A chromosomal walk in the region of polytene bands 7C-D of theDrosophila X chromosome

A chromosomal walk on the X chromosome ofDrosophila in the region of polytene bands 7C1 to 7D5 is described. The region is of interest since three olfactory genes have been found to map here in addition to a haplo-inviable locus. Genomic clones spanning 160 kilobases have been isolated and their complete restriction map is presented. The clones have been aligned on the polytene chromosome bands byin situ hybridisation. In addition the end-points of a deficiency and duplication lying in this region have been mapped approximately, showing that an overlap exists between them.     

Human nucleotide sequences related to the transforming gene of a murine sarcoma virus: studies with cloned viral and cellular DNAs

A recombinant plasmid, pI26, has been constructed by cloning into pBR322 a transforming gene of murine sarcoma virus (a Moloney strain, clone 124, MSV) synthesized by detergent-treated virions. From this plasmid a XbaI-HindIII fragment has been isolated which contains only mos-specific sequences. This mos-specific probe has been used for screening a human gene library cloned in bacteriophage λ Charon 4A. Of these, 19 clones have been isolated containing mos-related sequences. By physical mapping and molecular hybridization it has been shown that these sequences are neighboured by DNA regions related to Moloney murine leukemia virus. Recombinant phages have also been found containing human inserts related to MLV, not to the mos gene. The possible existence of murine-like endogenous retroviruses in the normal human genome, including that of a sarcoma type, is discussed. By Northern blotting, expression of the cellular c-mos gene has been detected in mouse liver treated with a hepatocarcinogen. The general significance of the suggested model for evaluating the relationship between chemical carcinogenesis and oncogene expression is discussed.     

The alpha taxonomy of Australopithecus at Sterkfontein: The postcranial evidence

The possibility that the fossils attributed to Australopithecus africanus represent more than a single species is of significance because of the pivotal role that A. africanus has played in discussions about hominin evolution. The A. africanus hypodigm that is currently widely recognized evinces considerable variation in a number of craniodental characters, and this has led to speculation that more than one australopith taxon may be represented among the specimens from Sterkfontein. Although crania, mandibles and teeth have dominated these taxonomic discussions, the Sterkfontein postcranial remains also have been invoked. While several workers have proposed that some of the craniodental remains from Sterkfontein can be partitioned into two groups, there is a notable lack of agreement among them as to their actual sorting. Most of the craniodental observations that have been put forward in support of arguments for taxonomic heterogeneity of the Sterkfontein australopith assemblage have been subjective and anecdotal in nature. So too, the postcranial evidence that has been cited in support of more than one australopith species at Sterkfontein has been largely subjective, and limited to a small number of elements. The results of quantitative statistical analyses of the craniodental and postcranial fossils that have been undertaken to date are not necessarily consistent with the hypothesis of taxonomic heterogeneity.     

A geometric synthesis method to realize a switching function

Frequently in threshold logic it is necessary to realize a switching function f of n variables in a two or more stages realization, both because it is not possible to realize f in a single gate and for reliability considerations. This means that the given function must be decomposed into a certain number of threshold functions, each of them having a number of variables less than n. When a geometric representation of switching functions is considered, the problem is equivalent to that of looking for functions whose patterns (on-sets) cover, in an adequate way, the on-set of the function f to be realized. In this paper a heuristic covering approach has been introduced which provides a manageable method for searching for a two stage realization of f. Furthermore a class of switching functions whose patterns possess a particular geometric shape (shell structure) has been considered. It has been proved that such functions (shell functions) are linearly separable and that one of their separating systems strictly depends on the centre and on the diameter of the shell structure. Gates implementing shell functions have been considered and their use has been revealed more convenient than that of majority gates in the solution of the problem of network synthesis. To clarify this advantage an example has been discussed in detail.     

Effects of rho-fluorophenylalanine on the growth of Lactobacillus arabinosus

p-Fluorophenylalanine has been found to be inhibitory to Lactobacillus arabinosus 17-5. This inhibition has been shown to be competitive with phenylalanine but not with tyrosine, and is described by a low antibacterial index, which varies over a range of approximately 1–20, dependent upon the temporal stage of the culture for which the data are employed in calculation.The organism has been found also to adapt readily to the inhibitor. Evidence that this adjustment involves a mutation to a type with a selective advantage in media containing the inhibitor is presented.Under limiting conditions, which have been described, the organism is capable of greater growth in the presence of both metabolite and antimetabolite than in the presence of the same amount of metabolite alone.Discussion of the significance of the results has been presented.     

Tubes or cell sheet? A 3-D reconstruction of Halysis Høeg, 1932, from the Upper Ordovician of South China

Halysis is a microfossil found in Ordovician to Devonian shallow-marine carbonates. Up to now, it is only known from thin-sections, and therefore its three-dimensional shape and its systematic position are controversial. Halysis is described as a chain-like microfossil with a shape of the single “chain links” ranging from circular to rounded rectangular. Given that Halysis commonly co-occurs with calcareous algae, it is assumed to also be an alga. Interpretations of the anatomy propose a filiform or tubiform shape. Even a unistratose sheet of cells has been discussed. Since Halysis is comparatively rare, its shape has not been resolved up to now. For the present study, 52 out of several hundred specimens from an Upper Ordovician shallow-water limestone of South China have been investigated in detail, which for the first time offers the opportunity to analyze a great number of sections through Halysis. A three-dimensional computer model of Halysis has been constructed in order to set up planes sectioning the model. These simulated sections have been compared to those from Halysis in thin-sections. The results show that Halysis represents a microfossil with a morphology consisting of parallel juxtaposed, partly branching tubes. A single sheet of cells, which was recently proposed as shape of Halysis, can clearly be excluded.     

Cranial morphology and adaptations in Eocene Adapidae. II. The Cambridge skull of Adapis parisiensis

One of the most complete skulls of the early primate Adapis parisiensis is in the collection of the Department of Zoology, Cambridge University. This exceptionally well-preserved male skull, from Quercy in southern France, is important in showing relatively small orbits that are highly convergent, a distinct ethmoid component in the medial orbital wall, very small infraorbital foramina, a well-preserved auditory region with the stapedial canal about twice the diameter of the canal for the promontory artery, and a well-preserved braincase 8.8 cm³ in endocranial volume. The frontal lobe of the brain in the Cambridge skull described here is less expanded than that reported previously in a British Museum skull. The average body weight of Adapis parisiensis is estimated to have been about 2.0 kg, and that of Adapis magnus is estimated to have been about 8.4 to 9.0 kg. The encephalization quotient (EQ) of Adapis parisiensis is estimated to have been 0.45, which is well below the range found in modern prosimians. There is some indication that the size of the foramen magnum has increased with increasing brain size during primate evolution. Adapis parisiensis appears to have been a medium-sized, visually oriented, diurnal, sexually dimorphic arboreal folivore.     

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements

Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s^–1 at 30 °C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the –35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence. Correspondence to: A. N. Lane     

Tentative d'introduction a Madagascar et a la Réunion deDiatraeophaga striatalis,parasite deProceras sacchariphagus “Borer ponctué” de la canne a sucre

Summary In order to control the sugar-cane borerProceras sacchariphagus Boj. in Madagascar and Réunion, the French Research Institute for Tropical Agriculture has organized a mission in Indonesia in 1964 with the objective of finding the TachinidDiatraeophaga striatalis Towns. The result is that 4812 available adult flies have been introduced into Madagascar and among them 1470 flies have been released in Réunion and 530 in Madagascar. Moreover, it has been possible to rearDiatraeophaga and again to release flies in 1965 (2 000 in Madagascar and more than 1 000 in Réunion). At present, this rearing is carried on, particularly in Réunion, where a strain was sent in July 1965 and a wider program of mass production and release is planned for 1966. For the first time, in october 1965, it has been possible to find the progeny of flies having been released in the flield. In this paper some data on conditions ofDiatraeophaga rearing are also given.      

THE ACCUMULATION OF ELECTROLYTES : VII. ORGANIC ELECTROLYTES PART 2

Analyses have been made of the inorganic constituents of the juices expressed from the leaves of Rheum, Rumex, and Oxalis. It has been shown that in all cases there is a large excess of inorganic cations over anions in the sap, the average ratio of cations to anions being 3.8 (Part 1, p. 239). The ash analyses of plant tissues (chiefly leaves) reported in the literature have been examined critically, and it has been shown that the preponderance of inorganic cations over inorganic anions in the ash and in the sap is general. It has been concluded that the excess of inorganic cations is consistent with the view that cations pass into the protoplasm chiefly in the form of hydroxides, and are accumulated either in the form of organic salts (such as the oxalates) or in non-polar linkage. It has been concluded that practically all the potassium and sodium found in plant ash must have been present originally in the form of soluble ionogenic compounds, but that a considerable part of the calcium and magnesium may have been present originally in the form of insoluble salts or as components of non-polar compounds. The methods whereby the cations, particularly potassium, may have been accumulated have been discussed, and it has been concluded that as it does not seem very probable that they enter chiefly as nitrates or bicarbonates we may suppose that they go in to a large extent as hydrates: this is highly probable in the case which has been most carefully investigated (Valonia).     

Acetylcholine receptor-controlled ion flux in electroplax membrane vesicles: Identification and characterization of membrane properties that affect ion flux measurements

Summary Several intrinsic properties of acetylcholine receptor-rich membrane vesicles prepared fromElectrophorus electricus, which need to be considered in measurements of receptor-mediated ion flux, have been identified. One of these properties is a slow exchange of inorganic ions in the vesicles. The slow exchange of ions is not related to the receptor-mediated flux of ions and accounts for 30–35% of the efflux observed. A method to separate this process from the receptor-controlled flux has been developed. It has also been shown, using a light-scattering method, that aggregation-disaggregation of the vesicles can interfere with the efflux measurements, and a method to overcome this problem has been developed. The difference in the amplitude of effluxes induced by saturating amounts of carbamylcholine and gramicidin has been investigated and has been shown not to be due to a receptor-controlled process; therefore, the amplitude difference does not need to be considered in understanding the receptor-controlled process.     

CHROMOSIN,A DESOXYRIBOSE NUCLEOPROTEIN COMPLEX OF THE CELL NUCLEUS

A desoxyribose nucleoprotein complex, which we have referred to as a chromosin, has been prepared from a great variety of cells, mainly animal but also plant and bacterial. A chromosin is derived from the cell nucleus. In the course of preparation precautions have been taken to prevent contamination by cytoplasmic constituents. To assure the nuclear origin of all components of chromosin, nuclei have in several instances been isolated before extraction was begun. Because of the precautions taken, chromosins do not contain detectable quantities of ribose nucleoproteins; but, incidentally, extraction of ribose nucleoproteins, free of desoxyribose compounds, has also been described in this paper. A typical chromosin contains 3 components: desoxyribose nucleic acid, histone, and non-histone protein. The nucleic acid, being highly polymerized, is exceedingly viscous when dissolved and fibrous when precipitated. Histone and non-histone protein differ from each other in a number of ways, of which one of the most definite is that whereas a histone contains no more than traces of tryptophane, the non-histone protein of chromosin contains nearly 1 per cent of tryptophane. In neutral physiological saline both proteins can combine with nucleic acid. With the isolation of chromosins from so many different kinds of cells, it can now be seen that (contrary to the view expressed by Kossel) histones are present in most animal cells and at least in some plant and bacterial cells. Chromosin prepared from the Type III pneumococcus is active in transforming the type of a pneumococcus culture. It has been pointed out that it is not yet known whether or not protein is a necessary constituent of the transforming agent. To extract chromosin from a cell M NaCl is used. When dissolved in M NaCl the nucleic acid and histone components of a chromosin are to a considerable extent dissociated. They are not dissociated when the chromosin is dissolved in 0.02 M NaCl, but in this medium a partial depolymerization of the nucleic acid occurs. A chromosin should certainly not be considered to be a definite chemical compound. It is a complex extracted from chromatin, which is itself a complicated nuclear structure. And in the course of extraction, it need hardly be said, the structure of chromatin has been considerably changed. To avoid complications it has been considered an advantage in this work to begin with isolated nuclei, and it would clearly be a further simplification to begin chemical procedures only after the chromosomes themselves have been isolated. This is now being accomplished, and it is found that the methods described in this paper are of value in learning how the substances present in a chromosin are put together in a chromosome.     

SCO Trimers as High-energy Materials? A Density Functional Study

Density functional calculations using the hybrid B3LYP functional have been carried out on the fragmentation reaction of cyclic SCO trimers. Analogous calculations for CO₂ and HNCO have also been performed for comparison. The energies of the different trimers relative to those of the isolated monomers as well as the energy barriers to fragmentation have been calculated. For all the calculations, a reaction path in which three bonds are simultaneously broken has been considered. It has been found that the fragmentation of cyclic SCO trimers is a rather facile process. The same statement applies to the cyclic CO₂ trimer but not to the HNCO one. In addition, the latter is much more stable than three free HNCO monomers, which is not the case for SCO and CO₂.     

Familial Juvenile Hyperuricaemic Nephropathy is not Such a Rare Genetic Metabolic Purine Disease in Britain

Renal disease is rare today in classic adult gout, and gout is rare in renal disease—especially in the young. Here we summarise studies in 158 patients from 31 kindreds diagnosed with familial juvenile hyperuricaemic nephropathy FJHN from a total of 230 kindred members studied in Great Britain. Some patients have been followed for up to 30 years, and allopurinol has ameliorated the progression of the renal disease in all 113 surviving members provided: 1. They have been diagnosed and treated sufficiently early.

2. Compliance with allopurinol treatment and diet has been as important as early recognition.

3. Hypertension has been rigorously controlled.

4. The use of oral contraceptives has been avoided, as has pregnancy in any female with a Glomelar Filtration Rate GFR <70 ml/min.

The question arising is: Why is FJHN the most prevalent genetic purine disorder diagnosed in Britain? Is it a lack of awareness which needs to be improved Europe-wide?     

Refolding and biophysical characterization of the Caulobacter crescentus copper resistance protein,PcoB: An outer membrane protein containing an intrinsically disordered domain

Copper cations play fundamental roles in biological systems, such as protein folding and stabilization, or enzymatic reactions. Although copper is essential to the cell, it can become cytotoxic if present in too high concentration. Organisms have therefore developed specific regulation mechanisms towards copper. This is the case of the Pco system present in the bacterium Caulobacter crescentus, which is composed of two proteins: a soluble periplasmic protein PcoA and an outer membrane protein PcoB. PcoA oxidizes Cu⁺ to Cu²⁺, whereas PcoB is thought to be an efflux pump for Cu²⁺. While the PcoA protein has already been studied, very little is known about the structure and function of PcoB. In the present work, PcoB has been overexpressed in high yield in E. coli strains and successfully refolded by the SDS-cosolvent method. Binding to divalent cations has also been studied using several spectroscopic techniques. In addition, a three-dimensional structure model of PcoB, experimentally supported by circular dichroism, has been constructed, showing a β-barrel conformation with a N-terminal disordered chain. This peculiar intrinsic disorder property has also been confirmed by various bioinformatic tools.     

Regulation and Manipulation of the Biosynthesis of Abscisic Acid, Including the Supply of Xanthophyll Precursors

Mutant plants deficient in the phytohormone abscisic acid (ABA) are typically unable to control their stomatal behavior appropriately in response to water stress, leading to a “wilty” phenotype. In plant species showing strong seed dormancy, ABA deficiency of the seed results in a second clearly recognizable phenotype, that is, early germination. Mutants selected by means of this latter character are often collectively termed “viviparous.” These two broad classes include mutants that are defective in their ability to synthesize ABA. A number of these genetic lesions have been assigned to specific steps in ABA biosynthesis and have been invaluable in elucidating many important features of the pathway. Most of the genes encoding ABA biosynthetic enzymes have now been cloned and their expression has been studied and manipulated. Genetically modified plants constitutively overexpressing ABA biosynthesis genes have been produced and analyzed over the last 6 years. In some cases these plants have been found to have elevated ABA concentrations, leading to altered stomatal behavior and increased seed dormancy. Genetic manipulation of ABA synthesis in photosynthetic tissues has been most effectively achieved through overexpression of the key rate-limiting biosynthetic enzyme 9-cis-epoxycarotenoid dioxygenase, and downregulation of the major catabolic enzyme ABA 8′-hydroxylase. However in non-photosynthetic tissue manipulation of ABA synthesis is a more complex task because of the limiting supply of xanthophyll precursors. The recent cloning of genes encoding enzymes controlling important pathways of ABA catabolism has been reviewed elsewhere, and so only information relevant to the regulation and manipulation of ABA synthesis, including supply of xanthophyll precursors, is discussed in this review.     

The location of parasites within their hosts: The influence of surgical manipulation of the intestine and mesenteric blood supply on the dispersion of Nippostrongylus brasiliensis in the rat

In the early stages of a primary infection with N. brasiliensis in rats, adults are characteristically located about one-third of the distance anad of the pyloric sphincter. As one of a series of experimental investigations of this phenomenon, surgical manipulation of the site has been attempted. The normal site has been surgically removed, it has been reversed while keeping the blood system intact and the mesenteric arterial and venous supply has been locally restricted. In no case did surgical intervention significantly lower the number of adult parasites. In all cases there was a shift from the normal dispersion to one more orad. It has been conclusively demonstrated that there is no specific structural or physiological factor in the normal site of N. brasiliensis, which is critical for its survival. All results indicate as proposed in an earlier paper, that N. brasiliensis is a lumenal dweller and is most frequently recovered from the intestinal contents.