satellite array in Chiropotes satanas (black bearded saki) has a 539 bp repeat unit that consists of a 338 bp dimer together with a duplication of 33 bp of the first monomeric unit and 168 bp of the second monomeric unit.     

The organization of the mouse satellite DNA at centromeres

The mouse genome contains a major and a minor satellite DNA family of repetitive DNA sequences. The use of 5-azacytidine has allowed us to demonstrate that these satellite DNAs are organized in two separate domains at the centromeres of mouse chromosomes. The minor satellite is closer to the short arms of the acrocentric chromosomes than the major satellite. The major satellite is farther away, flanking the minor satellite and adjacent to the euchromatic long arm of each mouse chromosome. At the level of resolution afforded by the in situ hybridization technique it would appear that the organization of the centromeric domain of the mouse is similar to that in man. That is, both contain two repetitive DNA sequence families arranged in major blocks.