Use of methylphosphonic dichloride for the synthesis of oligonucleoside methylphosphonates.

Methylphosphonic dichloride was used to prepare protected deoxyribonucleoside 3'-methylphosphonate beta-cyanoethyl esters, d-[(MeO)2Tr]NpCNEt, and protected oligonucleoside methylphosphonates in solution. Reaction of d-[(MeO)2Tr]N with methylphosphonic dichloride gives d-[(MeO)2Tr]NpCl. The phosphonylation and subsequent esterification or condensation reactions are each complete within 60 min. The products are readily purified by "flash chromatography" on silica gel columns. d-[(MeO)2Tr]NpCl, or its tetrazole derivative, d-[(MeO)2Tr]Nptet, were tested as intermediates for the synthesis of oligothymidine methylphosphonates on a silica gel polymer support. The average yield per coupling step was 76% and did not increase with addition of more d-[(MeO)2Tr]TpCl. The formation of (5'-5') linked thymidine dimers indicated that the thymidine monomers are clustered closely together on the support. When N is ibuG, the yield for the coupling step on the support is very low. This may be due to steric hindrance of the 3'-phosphonate group by the N-2 isobutryl protecting group.     

Preparation of oligodeoxyribonucleoside methylphosphonates on a polystyrene support.

An efficient procedure is described for synthesizing deoxyribonucleoside methylphosphonates on polystyrene polymer supports which involves condensing 5'-dimethoxytrityldeoxynucleoside 3'-methylphosphonates. The oligomers are removed from the support and the base protecting groups hydrolyzed by treatment with ethylenediamine in ethanol, which avoids hydrolysis of the methylphosphonate linkages. Two types of oligomers were synthesized: those containing only methylphosphonate linkages, d-Np(Np)nN, and those which terminate with a 5' nucleotide residue, dNp (Np)nN. The latter oligomers can be phosphorylated by polynucleotide kinase, and are separated by polyacrylamide gel electrophoresis according to their chain length. Piperdine randomly cleaves the oligomer methylphosphonate linkages and generates a series of shorter oligomers whose number corresponds to the length of the original oligomer. Apurinic sites introduced by acid treatment spontaneously hydrolyze to give oligomers which terminate with free 3' and 5' OH groups. These reactions may be used to characterize the oligomers.     

Chemical synthesis of DNA oligomers containing cytosine arabinoside.

The solid phase phospite triester synthesis of oligodeoxynucleotides containing cytosine arabinoside (araC) is described. A protected araC phosphoramadite was prepared for the introduction of araC residues at 5'termini and internucleotide positions in DNA oligomers. These oligomers were utilized to demonstrate the formation of correct 3'-5' linkages, to test for alkaline lability at the araC site, and to study the stability of duplexes containing araC-G base pairs. For the introduction of araC residues at 3' terminal positions, a protected derivative of araC was coupled to functionalized silica. This material was used to prepare a test oligomer which was characterized enzymatically.     

A simple method for the solid phase synthesis of oligodeoxynucleotides containing O4-alkylthymine.

A route to prepare the cyanoethyl-phosphoramidite monomer of O4-alkylthymine and a method for the routine solid-phase synthesis of oligodeoxynucleotides containing O4-alkylthymine are described. This method has been used to make DNA sequences up to 48 bases in length. The amino function of the adenine and guanine in the sequence were protected with the phenoxyacetyl group, and that of cytosine with the isobutyryl group. The phosphodiesters were protected with the cyanoethyl group. This allowed complete deprotection of the oligomer with alkoxide ions (methanol/1,8- diazabicyclo[5.4.0]undec-7-ene (DBU) for the oligomers containing O4-methylthymine, or ethanol/DBU for those containing O4-ethylthymine) thus avoiding the use of ammonia which is known to attack the O4-alkylthymine to form 5-methylcytosine. There was no detectable loss of the alkyl group to form thymine.     

Novel internucleotide 3'-NH-P(CH3)(O)-O-5' linkage. Oligo(deoxyribonucleoside methanephosphonamidates); synthesis, structure and hybridization properties.

Diastereomeric dithymidine methanephosphonamidates (TnpmT) were synthesized by reaction of 3'-amino-3'-deoxythymidine with 3'- O -acetylthymidin-5-yl-methanephosphonochloridate. Separated dinucleotide TnpmT(fast) and TnpmT(slow) diastereomers were used as building blocks to prepare chimeric dodecathy-midylates, possessing one to four modified linkages, by means of phosphoramidite automated solid phase synthesis. As expected, the methanephosphonamidate internucleotide linkage is resistant to nuclease P1, snake venom PDE and 3'-exonuclease from human plasma. Degradation of dodecathymidylates possessing modified internucleotide linkages in alternate positions proved the 'hopping' properties of 3'-exonuclease. Oligo(deoxyribonucleotide methanephosphonamidates) were tested for their binding affinity to complementary oligomers in thermal denaturation experiments. All the oligomers showed lower binding affinity to DNA and RNA targets, however, oligomers originating from the TnpmT(fast) dimeric unit exhibited better hybridization properties than their diastereomeric TnpmT(slow) counterparts. A lowering of T m of approximately 2.4 degrees C (1.0-1.8 degrees C) was observed for each introduced TnpmT(fast) modification and 6.0 degrees C (4.2-5.0 degrees C) for each TnpmT(slow) modification in duplexes of modified dodecathymidylates with dA12(A12) oligomers. The oligo(deoxyribonucleoside methanephosphonamidate) designated F4, possessing four modified methanephosphonate linkages originating from the TnpmT(fast) diastereomeric unit, exhibits a tendency for triplex formation, as was demonstrated in thermal denaturation experiments with the d(A21C4T21) hairpin oligomer.     

Interaction of psoralen-derivatized oligodeoxyribonucleoside methylphosphonates with single-stranded DNA

Oligodeoxyribonucleoside methylphosphonates derivatized at the 5' end with 4'-(amino-alkyl)-4,5',8-trimethylpsoralen were prepared. The interaction of these psoralen-derivatized methylphosphonate oligomers with synthetic single-stranded DNAs 35 nucleotides in length was studied. Irradiation of a solution containing the 35-mer and its complementary methylphosphonate oligomer at 365 nm gave a cross-linked duplex produced by cycloaddition between the psoralen pyrone ring of the derivatized methylphosphonate oligomer and a thymine base of the DNA. Photoadduct formation could be reversed by irradiation at 254 nm. The rate and extent of cross-linking were dependent upon the length of the aminoalkyl linker between the trimethylpsoralen group and the 5' end of the methylphosphonate oligomer. Methylphosphonate oligomers derivatized with 4'-[[N-(2-aminoethyl)amino]methyl]- 4,5',8-trimethylpsoralen gave between 70% and 85% cross-linked product when irradiated for 20 min at 4 degrees C. Further irradiation did not increase cross-linking, and preirradiation of the psoralen-derivatized methylphosphonate oligomer at 365 nm reduced or prevented cross-linking. These results suggest that the methylphosphonate oligomers undergo both cross-linking and deactivation reactions when irradiated at 365 nm. The extent of cross-linking increased up to 10 microM oligomer concentration and dramatically decreased at temperatures above the estimated Tm of the methylphosphonate oligomer-DNA duplex. The cross-linking reaction was dependent upon the fidelity of base-pairing interactions between the methylphosphonate oligomers and the single-stranded DNA. Noncomplementary oligomers did not cross-link, and the extent of cross-linking of oligomers containing varying numbers of noncomplementary bases was greatly diminished or eliminated.(ABSTRACT TRUNCATED AT 250 WORDS)     

DNA primase-DNA polymerase alpha assembly from mouse FM3A cells. Purification of constituting enzymes, reconstitution, and analysis of RNA priming as coupled to DNA synthesis

The mouse DNA primase-DNA polymerase alpha complex can be resolved with buffer containing 50% ethylene glycol (Suzuki, M., Enomoto, T., Hanaoka, F., and Yamada, M. (1985) J. Biochem. (Tokyo) 98, 581-584). The dissociated primase and DNA polymerase alpha have been purified sufficiently that there was no cross-contamination with each other. By the use of thus isolated DNA primase and DNA polymerase alpha in addition to DNA primase-DNA polymerase alpha complex, we have studied primer RNA synthesis and DNA elongation separately as well as the coupled reaction of the initiation and elongation of DNA chains. In the absence of deoxyribonucleoside triphosphates, the isolated primase synthesized oligoribonucleotides of an apparent length of 7-11 nucleotides (monomeric oligomer) and multiples of a modal length of 9-10 nucleotides (multimeric oligomer) and fd phage single-stranded circular DNA. Monomeric and dimeric oligomers were synthesized processively, and trimeric and larger oligomers were produced by repeated cycles of processive synthesis. The primase complexed with DNA polymerase alpha mainly synthesized monomeric and a small amount of dimeric oligomers. In the presence of deoxyribonucleoside triphosphates at concentrations above 10 microM, the DNA primase-DNA polymerase alpha complex exclusively synthesized monomeric oligomers only, which were utilized as primers for DNA synthesis. On the other hand, the products synthesized by the isolated primase were qualitatively unchanged as compared with those synthesized in the absence of DNA precursors. When the synthesis of oligomers by the isolated primase was coupled with DNA elongation by the addition of the primase-free DNA polymerase alpha, the synthesis of dimeric oligomers was inhibited as a result of efficient DNA elongation from monomeric oligomers.     

Photochemical cross-linking of psoralen-derivatized oligonucleoside methylphosphonates to rabbit globin messenger RNA

Antisense oligodeoxyribonucleoside methylphosphonates targeted against various regions of mRNA or precursor mRNA are selective inhibitors of mRNA expression both in cell-free systems and in cells in culture. The efficiency with which methylphosphonate oligomers interact with mRNA, and thus inhibit translation, can be considerably increased by introducing photoactivatable psoralen derivatives capable of cross-linking with the mRNA. Oligonucleoside methylphosphonates complementary to coding regions of rabbit alpha- or beta-globin mRNA were derivatized with 4'-(aminoalkyl)-4,5',8-trimethylpsoralens by attaching the psoralen group to the 5' end of the oligomer via a nuclease-resistant phosphoramidate linkage. The distance between the psoralen group and the 5' end of the oligomer can be adjusted by changing the number of methylene groups in the aminoalkyl linker arm. The psoralen-derivatized oligomers specifically cross-link to their complementary sequences on the targeted mRNA. For example, an oligomer complementary to nucleotides 56-67 of alpha-globin mRNA specifically cross-linked to alpha-globin mRNA upon irradiation of a solution of the oligomer and rabbit globin mRNA at 4 degrees C. Oligomers derivatized with 4'-[[N-(2-amino-ethyl)amino]methyl]-4,5',8-trimethylpsoralen gave the highest extent of cross-linking to mRNA. The extent of cross-linking was also determined by the chain length of the oligomer and the structure of the oligomer binding site. Oligomers complementary to regions of mRNA that are sensitive to hydrolysis by single-strand-specific nucleases cross-linked to an approximately 10-30-fold greater extent than oligomers complementary to regions that are insensitive to nuclease hydrolysis.(ABSTRACT TRUNCATED AT 250 WORDS)     

Mechanisms of degradation of 2′-5′ oligoadenylates

We have studied the mechanisms of breakdown of 2'-5' oligoadenylates. We monitored the time-courses of degradation of ppp(A2'p5')nA (dimer to tetramer) and of 5'OH-(A2'p5')nA (dimer to pentamer) in unfractionated L1210 cell extract. The 5' triphosphorylated 2'-5' oligoadenylates are converted by a phosphatase activity. However, 2'-5' oligoadenylates are degraded mainly by phosphodiesterase activity which splits the 2'-5' phosphodiester bond sequentially at the 2' end to yield 5' AMP and one-unit-shorter oligomers. The nonlinear least-squares curve-fitting program CONSAM was used to fit these kinetics and to determine the degradation rate constant of each oligomer. Trimers and tetramers, whether 5' triphosphorylated or not, are degraded at the same rate, whereas 5' triphosphorylated dimer is rapidly hydrolyzed and 5'-OH dimer is the most stable oligomer. The interaction between degradation enzymes and the substrate strongly depends on the presence of a 5' phosphate group in the vicinity of the phosphodiester bond to be hydrolyzed; indeed, when this 5' phosphate group is present, as in pp/pA2'p5'A/or A2'/p5'A2'p5'A/, affinity is high and maximal velocity is low. Such a degradation pattern can control the concentration of 2'-5' oligoadenylates active on RNAse L either by limiting their synthesis (5' triphosphorylated dimer is the primer necessary for the formation of longer oligomers) and/or by converting them into inhibitory (e.g., monophosphorylated trimer) or inactive (e.g., nonphosphorylated oligomers) molecules.     

Solution Stability and Degradation Pathway of Deoxyribonucleoside Phosphoramidites in Acetonitrile

The impuritiy profiles of acetonitrile solutions of the four standard O‐cyanoethyl‐N,N‐diisopropyl‐phosphoramidites of 5′‐O‐dimethoxytrityl (DMT) protected deoxyribonucleosides (dG^ib, dA^bz, dC^bz, T) were analyzed by HPLC‐MS. The solution stability of the phosphoramidites decreases in the order T, dC>dA>dG. After five weeks storage under inert gas atmosphere the amidite purity was reduced by 2% (T, dC), 6% (dA), and 39% (dG), respectively. The main degradation pathways involve hydrolysis, elimination of acrylonitrile and autocatalytic acrylonitrile‐induced formation of cyanoethyl phosphonoamidates. Consequently, the rate of degradation is reduced by reducing the water concentration in solution with molecular sieves and by lowering the amidite concentration. Acid‐catalyzed hydrolysis could also be reduced by addition of small amounts of base.     

Large-scale purification of synthetic oligonucleotides and carcinogen-modified oligodeoxynucleotides on a reverse-phase polystyrene (PRP-1) column

A procedure is described for the large-scale purification of synthetic oligonucleotides using a polystyrene (PRP-1, Hamilton Co.) high-performance liquid chromatography (HPLC) column with a phosphate/methanol/acetonitrile solvent system. Pure oligonucleotides are obtained with a three-step procedure that involves only one column purification step. The dimethoxytrityl group is left on the oligomer for the HPLC purification. The use of the PRP-1 polystyrene column with a phosphate/methanol/acetonitrile solvent system provides excellent separation of the desired dimethoxytrityl-bearing oligonucleotide from failure sequences. The dimethoxytrityl group is removed by treatment with acetic acid and the oligonucleotide is desalted on a C-18 Sep-Pak cartridge. The oligodeoxynucleotides obtained are shown to be essentially pure by HPLC, polyacrylamide gel electrophoresis, and 500-MHzNMR spectroscopy. This procedure is especially useful for the large-scale purification of oligonucleotides required for NMR studies. The PRP-1 column and the phosphate/methanol/acetonitrile solvent system is useful for purifying modified oligonucleotides containing lipophilic groups such as the carcinogen 2-(acetylamino)fluorene.     

Studies on transfer ribonucleic acids and related compounds. XLV. Block condensation of ribooligonucleotides containing 2'-O-tetrahydrofuranyl-5'-O-dimethoxytritylnucleosides.

2'-O-Tetrahydrofuranyl-5'-O-dimethoxytrityl-N-protected nucleosides were phosphorylated to give the 3'-(o-chlorophenyl) phosphates which were then condensed with 3',5'-unprotected nucleosides to elongate the chain in the 3'-direction. The 5'-dimethoxytrityl group of these oligonucleotides was selectively deblocked by treatment with zinc bromide. The rate of removal of the dimethoxytrityl group differed in each nucleotide. A dodecamer containing a termination codon UAG, U(AGU)3AG, was synthesized by elongating the chain in the 5'-direction using the selective dedimethoxytritylation followed by condensation of protected oligonucleotide blocks.     

Control of ribonucleic acid function by oligonucleoside methylphosphonates

Oligodeoxyribonucleoside methylphosphonates contain nonionic 3'-5' linked methylphosphonate internucleotide bonds in place of the normal charged phosphodiester linkage of natural nucleic acids. These oligomers are resistant to nuclease hydrolysis, can pass through the membranes of mammalian cells in culture and can form stable hydrogen-bonded complexes with complementary nucleotide sequences of cellular RNAs such as mRNA. The oligomers are readily synthesized on insoluble polymer supports. Their chainlength and nucleotide sequence can be determined by chemical sequencing procedures. Oligonucleoside methylphosphonates which are complementary to the 5'-end, initiation codon region, or coding region of rabbit globin mRNA inhibit translation of the mRNA in rabbit reticulocyte lysates and globin synthesis in rabbit reticulocytes. This inhibition is due to the interaction of the oligomers with mRNA and the extent of inhibition is influenced by the secondary structure of the mRNA and the location of oligomer binding site on the mRNA. Oligomers complementary to the initiation codon regions of N, NS and G protein mRNAs of Vesicular stomatitis virus (VSV) inhibit virus protein synthesis in VSV-infected Mouse L-cells. These oligomers do not affect L-cell protein synthesis or growth. Virus protein synthesis and growth can also be selectively inhibited by oligonucleoside methylphosphonates which are complementary to the donor or acceptor splice junctions of virus pre mRNA. An oligomer complementary to the donor splice junction of SV40 large T antigen mRNA inhibits T-antigen synthesis in SV40-infected African green monkey kidney cells but does not inhibit overall cellular protein synthesis.(ABSTRACT TRUNCATED AT 250 WORDS)     

Nuclear magnetic resonance studies of cis-syn, trans-syn, and 6-4 photodimers of thymidylyl(3'-5')thymidine monophosphate and cis-syn photodimers of thymidylyl(3'-5')thymidine cyanoethyl phosphotriester

Three out of four possible photodimers of thymidylyl(3'-5')thymidine monophosphates (i.e., cis-syn, 6-4, and one of the trans-syn) and two structural isomers (i.e., R and S forms) of cis-syn-thymidylyl(3'-5')thymidine cyanoethyl phosphotriester have been isolated and purified from the reaction mixtures after UV irradiation and studied by multinuclear magnetic resonance Spectroscopy. All five inter thymine base linked photodimers have grossly similar structures which are quite different from those of the parent thymidylyl(3'-5')thymidine. The base of Tp- is in the syn conformation, and that of -pT it is in the anti conformation. The sugar puckering of Tp- is dominated by the 2E conformer, but in -pT it is in 4E; except for the conformer around C5'-O5' bond, the 6-4 isomer is very similar to those of cis-syn and trans-syn conformation. As expected, there are sugar-phosphate backbone distortions in the phosphotriesters, due to the neutralization of the negative charge of the phosphate. In general the structures of all five photodimers are very close to those of the cis-syn photodimer of thymidylyl(3'-5')thymidine monophosphate cyanoethyl ester as studied by X-ray diffraction [Cadet, J., Voituriez, L., Hruska, F. E., & Grand, A. (1985) Biopolymers 24, 897-903; Hruska, F. E., Voituriez, L., Grand, A., & Cadet, J. (1986) Biopolymers 25, 1401-1417]. While the trans-syn photodimer has two structural isomers, only one [C6(of Tp-)-R] was produced by the UV irradiation and studied.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Cross-linking of the anticodon of Escherichia coli and Bacillus subtilis acetylvalyl-tRNA to the ribosomal P site. Characterization of a unique site in both E. coli 16S and yeast 18S ribosomal RNA

The nucleotide residues involved in the cross-link between P site bound acetylvalyl-tRNA (AcVal-tRNA) and 16-18S rRNA have been identified. This cross-link was formed by irradiation of Escherichia coli or Bacillus subtilis AcVal-tRNA bound to the P site of E. coli ribosomes or by irradiation of E. coli AcVal-tRNA bound to the P site of yeast ribosomes. The three cross-linked RNA heterodimers were obtained in 10-35% purity by disruption of the irradiated ribosome-tRNA complex with sodium dodecyl sulfate followed by sucrose gradient centrifugation. After total digestion with RNase T1, and labeling at either the 5'- or the 3'-end, the cross-linked oligomers could be identified and isolated before and after photolytic splitting of the cross-link. One of the oligomers was shown to be UACACACCG, a unique rRNA nonamer present in an evolutionarily conserved region. This oligomer was found in all three heterodimers. The other oligomer of the dimer had the sequence expected for the RNase T1 product encompassing the anticodon of the tRNA used. The precise site of cross-linking was determined by two novel methods. Bisulfite modification of the oligonucleotide dimer converted all C residues to U, except for any cross-linked C which would be resistant by being part of a cyclobutane dimer. Sequencing gel analysis of the UACACACCG oligomer showed that the C residue protected was the 3'-penultimate C residue, C1400 in E. coli rRNA or C1626 in yeast rRNA.(ABSTRACT TRUNCATED AT 250 WORDS)     

A method for the enzymatic synthesis and purification of [alpha-32P] nucleoside triphosphates.

A simplified method is described for the enzymatic synthesis and purification of [alpha-32P]ribo- and deoxyribonucleoside triphosphates. The products are obtained at greater than 97% radiochemical purity with yields of 50--70% (relative to 32Pi) by a two-step elution from DEAE-Sephadex. All reactions are done in one vessel as there is no need for intermediate product purifications. This method is therefore suitable for the synthesis of these radioactive compounds on a relatively large scale. The sequential steps of the method involve first the synthesis of [gamma-32P]ATP and the subsequent phosphorylation of nucleoside 3' monophosphate with T4 polynucleotide kinase to yield nucleoside 3', [5'-32P]diphosphate. Hexokinase is used after the T4 reaction to remove any remaining [gamma-32P]ATP. Nucleoside 3',[5'-32P]diphosphate is treated with nuclease P-1 to produce the nucleoside [5'-32P]monophosphate which is phosphorylated to the [alpha-32P]nucleoside triphosphate with pyruvate kinase and nucleoside monophosphate kinase. Adenosine triphosphate used as the phosphate donor for [alpha-32P]deoxynucleoside triphosphate syntheses is readily removed in a second purification step involving affinity chromatography on boronate-polyacrylamide. [alpha-32P]Ribonucleoside triphosphates can be similarly purified when deoxyadenosine triphosphate is used as the phosphate donor.     

Synthesis of RNA containing inosine: analysis of the sequence requirements for the 5'' splice site of the Tetrahymena group I intron.

Two protected derivatives of the ribonucleoside inosine have been prepared to serve as building blocks for phosphoramidite-based synthesis of RNA. Two different synthetic routes address the unusual solubility characteristics of inosine and its derivatives. The final products of the different synthetic pathways, 5'-O-(dimethoxytrityl)-2'-O-(t-butyldimethylsiyl) inosine 3'-O-(beta-cyanoethyldiisopropylamino) phosphoramidite 5a, and O6-p-nitrophenylethyl-5'-O-(dimethoxytrityl)-2'-O-(t-butyldimethylsilyl) inosine 3'-O-(methyldiisopropylamino) phosphoramidite 5b, were chemically incorporated into short oligoribonucleotides which also contained the four standard ribonucleoside bases. The oligomers were chosen to study base-specific interactions between an RNA substrate and an RNA enzyme derived from the Group I Tetrahymena self-splicing intron. The oligomers were shown to be biochemically competent using a trans cleavage assay with the modified Tetrahymena intron. The results confirm the dependence of the catalytic activity on a wobble base pair, rather than a Watson-Crick base pair, in the helix at the 5'-splice site. Furthermore, comparison of guanosine and inosine in a wobble base pair allows one to assess the importance of the guanine 2-amino group for biological activity. The preparation of the inosine phosphoramidites adds to the repertoire of base analogues available for the study of RNA catalysis and RNA-protein interactions.     

Simple and stereoselective preparation of an 4-(aminomethyl)-1,2,3-triazolyl nucleoside phosphoramidite

A simple and stereoselective synthesis of a protected 4-(aminomethyl)-1-(2-deoxy-β-D-ribofuranosyl)-1,2,3-triazole cyanoethyl phosphoramidite was developed for the modification of synthetic oligonucleotides. The configuration of the 1,2,3-triazolyl moiety with respect to the deoxyribose was unambiguously determined in ROESY experiments. The aminomethyl group of the triazolyl nucleotide was fully functional in labelling reactions. Furthermore, the hybridization behavior of 5' triazole-terminated oligonucleotide was similar to that of 5' aminohexyl-terminated oligomer with the same sequence. Internal modifications of the oligonucleotide strands resulted in significant decrease of duplex stability.