Aldosterone synthase cytochrome P-450 expressed in the adrenals of patients with primary aldosteronism

A human cytochrome P-450 with aldosterone synthase activity was purified from the mitochondria of an aldosterone-producing adenoma. It was recognized by an anti-bovine cytochrome P-450(11 beta) IgG and by a specific antibody raised against a portion of the CYP11B2 gene product, one of the two putative proteins encoded by human cytochrome P-450(11 beta)-related genes (Mornet, E., Dupont, J., Vitek, A., and White, P. C. (1989) J. Biol. Chem. 264, 20961-20967). A similar and probably the same aldosterone synthase cytochrome P-450 was detected in the adrenal of a patient with idiopathic hyperaldosteronism. These aldosterone synthases were distinguishable from cytochrome P-450(11 beta), the product of another cytochrome P-450(11 beta)-related gene, i.e. CYP11B1, by their catalytic, molecular, and immunological properties and also by their localization. The latter enzyme was unable to produce aldosterone and did not react with the specific antibody against the CYP11B2 gene product. It was present both in tumor and non-tumor portions of the adrenals carrying the adenoma and in normal adrenal cortex. On the other hand, aldosterone synthase cytochrome P-450 localized in the tumor portions of the adrenals or in the adrenal of a patient with idiopathic hyperaldosteronism. Thus aldosterone synthase cytochrome P-450, a distinct species from cytochrome P-450(11 beta), is responsible for the biosynthesis of aldosterone in the human, at least in patients suffering from primary aldosteronism.     

CYP11A1 stimulates the hydroxylase activity of CYP11B1 in mitochondria of recombinant yeast in vivo and in vitro.

In mammals, hydrocortisone synthesis from cholesterol is catalyzed by a set of five specialized enzymes, four of them belonging to the superfamily of cytochrome P-450 monooxygenases. A recombinant yeast expression system was recently developed for the CYP11B1 (P45011beta) enzyme, which performs the 11beta hydroxylation of steroids such as 11-deoxycortisol into hydrocortisone, one of the three mitochondrial cytochrome P-450 proteins involved in steroidogenesis in mammals. This heterologous system was used to test the potential interaction between CYP11B1 and CYP11A1 (P450scc), the mitochondrial cytochrome P-450 enzyme responsible for the side chain cleaving of cholesterol. Recombinant CYP11B1 and CYP11A1 were targeted to Saccharomyces cerevisiae mitochondria using the yeast cytochrome oxidase subunit 6 mitochondrial presequence fused to the mature form of the two proteins. In yeast, the presence of CYP11A1 appears to improve 11beta hydroxylase activity of CYP11B1 in vivo and in vitro. Fractionation experiments indicate the presence of the two proteins in the same membrane fractions, i.e. inner membrane and contact sites of mitochondria. Thus, yeast mitochondria provide interesting insights to study some molecular and cellular aspects of mammalian steroid synthesis. In particular, recombinant yeast should permit a better understanding of the mechanism permitting the synthesis of steroids (sex steroids, mineralocorticoids and glucocorticoids) with a minimal set of enzymes at physiological level, thus avoiding disease states.     

Cloning and characterization of bovine cytochrome P-450(11 beta) genes

We isolated 4 different clones of the P-450(11 beta) gene from a bovine genomic library. These genomic clones were highly homologous with each other. Two of the isolated clones were pseudogenes. Determination of its nucleotide sequences indicated that the bovine P-450(11 beta) gene is divided into 9 exons by 8 introns and that it is about 8.5 kb in total length. The number of exons and the locations of intron insertion into the P-450(11 beta) gene are identical with those in the case of P-450(SCC), but different from those of other microsomal P-450s.     

Interaction of CYP11B1 (cytochrome P-45011 beta) with CYP11A1 (cytochrome P-450scc) in COS-1 cells.

The interactions of CYP11B1 (cytochrome P-45011beta), CYP11B2 (cytochrome P-450aldo) and CYP11A1 (cytochrome P-450scc) were investigated by cotransfection of their cDNA into COS-1 cells. The effect of CYP11A1 on CYP11B isozymes was examined by studying the conversion of 11-deoxycorticosterone to corticosterone, 18-hydroxycorticosterone and aldosterone. It was shown that when human or bovine CYP11B1 and CYP11A1 were cotransfected they competed for the reducing equivalents from the limiting source contained in COS-1 cells; this resulted in a decrease of the CYP11B activities without changes in the product formation patterns. The competition of human CYP11A1 with human CYP11B1 and CYP11B2 could be diminished with excess expression of bovine adrenodoxin. However, the coexpression of bovine CYP11B1 and CYP11A1 in the presence of adrenodoxin resulted in a stimulation of 11beta-hydroxylation activity of CYP11B1 and in a decrease of the 18-hydroxycorticosterone and aldosterone formation. These results suggest that the interactions of CYP11A1 with CYP11B1 and CYP11B2 do not have an identical regulatory function in human and in bovine adrenal tissue.     

Steroid 11-beta-hydroxylase deficiency caused by compound heterozygosity for a novel mutation, p.G314R, in one CYP11B1 allele, and a chimeric CYP11B2/CYP11B1 in the other allele

AIMS: Steroid 11beta-hydroxylase deficiency (11beta-OHD) is the second most common (5-8%) cause of congenital adrenal hyperplasia (CAH), and results from homozygous or compound heterozygous mutations or deletions of the responsible gene CYP11B1. In order to better understand the molecular basis causing 11beta-OHD, we performed detailed studies of CYP11B1 in a newly described patient diagnosed with the classical signs of 11beta-OHD. METHODS:CYP11B1 of the patient was investigated by polymerase chain reaction (PCR), sequencing, restriction fragment length polymorphism (RFLP) analysis, Southern blotting, and transient cell expression. RESULTS: We identified two new mutated alleles in CYP11B1. In one allele CYP11B1 has a g.940G-->C (p.G314R) missense mutation. On the other allele we found a chimeric gene that consists of part of the aldosterone synthase gene (CYP11B2) at exons 1-3 and part of the 11beta-hydroxylase gene (CYP11B1) at exons 4-9. Inin vitro studies, the g.940G-->C (p.G314R) mutation abolished all hydroxylase activity in comparison with the wild-type 11beta-hydroxylase. The chimeric CYP11B2/CYP11B1 protein retained 11beta-hydroxylase enzymatic activity in vitro. CONCLUSION: This case is caused by compound heterozygosity for a nonfunctional missense mutation and a chimeric CYP11B2/CYP11B1 gene with hydroxylase activity that is controlled by the CYP11B2 promoter. The most likely explanation is that the CYP11B2 promoter does not function in the zona fasciculata/reticularis where cortisol is exclusively synthesized.     

A missense mutation (GGC[435Gly]-->AGC[Ser]) in exon 8 of the CYP11B2 gene inherited in Japanese patients with congenital hypoaldosteronism

OBJECTIVES: To clarify the underlying molecular mechanism of corticosterone methyl oxidase type II (CMO II) deficiency, Japanese patients newly diagnosed with CMO II deficiency were investigated. METHODS: We analyzed the patients' genomic DNA sequence on all 9 exons of the CYP11B2 gene. In addition, restriction fragment length polymorphism (RFLP) analysis and expression studies were performed. RESULTS: The analysis showed that the patients homozygously retained a missense mutation, Gumacr;GC[435Gly]-->Aumacr;GC[Ser], in the CYP11B2 gene. Expression studies indicated that the steroid 18-hydroxylase/oxidase activities of the mutant enzyme were substantially reduced. CONCLUSION: These results support the hypothesis that this mutation causes CMO II deficiency in the patients, and are in accordance with our theory that the partial loss of P-450(C18) activities causes CMO II deficiency.     

Enzymatic activities of P-450(11 beta)s expressed by two cDNAs in COS-7 cells

Expression plasmids were constructed using two cDNA clones of P-450(11 beta), pcP-450-(11 beta)-2, and pcP-450(11 beta)-3 (Morohashi et al. (1987) J. Biochem. 102, 559-568 and Kirita et al. (1988) J. Biochem. 104, 683-686), and introduced into COS-7 cells by electroporation. The expression of P-450(11 beta) proteins and their localization in the mitochondria were demonstrated by immunoblotting, immunofluorescence microscopy, and immunoelectron microscopy. The enzymatic activities of the expressed P-450(11 beta)s were determined using deoxycorticosterone (DOC), deoxycortisol, and corticosterone as substrates. Though the activities of the two P-450(11 beta)s for 11-, 18-, and 19-hydroxylation of DOC were almost equal, the production of 18-hydroxycorticosterone and aldosterone from corticosterone by P-450(11 beta)-3 was greater than that by P-450(11 beta)-2.     

Common characteristics of the cytochrome P-450 system involved in 18- and 11 beta-hydroxylation of deoxycorticosterone in rat adrenals.

18- and 11beta-Hydroxylation of deoxycorticosterone and side chain cleavage of cholesterol were studied in mitochondria and submitochondrial reconstituted systems prepared from rat and bovine adrenals. A mass fragmentographic technique was used that allows determination of hydroxylation of both exogenous and endogenous cholesterol. The following results were obtained. (1) Treatment of rats with excess potassium chloride in drinking fluid increased mitochondrial cytochrome P-450 as well as 18- and 11beta-hydroxylase activity in the adrenals. Cholesterol side chain cleavage was not affected. In the presence of excess adrenodoxin and adrenodoxin reductase, cytochrome P-450 isolated from potassium chloride-treated rats had higher 18- and 11beta-hydroxylase activity per nmol than cytochrome P-450 isolated from control rats. The stimulatory effects on 18- and 11beta-hydroxylation were of similar magnitude. (2) Long-term treatment with ACTH increased cholesterol side chain cleavage in the adrenals but had no effect on 18- and 11beta-hydroxylase activity. The amount of cytochrome P-450 in the adrenals was not affected by the treatment. It was shown with isolated mitochondrial cytochrome P-450 in the presence of excess adrenodoxin and adrenodoxin reductase that the effect of ACTH was due to increase of side chain cleavage activity per nmol cytochrome P-450. Side chain cleavage of exogenous cholesterol was affected more than that of endogenous cholesterol. (3) Gel chromatography of soluble cytochrome P-450 prepared from rat and bovine adrenal mitochondria yielded chromatographic fractions having either a high 18- and 11beta-hydroxylase activity and a low cholesterol side chain cleavage activity or the reverse. The ratio between 18- and 11beta-hydroxylase activity was approximately constant, provided the origin of cytochrome P-450 was the same. (4) Addition of progesterone to incubations of deoxycorticosterone with soluble or insoluble rat adrenal cytochrome P-450 competitively inhibited 18- and 11beta-hydroxylation of deoxycorticosterone to the same degree. Addition of deoxycorticosterone competitively inhibited 11beta-hydroxylation of progesterone with the same system. Progesterone was not 18-hydroxylated by the system. From the results obtained, it is concluded that 18- and 11beta-hydroxylation have similar properties and that the binding site for deoxycorticosterone is similar or identical in the two hydroxylations. The possibility that the same specific type of cytochrome P-450 is responsible for both 18- and 11beta-hydroxylation of deoxycorticosterone is discussed.     

Hydroxylation of 19-norandrostenedione by adrenal cortex mitochondrial P-450(11)beta

The activity of purified bovine adrenocortical P-450(11)beta on the C18-steroid, 4-estrene-3,17-dione (19-norandrostenedione), is described. The major steroid products were separated by HPLC and identified by GC-MS, and 1H- and 13C-NMR as 11 beta-, 18- and 6 beta-hydroxylated derivatives of 19-norandrostenedione. The turnover numbers of the 11 beta-, 18- and 6 beta-hydroxylase reactions were 45, 7.5 and 1.9 (mol/min/mol of P-450(11)beta), respectively, with a common Km of 44 microM. All of these activities required the presence of the electron donating system consisting of NADPH, adrenal ferredoxin (adrenodoxin) and its reductase. These findings provide additional insights into the versatile catalytic roles of P-450(11)beta in the adrenal cortex, in which it may act on C18-19-nor-steroids in addition to its known activities on C21- and C19-steroids.     

Cloning and expression of a cDNA for human cytochrome P-450aldo as related to primary aldosteronism

A cDNA clone encoding human aldosterone synthase cytochrome P-450 (P-450aldo) has been isolated from a cDNA library derived from human adrenal tumor of a patient suffering from primary aldosteronism. The insert of the clone contains an open reading frame encoding a protein of 503 amino acid residues together with a 3 bp 5'-untranslated region and a 1424 bp 3'-untranslated region to which a poly(A) tract is attached. The nucleotide sequence of P-450aldo cDNA is 93% identical to that of P-450(11) beta cDNA. Catalytic functions of these two P-450s expressed in COS-7 cells are very similar in that both enzymes catalyze the formation of corticosterone and 18-hydroxy-11-deoxycorticosterone using 11-deoxycorticosterone as a substrate. However, they are distinctly different from each other in that P-450aldo preferentially catalyzes the conversion of 11-deoxycorticosterone to aldosterone via corticosterone and 18-hydroxycorticosterone while P-450(11)beta substantially fails to catalyze the reaction to form aldosterone. These results suggest that P-450aldo is a variant of P-450(11)beta, but this enzyme is a different gene product possibly playing a major role in the synthesis of aldosterone at least in a patient suffering from primary aldosteronism.     

Structural analysis of multiple bovine P-450(11 beta) genes and their promoter activities

A bovine genomic library was constructed using a cosmid vector, pHC79, and bovine DNA partially digested by EcoRI. Bovine P-450(11 beta) cDNA, pcP-450(11 beta)-2 [Morohashi et al. (1987) J. Biochem. 102,559-568], was used as a probe for screening the genomic library. Ten clones carrying P-450(11 beta) genomic DNA were isolated from 8 x 10(4) colonies and classified into five groups (CB11 beta-1, CB11 beta-3, CB11 beta-7, CB11 beta-20, and CB11 beta-21) according to differences in the restriction endonuclease sites. Nucleotide sequences of amino acid coding regions of the five clones were determined by the dideoxy sequencing method using synthetic nucleotides corresponding to various parts of the cDNA as primers. The nucleotide sequences revealed that three clones, CB11 beta-1, CB11 beta-3, and CB11 beta-21, were pseudogenes. Amino acid sequences coded by the other two clones, CB11 beta-7 and CB11 beta-20, were identical with that coded by a previously described cDNA, pcP-450(11 beta)-3 [Kirita et al. (1988) J. Biochem. 104, 683-686]. The promoter regions of the five clones were introduced in front of chloramphenicol acetyltransferase (CAT) gene of pSV00CAT and used to examine P-450(11 beta) gene regulation in cultured cells. The five recombinant plasmids showed cAMP-responsive CAT activities in Y-1 cells, a cell strain derived from adrenal tumor. The induction rates of the recombinant plasmids carrying the promoters of normal genes, CB11 beta-7 and -20, were larger than those of pseudogenes, CB11 beta-1, -3, and -21. CAT activities expressed by the promoter regions of the normal genes in the presence or absence of cAMP in Y-1 cells were almost equal to that by the promoter region of human P-450(SCC) gene. Though the promoter of the P-450(SCC) gene also showed cAMP-responsive CAT activity in I-10 cells, a cell strain derived from Leyding cell tumor, P-450(11 beta) gene promoter did not express the activity in I-10 cells.     

Molecular cloning and expression of cDNAS encoding rat aldosterone synthase: variants of cytochrome P-450(11 beta)

Two distinct forms of cDNA encoding rat aldosterone synthase were cloned from an adrenal capsular tissue cDNA library. The deduced amino acid sequences showed that one of the enzymes (P-450(11 beta),aldo-1) had a long extension peptide composed of 34 amino acid residues while the other (P-450(11 beta),aldo-2) had an extension peptide identical to that of rat P-450(11 beta). Glu at the 320th position of P-450(11 beta),aldo-1 was replaced with Lys in P-450(11 beta),aldo-2. The amino acid sequence of the aldosterone synthase was highly homologous (81%) to rat P-450(11 beta). Constructed expression vector containing the cDNA for extension peptide of P-450(11 beta) and the mature protein of P-450(11 beta),aldo-1 was transfected into COS-7 cells. The cells converted 11-deoxycorticosterone into corticosterone, 18-hydroxycorticosterone, and aldosterone.     

Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)