共查询到20条相似文献，搜索用时 593 毫秒
1.
Wataru Yoshida Mizuki Terasaka Saowalak Laddachote Isao Karube 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(9):1933-1937
Background
DNA methylation at the 5-position of cytosine is an epigenetic modification of CpG dinucleotides. In addition to CpG methylation, the G-quadruplex (G4) structure has been reported as a regulator of gene expression. The identification of G4 forming sequences in CpG islands suggests an involvement of CpG-methylated G4 structures in biological processes; however, few reports have addressed the effects of CpG methylation on G4 structure.Methods
The thermostability of a methylated, 21-mer G4 structure located on the vascular endothelial growth factor (VEGF) gene promoter containing four CpG sites (C1, C6, C11, and C17) were investigated using circular dichroism (CD) spectral analysis.Results
CD melting analysis revealed that VEGF G4 was stabilized by a single CpG methylation on C11 in the presence of Na+ and Mg2+. However, either C1 or C11 methylation enhanced VEGF G4 thermal stability in the presence of K+.Conclusions
Single CpG methylation appears to enhance VEGF G4 thermostability in a manner dependent on both the CpG methylation site and cation type.General significance
These results are expected to contribute to the elucidation of the roles of CpG methylation-stabilized G4 structures in biological processes. 相似文献2.
I-Te Chu Chia-Chuan Wu Ta-Chau Chang 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(2):418-425
Background
Mitochondrial DNA (mtDNA) mutations could lead to mitochondrial dysfunction, which plays a major role in aging, neurodegeneration, and cancer. Recently, we have highlighted G-quadruplex (G4) formation of putative G4-forming (PQF) mtDNA sequences in cells. Herein, we examine structural variation of G4 formation due to mutation of mtDNA sequences in vitro.Methods
The combined circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE) results provide complementary insights into the structural variation of the studied G-rich sequence and its mutants.Results
This study illustrates the structural diversity of mt10251, a G-rich mtDNA sequence with a 16-nt loop, (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including the coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures of mt10251 in 20?mM K+ solution. Moreover, a single-base mutation of mt10251 can cause significant changes in terms of structural populations and polymorphism. In addition, single-base mutations of near-but-not-PQF sequences can potentially change not-G4 to G4 structures. We further found 124 modified PQF sequences due to single-base mutations of near-but-not-PQF sequences in mtDNA.Conclusions
Single-base mutations of mt10251 could make significant changes in its structural variation and some single-base mutated sequences in mtDNA could form G4 structures in vitro.General significance
We illustrate the importance of single-base mutations of DNA sequences to the change of G4 formation in vitro. The use of single-base mutations by generating the fourth G-tract and followed by selection in shortening the longest loop size in the near-but-not-PQF sequences was conducted for the G4 formation. 相似文献3.
Augusta De Santis Sara La Manna Irene Russo Krauss Anna Maria Malfitano Ettore Novellino Luca Federici Antonella De Cola Adele Di Matteo Gerardino D&#x;Errico Daniela Marasco 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(4):967-978
Background
Nucleophosmin-1 (NPM1) is an abundant multifunctional protein, implicated in a variety of biological processes and in the pathogenesis of several human malignancies. Its C-terminal domain (CTD) is endowed with a three helix bundle and we demonstrated that several regions within it, associated with acute myeloid leukemia (AML), have a strong tendency to form beta amyloid-like assemblies toxic for cells. The central helix of the bundle (H2) resulted the most amyloidgenic region; here we aim to model the cytoxicity processes of the H2 sequence and getting clues of a potential involvement in toxicity of the interaction between CTDs and cellular membranes.Methods
We investigated the interaction of CTD-NPM1 regions with model membranes through fluorescence, SPR, CD and ESR spectroscopies and the localization of NPM1 by immune-fluorescence in leukemic cells.Results
Our findings indicate that investigated regions are able to interact with membranes with different mechanisms and outlined the importance of the presence of cholesterol.Conclusions
H2 showed a preference of interaction with membrane containing cholesterol determining a sensitive fluidification of the bilayer, while N-term H2 causes a stiffening of central and outer regions of the lipid system. Noticeably, NPM1 mut A demonstrated to thicken at the plasma membrane, differently from wt. These findings were corroborated by diverse mechanisms of interaction of CTDs toward membrane models in vitro.General significance
This study suggests that the direct interaction of several regions of NPM1CTD with cellular membranes could be implicated in diseases where NPM1 is mutated and/or where its overexpression is cytoxic. 相似文献4.
5.
Hongbo Chen Hongxia Sun Yahong Chai Suge Zhang Aijiao Guan Qian Li Li Yao Yalin Tang 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(1):31-38
Background
G-quadruplex has been viewed as a promising therapeutic target in oncology due to its potentially important roles in physiological and pathological processes. Emerging evidence suggests that the biological functions of G-quadruplexes are closely related to the binding of some proteins. Insulin-like growth factor type I (IGF-1), as a significant modulator of cell growth and development, may serve as a quadruplex-binding protein.Methods
The binding affinity and selectivity of IGF-1 to different DNA motifs in solution were measured by using fluorescence spectroscopy, Surface Plasmon Resonance (SPR), and force-induced remnant magnetization (FIRM). The effects of IGF-1 on the formation and stability of G-quadruplex structures were evaluated by circular dichroism (CD) and melting fluorescence resonance energy transfer (FRET) spectroscopy. The influence of quadruplex-specific ligands on the binding of G-quadruplexes with IGF-1 was determined by FIRM.Results
IGF-1 shows a binding specificity for G-quadruplex structures, especially the G-quadruplex structure with a parallel topology. The quadruplex-specific ligands TMPyP4 and PDS (Pyridostatin) can inhibit the interaction between G-quadruplexes and proteins.Conclusions
IGF-1 is demonstrated to selectively bind with G-quadruplex structures. The use of quadruplex-interactive ligands could modulate the binding of IGF-1 to G-quadruplexes.General significance
This study provides us with a new perspective to understand the possible physiological relationship between IGF-1 and G-quadruplexes and also conveys a strategy to regulate the interaction between G-quadruplex DNA and proteins. 相似文献6.
Yuta Murakami Koichi Takahashi Kyoka Hoshi Hiromi Ito Mayumi Kanno Kiyoshi Saito Kenneth Nollet Yoshiki Yamaguchi Masakazu Miyajima Hajime Arai Yasuhiro Hashimoto Tatsuo Mima 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(8):1835-1842
Background
Spontaneous intracranial hypotension (SIH) is caused by cerebrospinal fluid (CSF) leakage. Definitive diagnosis can be difficult by clinical examinations and imaging studies.Methods
SIH was diagnosed with the following criteria: (i) evidence of CSF leakage by cranial magnetic resonance imaging (MRI) findings of intracranial hypotension and/or low CSF opening pressure; (ii) no recent history of dural puncture. We quantified CSF proteins by ELISA or Western blotting.Results
Comparing with non-SIH patients, SIH patients showed significant increase of brain-derived CSF glycoproteins such as lipocalin-type prostaglandin D synthase (L-PGDS), soluble protein fragments generated from amyloid precursor protein (sAPP) and “brain-type” transferrin (Tf). Serum-derived proteins such as albumin, immunoglobulin G, and serum Tf were also increased. A combination of L-PGDS and brain-type Tf differentiated SIH from non-SIH with sensitivity 94.7% and specificity 72.6%.Conclusion
L-PGDS and brain-type Tf can be biomarkers for diagnosing SIH.General significance
L-PGDS and brain-type Tf biosynthesized in the brain appears to be markers for abnormal metabolism of CSF. 相似文献7.
Veronica Esposito Annapina Russo Valentina Vellecco Mariarosaria Bucci Giulia Russo Luciano Mayol Antonella Virgilio Aldo Galeone 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(12):2645-2650
Background
Although the thrombin binding aptamer (TBA) is endowed with both anticoagulant and antiproliferative properties, it is possible to reduce the first and enhance the second one by suitable chemical modifications.Methods
Two oligonucleotides (TBA353 and TBA535) based on the TBA sequence (GGTTGGTGTGGTTGG) and containing inversion of polarity sites have been investigated by CD, UV and electrophoretic techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay), antiproliferative (MTT assay) and anti-motility (wound healing assay) properties against Calu-6 cells have been tested and compared with TBA.Results
CD, UV and electrophoresis data indicate that both ODNs are able to form G-quadruplex structures. Particularly, results suggest that TBA535 adopts a G-quadruplex structure characterized by a loop arrangement different from that of TBA. Both TBA analogues drop the anticoagulant activity. However, TBA535 is endowed with a significant antiproliferative activity against lung cancer Calu-6 cells. Importantly, both TBA and TBA535 possess a remarkable anti-motility property against the same cell line.Conclusions
Both TBA analogues TBA353 and TBA535 are able to form G-quadruplex structures with no anticoagulant activity. However only TBA535 is endowed with noteworthy antiproliferative and anti-motility properties against lung cancer Calu-6 cells.General significance
The switching from the anticoagulant to antiproliferative property can be obtained also in TBA derivatives not adopting the “chair-like” G-quadruplex structure typical of TBA. Furthermore, results have highlighted an unprecedented anti-cell-motility property of TBA and TBA535 reinforcing the potential of these ODNs as anticancer drugs. 相似文献8.
Huan He Juan Xu Wen Xie Qing-Lian Guo Feng-Lei Jiang Yi Liu 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(3):501-512
Background
CDK6 is considered as a highly validated anticancer drug target due to its essential role in regulating cell cycle progression at G1 restriction point. Activation of CDK6 requires the phosphorylation of Thr177 on A-loop, but the structural insights of the activation mechanism remain unclear.Methods
Herein, all-atoms molecular dynamics (MD) simulations were used to study the effects of Thr177 phosphorylation on the dynamic structure of CDK6-Vcyclin complex.Results
MD results indicated that the free energy barrier of the transition from open to closed state decreased ~ 47.2% after Thr177 phosphorylation. Key steps along the state transition process were obtained from a cluster analysis. Binding preference of ten different inhibitors to open or closed state were also investigated through molecular docking along with MD simulations methods.Conclusions
Our results indicated that Thr177 phosphorylation increased the flexibility around the ATP-binding pocket. The transition of the ATP-binding pocket between open and closed states should be considered for understanding the binding of CDK6 inhibitors.General significance
This work could deepen the understanding of CDKs activation mechanism, and provide useful information for the discovery of new CDKs inhibitors with high affinity and specificity. 相似文献9.
10.
11.
Pavlína Ptáčková Jan Musil Martin Štach Petr Lesný Šárka Němečková Vlastimil Král Milan Fábry Pavel Otáhal 《Cytotherapy》2018,20(4):507-520
Background aims
Clinical-grade chimeric antigenic receptor (CAR)19 T cells are routinely manufactured by lentiviral/retroviral (LV/RV) transduction of an anti-CD3/CD28 activated T cells, which are then propagated in a culture medium supplemented with interleukin (IL)-2. The use of LV/RVs for T-cell modification represents a manufacturing challenge due to the complexity of the transduction approach and the necessity of thorough quality control.Methods
We present here a significantly improved protocol for CAR19 T-cell manufacture that is based on the electroporation of peripheral blood mononuclear cells with plasmid DNA encoding the piggyBac transposon/transposase vectors and their cultivation in the presence of cytokines IL-4, IL-7 and IL-21.Results
We found that activation of the CAR receptor by either its cognate ligand (i.e., CD19 expressed on the surface of B cells) or anti-CAR antibody, followed by cultivation in the presence of cytokines IL-4 and IL-7, enables strong and highly selective expansion of functional CAR19 T cells, resulting in >90% CAR+ T cells. Addition of cytokine IL-21 to the mixture of IL-4 and IL-7 supported development of immature CAR19 T cells with central memory and stem cell memory phenotypes and expressing very low amounts of inhibitory receptors PD-1, LAG-3 and TIM-3.Conclusions
Our protocol provides a simple and cost-effective method for engineering high-quality T cells for adoptive therapies. 相似文献12.
Cristina Pérez-Arnaiz Natalia Busto Javier Santolaya José M. Leal Giampaolo Barone Begoña García 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(3):522-531
Background
Stabilization of G-quadruplex helices by small ligands has attracted growing attention because they inhibit the activity of the enzyme telomerase, which is overexpressed in > 80% cancer cells. TMPyP4, one of the most studied G-quadruplex ligands, is used as a model to show that the ligands can exhibit different binding features with different conformations of a human telomeric specific sequence.Methods
UV–Vis, FRET melting Assay, Isothermal Titration Calorimetry, Time-resolved Fluorescence lifetime, T-Jump and Molecular Dynamics.Results
TMPyP4 yields two different complexes with two Tel22 telomeric conformations in the presence of Na+ or K+. T-Jump kinetic experiments show that the rates of formation and dissociation of these complexes in the ms time scale differ by one order of magnitude. MD simulations reveal that, in K+ buffer, “hybrid 1” conformation yields kinetic constants on interaction with TMPyP4 one order lower than “hybrid 2”. The binding involves π–π stacking with external loop bases.Conclusions
For the first time we show that for a particular buffer TMPyP4 interacts in a kinetically different way with the two Tel22 conformations even if the complexes formed are thermodynamically indistinguishable.General significance
G-quadruplexes, endowed with technological applications and potential impact on regulation mechanisms, define a new research field. The possibility of building different conformations from same sequence is a complex issue that confers G-quadruplexes very interesting features. The obtaining of reliable kinetic data constitutes an efficient tool to determine reaction mechanisms between conformations and small molecules. 相似文献13.
Lei Li Ryan Z.L. Lim Lawrence S.U. Lee Nicholas S.Y. Chew 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(8):1790-1800
Background
HIV infection and/or the direct pathogenic effects of circulating HIV proteins impairs the physiological function of mesenchymal stem cells (MSCs), and contribute to the pathogenesis of age-related clinical comorbidities in people living with HIV. The SDF-1/CXCR4 pathway is vital for modulating MSC proliferation, migration and differentiation. HIV glycoprotein gp120 inhibits SDF-1 induced chemotaxis by downregulating the expression and function of CXCR4 in monocytes, B and T cells. The influence of gp120 on CXCR4 expression and migration in MSCs is unknown.Methods
We investigated CXCR4 expression and SDF-1/CXCR4-mediated MSC migration in response to gp120, and its effect on downstream signaling pathways: focal adhesion kinase (FAK)/Paxillin and extracellular signal-regulated kinase (ERK).Results
Gp120 upregulated MSC CXCR4 expression. This potentiated the effects of SDF-1 in inducing chemotaxis; FAK/Paxillin and ERK pathways were over-activated, thereby facilitating actin stress fiber reorganization. CXCR4 blockage or depletion abrogated the observed effects.Conclusion
Gp120 from both T- and M- tropic HIV strains upregulated CXCR4 expression in MSCs, resulting in enhanced MSC chemotaxis in response to SDF-1.General significance
HIV infection and its proteins are known to disrupt physiological differentiation of MSC; increased gp120-driven migration amplifies the total MSC population destined for ineffective and inappropriate differentiation, thus contributing to the pathogenesis of HIV-related comorbidities. Additionally, given that MSCs are permissive to HIV infection, initial cellular priming by gp120 results in increased expression of CXCR4 and could lead to co-receptor switching and cell tropism changes in chronic HIV infection and may have implications against CCR5-knockout based HIV cure strategies. 相似文献14.
Shruti Chakraborty Sayak Ganguli Aritra Chowdhury Michael Ibba Rajat Banerjee 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(8):1801-1809
Background
Under oxidative stress cytoplasmic aminoacyl-tRNA synthetase (aaRSs) substrate specificity can be compromised, leading to tRNA mischarging and mistranslation of the proteome. Whether similar processes occur in mitochondria, which are major cellular sources of reactive oxygen species (ROS), is unknown. However, relaxed substrate specificity in yeast mitochondrial phenylalanyl-tRNA synthetase (ScmitPheRS) has been reported to increase tRNA mischarging and blocks mitochondrial biogenesis.Methods
Non-reducing denaturing PAGE, cysteine reactivity studies, MALDI-TOF mass spectrometry, enzyme assay, western blot, growth assay, circular dichroism, dynamic light scattering and fluorescence spectroscopy were used to study the effect of oxidative stress on ScmitPheRS activity.Results
ScmitPheRS is reversibly inactivated under oxidative stress. The targets for oxidative inactivation are two conserved cysteine residues resulting in reversible intra-molecular disulfide bridge formation. Replacement of either conserved cysteine residue increased viability during growth under oxidative stress.Conclusion
Formation of intra-molecular disulfide bridge under oxidative stress hinders the tRNAPhe binding of the enzyme, thus inactivating ScmitPheRS reversibly.General significance
The ScmitPheRS activity is compromised under oxidative stress due to formation of intra-molecular disulfide bridge. The sensitivity of ScmitPheRS to oxidation may provide a protective mechanism against error-prone translation under oxidative stress. 相似文献15.
Sandra Peherstorfer Hans Henning Brewitz Ajay Abisheck Paul George Amelie Wißbrock Jana Maria Adam Lutz Schmitt Diana Imhof 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(9):1964-1972
Background
Tight regulation of heme homeostasis is a critical mechanism in pathogenic bacteria since heme functions as iron source and prosthetic group, but is also toxic at elevated concentrations. Hemolysin-activating lysine-acyltransferase (HlyC) from Escherichia coli is crucial for maturation of hemolysin A, which lyses several mammalian cells including erythrocytes liberating large amounts of heme for bacterial uptake. A possible impact and functional consequences of the released heme on events employing bacterial HlyC have remained unexplored.Methods
Heme binding to HlyC was investigated using UV/vis and SPR spectroscopy. Functional impact of heme association was examined using an in vitro hemolysis assay. The interaction was further studied by homology modeling, molecular docking and dynamics simulations.Results
We identified HlyC as potential heme-binding protein possessing heme-regulatory motifs. Using wild-type protein and a double alanine mutant we demonstrated that heme binds to HlyC via histidine 151 (H151). We could show further that heme inhibits the enzymatic activity of wild-type HlyC. Computational studies illustrated potential interaction sites in addition to H151 confirming the results from spectroscopy indicating more than one heme-binding site.Conclusions
Taken together, our results reveal novel insights into heme-protein interactions and regulation of a component of the heme uptake system in one of the major causative agents of urinary tract infections in humans.General significance
This study points to a possible novel mechanism of regulation as present in many uropathogenic E. coli strains at an early stage of heme iron acquisition from erythrocytes for subsequent internalization by the bacterial heme-uptake machinery. 相似文献16.
Hasan Alniss Bita Zamiri Melisa Khalaj Christopher E. Pearson Robert B. Macgregor 《Biochemical and biophysical research communications》2018,495(4):2410-2417
Background
An expansion of the hexanucleotide repeat (GGGGCC)n·(GGCCCC)n in the C9orf72 promoter has been shown to be the cause of Amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). The C9orf72 repeat can form four-stranded structures; the cationic porphyrin (TMPyP4) binds and distorts these structures.Methods
Isothermal titration calorimetry (ITC), and circular dichroism (CD) were used to study the binding of TMPyP4 to the C-rich and G-rich DNA and RNA oligos containing the hexanucleotide repeat at pH 7.5 and 0.1?M?K+.Results
The CD spectra of G-rich DNA and RNA TMPyP4 complexes showed features of antiparallel and parallel G-quadruplexes, respectively. The shoulder at 260?nm in the CD spectrum becomes more intense upon formation of complexes between TMPyP4 and the C-rich DNA. The peak at 290?nm becomes more intense in the c-rich RNA molecules, suggesting induction of an i-motif structure. The ITC data showed that TMPyP4 binds at two independent sites for all DNA and RNA molecules.Conclusions
For DNA, the data are consistent with TMPyP4 stacking on the terminal tetrads and intercalation. For RNA, the thermodynamics of the two binding modes are consistent with groove binding and intercalation. In both cases, intercalation is the weaker binding mode. These findings are considered with respect to the structural differences of the folded DNA and RNA molecules and the energetics of the processes that drive site-specific recognition by TMPyP4; these data will be helpful in efforts to optimize the specificity and affinity of the binding of porphyrin-like molecules. 相似文献17.
Yi-Jun Li Feng-Xin Yin Xin-Ke Zhang Jie Yu Shuang Zheng Xin-Lei Song Feng-Shan Wang Ju-Zheng Sheng 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(3):547-556
Background
The final structure of heparan sulfate chains is strictly regulated in vivo, though the biosynthesis is not guided by a template process. N-deacetylase/N-sulfotransferase (NDST) is the first modification enzyme in the HS biosynthetic pathway. The N-sulfo groups introduced by NDST are reportedly involved in determination of the susceptibility to subsequent processes catalyzed by C5-epimerse and 3-O-sulfotransferases. Understanding the substrate specificities of the four human NDST isoforms has become central to uncovering the regulatory mechanism of HS biosynthesis.Methods
Highly-purified recombinant NDST-4 (rNDST-4) and a selective library of structurally-defined oligosaccharides were employed to determine the substrate specificity of rNDST-4.Results
Full-length rNDST-4 lacks obvious N-deacetylase activity, and displays only N-sulfotransferase activity. Unlike NDST-1, NDST-4 did not show directional N-sulfotransferase activity while the N-deacetylase domain was inactive.Conclusion and general significance
Individual NDST-4 could not effectively assume the key role in the distribution of N-S domains and N-Ac domains in HS biosynthesis in vivo. 相似文献18.
Chunxia Qiao Xiaoling Lang Longlong Luo Shusheng Geng Ming Lv Jing Geng Xinying Li Jiannan Feng Beifen Shen Yan Li 《Biotechnology letters》2017,39(9):1309-1323
Objectives
To find a “me-better” antibody by epitope-specific antibody optimization and multi-parametric analysis.Results
Using epitope-specific library based on the commercial drug, Pertuzumab/2C4, we screened a novel human anti-HER2 antibody, MIL5, which has slightly higher affinity than the drug. MIL5 and 2C4 share the same epitope to bind HER2; however, MIL5 bound to HER2 His235–His245 more tightly than 2C4, which could be the main reason of its enhanced affinity. In vivo experiments also showed MIL5 had stronger anti-cancer activity than 2C4; however, the classical flow cytometry assays to detect cell apoptosis or cycling did not show convincing evidence of the advantages of MIL5. Thus we introduced the multi-parameter in-cell analysis method to evaluate the superiority of MIL5 to 2C4 in arresting cancer cells in G2-phase to inhibit cell growth and/or proliferation.Conclusion
Multi-parametric method confirmed stronger arrest of G2 by MIL5 to show better anti-cancer function both in vitro and in vivo than 2C4.19.
Ehsan Alirahimi Fatemeh Kazemi-Lomedasht Delavar Shahbazzadeh Mahdi Habibi-Anbouhi Mohammad Hosseininejad Chafi Nazli Sotoudeh Hajarossadat Ghaderi Serge Muyldermans Mahdi Behdani 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(12):2955-2965
Background
An effective therapy against envenoming should be a priority in view of the high number scorpion stings and snakebites. Serum therapy is still widely applied to treat the envenomation victims; however this approach suffers from several shortcomings. The employment of monoclonal antibodies might be an outcome as these molecules are at the core of a variety of applications from protein structure determination to cancer treatment. The progress of activities in the twilight zone between genetic and antibody engineering have led to the development of a unique class of antibody fragments. These molecules possess several benefits and lack many possible disadvantages over classical antibodies. Within recombinant antibody formats, nanobodies or single domain antigen binding fragments derived from heavy chain only antibodies in camelids occupy a privileged position.Scope of review
In this paper we will briefly review the common methods of envenomation treatment and focus on details of various in vivo research activities that investigate the performance of recombinant, monoclonal nanobodies in venom neutralization.Major conclusions
Nanobodies bind to their cognate target with high specificity and affinity, they can be produced in large quantities from microbial expression systems and are very robust even when challenged with harsh environmental conditions. Upon administering, they rapidly distribute throughout the body and seem to be well tolerated in humans posing low immunogenicity.General significance
Scorpion and snake envenomation is a major issue in developing countries and nanobodies as a venom-neutralizing agent can be considered as a valuable and promising candidate in envenomation therapy. 相似文献20.
Xiu-Mei Wang Shi-Chao Fan Yao Chen Xiao-Feng Ma Rong-Qiao He 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(2):379-383