共查询到20条相似文献，搜索用时 15 毫秒
1.
Annika Wahl Silva Kasela Elena Carnero-Montoro Maarten van Iterson Jerko Štambuk Sapna Sharma Erik van den Akker Lucija Klaric Elisa Benedetti Genadij Razdorov Irena Trbojević-Akmačić Frano Vučković Ivo Ugrina Marian Beekman Joris Deelen Diana van Heemst Bastiaan T. Heijmans Christian Gieger 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(3):637-648
Background
Glycosylation is one of the most common post-translation modifications with large influences on protein structure and function. The effector function of immunoglobulin G (IgG) alters between pro- and anti-inflammatory, based on its glycosylation. IgG glycan synthesis is highly complex and dynamic.Methods
With the use of two different analytical methods for assessing IgG glycosylation, we aim to elucidate the link between DNA methylation and glycosylation of IgG by means of epigenome-wide association studies. In total, 3000 individuals from 4 cohorts were analyzed.Results
The overlap of the results from the two glycan measurement panels yielded DNA methylation of 7 CpG-sites on 5 genomic locations to be associated with IgG glycosylation: cg25189904 (chr.1, GNG12); cg05951221, cg21566642 and cg01940273 (chr.2, ALPPL2); cg05575921 (chr.5, AHRR); cg06126421 (6p21.33); and cg03636183 (chr.19, F2RL3). Mediation analyses with respect to smoking revealed that the effect of smoking on IgG glycosylation may be at least partially mediated via DNA methylation levels at these 7 CpG-sites.Conclusion
Our results suggest the presence of an indirect link between DNA methylation and IgG glycosylation that may in part capture environmental exposures.General significance
An epigenome-wide analysis conducted in four population-based cohorts revealed an association between DNA methylation and IgG glycosylation patterns. Presumably, DNA methylation mediates the effect of smoking on IgG glycosylation. 相似文献2.
Dunja Urbančič Anita Kotar Alenka Šmid Marko Jukič Stanislav Gobec Lars-Göran Mårtensson Janez Plavec Irena Mlinarič-Raščan 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(1):182-190
Background
Methylation driven by thiopurine S-methylatransferase (TPMT) is crucial for deactivation of cytostatic and immunosuppressant thiopurines. Despite its remarkable integration into clinical practice, the endogenous function of TPMT is unknown.Methods
To address the role of TPMT in methylation of selenium compounds, we established the research on saturation transfer difference (STD) and 77Se NMR spectroscopy, fluorescence measurements, as well as computational molecular docking simulations.Results
Using STD NMR spectroscopy and fluorescence measurements of tryptophan residues in TPMT, we determined the binding of selenocysteine (Sec) to human recombinant TPMT. By comparing binding characteristics of Sec in the absence and in the presence of methyl donor, we confirmed S-adenosylmethionine (SAM)-induced conformational changes in TPMT. Molecular docking analysis positioned Sec into the active site of TPMT with orientation relevant for methylation reaction. Se-methylselenocysteine (MeSec), produced in the enzymatic reaction, was detected by 77Se NMR spectroscopy. A direct interaction between Sec and SAM in the active site of rTPMT and the formation of both products, MeSec and S-adenosylhomocysteine, was demonstrated using NMR spectroscopy.Conclusions
The present study provides evidence on in vitro methylation of Sec by rTPMT in a SAM-dependant manner.General significance
Our results suggest novel role of TPMT and demonstrate new insights into enzymatic modifications of the 21st amino acid. 相似文献3.
I-Te Chu Chia-Chuan Wu Ta-Chau Chang 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(2):418-425
Background
Mitochondrial DNA (mtDNA) mutations could lead to mitochondrial dysfunction, which plays a major role in aging, neurodegeneration, and cancer. Recently, we have highlighted G-quadruplex (G4) formation of putative G4-forming (PQF) mtDNA sequences in cells. Herein, we examine structural variation of G4 formation due to mutation of mtDNA sequences in vitro.Methods
The combined circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE) results provide complementary insights into the structural variation of the studied G-rich sequence and its mutants.Results
This study illustrates the structural diversity of mt10251, a G-rich mtDNA sequence with a 16-nt loop, (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including the coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures of mt10251 in 20?mM K+ solution. Moreover, a single-base mutation of mt10251 can cause significant changes in terms of structural populations and polymorphism. In addition, single-base mutations of near-but-not-PQF sequences can potentially change not-G4 to G4 structures. We further found 124 modified PQF sequences due to single-base mutations of near-but-not-PQF sequences in mtDNA.Conclusions
Single-base mutations of mt10251 could make significant changes in its structural variation and some single-base mutated sequences in mtDNA could form G4 structures in vitro.General significance
We illustrate the importance of single-base mutations of DNA sequences to the change of G4 formation in vitro. The use of single-base mutations by generating the fourth G-tract and followed by selection in shortening the longest loop size in the near-but-not-PQF sequences was conducted for the G4 formation. 相似文献4.
Sara Lago Matteo Nadai Monica Rossetto Sara N. Richter 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(6):1276-1282
Background
G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens.Methods
SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures.Results
The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability.Conclusions
Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells.General significance
The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. 相似文献5.
6.
Shruti Chakraborty Sayak Ganguli Aritra Chowdhury Michael Ibba Rajat Banerjee 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(8):1801-1809
Background
Under oxidative stress cytoplasmic aminoacyl-tRNA synthetase (aaRSs) substrate specificity can be compromised, leading to tRNA mischarging and mistranslation of the proteome. Whether similar processes occur in mitochondria, which are major cellular sources of reactive oxygen species (ROS), is unknown. However, relaxed substrate specificity in yeast mitochondrial phenylalanyl-tRNA synthetase (ScmitPheRS) has been reported to increase tRNA mischarging and blocks mitochondrial biogenesis.Methods
Non-reducing denaturing PAGE, cysteine reactivity studies, MALDI-TOF mass spectrometry, enzyme assay, western blot, growth assay, circular dichroism, dynamic light scattering and fluorescence spectroscopy were used to study the effect of oxidative stress on ScmitPheRS activity.Results
ScmitPheRS is reversibly inactivated under oxidative stress. The targets for oxidative inactivation are two conserved cysteine residues resulting in reversible intra-molecular disulfide bridge formation. Replacement of either conserved cysteine residue increased viability during growth under oxidative stress.Conclusion
Formation of intra-molecular disulfide bridge under oxidative stress hinders the tRNAPhe binding of the enzyme, thus inactivating ScmitPheRS reversibly.General significance
The ScmitPheRS activity is compromised under oxidative stress due to formation of intra-molecular disulfide bridge. The sensitivity of ScmitPheRS to oxidation may provide a protective mechanism against error-prone translation under oxidative stress. 相似文献7.
Seong-Cheol Park Il Ryong Kim Jin-Young Kim Yongjae Lee Eun-Ji Kim Ji Hyun Jung Young Jun Jung Mi-Kyeong Jang Jung Ro Lee 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(12):2545-2554
Background
It remains an open question whether plant phloem sap proteins are functionally involved in plant defense mechanisms.Methods
The antifungal effects of two profilin proteins from Arabidopsis thaliana, AtPFN1 and AtPFN2, were tested against 11 molds and 4 yeast fungal strains. Fluorescence profiling, biophysical, and biochemical analyses were employed to investigate their antifungal mechanism.Results
Recombinant AtPFN1 and AtPFN2 proteins, expressed in Escherichia coli, inhibited the cell growth of various pathogenic fungal strains at concentrations ranging from 10 to 160?μg/mL. The proteins showed significant intracellular accumulation and cell-binding affinity for fungal cells. Interestingly, the AtPFN proteins could penetrate the fungal cell wall and membrane and act as inhibitors of fungal growth via generation of cellular reactive oxygen species and mitochondrial superoxide. This triggered the AtPFN variant-induced cell apoptosis, resulting in morphological changes in the cells.Conclusion
PFNs may play a critical role as antifungal proteins in the Arabidopsis defense system against fungal pathogen attacks.General significance
The present study indicates that two profilin proteins, AtPFN1 and AtPFN2, can act as natural antimicrobial agents in the plant defense system. 相似文献8.
Xuejing Jia Yeer Liang Chao Zhang Kai Wang Yanbei Tu Meiwan Chen Peng Li Jian-Bo Wan Chengwei He 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(8):1751-1759
Background
Polysaccharides, one of the active ingredients in herbal medicine, are proved to enhance innate immunity against infections. The aim of this study is to explore the immunoregulatory ability of polysaccharides from Rhynchosia minima root in vitro and in vivo.Methods
Polysaccharide fractions of R. minima root were obtained by chromatographic column. The content of NO was measured by spectrophotometry. The levels of cytokines (tumor necrosis factor-α, TNF-α; interleukin-6, IL-6; and monocyte chemoattractant protein-1, MCP-1) were determined by enzyme-linked immuno-sorbent assay (ELISA) kits. The translocation of p65 into the nucleus was imaged by confocal microscopy. The mRNA expression of TNF-α, IL-6, and MCP-1 was determined by quantitative real-time PCR. T-lymphocyte subgroups of spleen from immunosuppressive mouse were evaluated by flow cytometry.Results
PRM3 remarkably enhanced the phagocytic ability of macrophages and promoted the release of NO and the secretion of cytokines (TNF-α, IL-6, and MCP-1) from macrophages. Simultaneously, PRM3 potently activated NF-κB signaling pathway via Toll-like receptor 4 (TLR4). In addition, PRM3 obviously increased the levels of serum cytokines, markedly up-regulated the percentages of CD3+ and CD4+ T lymphocytes and the CD4+/CD8+ ratio of splenocytes, and effectively attenuated cyclophosphamide induced immunosuppression in mice.Conclusions
PRM3 profoundly enhanced the immune function in vitro and in vivo through TLR4-NF-κB pathway and is a promising candidate of immunopotentiator which could be applied in functional foods or drugs.General significance
This study reported a polysaccharide PRM3 from R. minima root exhibited potent immunoenhancing activity and significantly alleviated cyclophosphamide-induced immunosuppression through TLR4-NF-κB pathway. 相似文献9.
Yi-Jun Li Feng-Xin Yin Xin-Ke Zhang Jie Yu Shuang Zheng Xin-Lei Song Feng-Shan Wang Ju-Zheng Sheng 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(3):547-556
Background
The final structure of heparan sulfate chains is strictly regulated in vivo, though the biosynthesis is not guided by a template process. N-deacetylase/N-sulfotransferase (NDST) is the first modification enzyme in the HS biosynthetic pathway. The N-sulfo groups introduced by NDST are reportedly involved in determination of the susceptibility to subsequent processes catalyzed by C5-epimerse and 3-O-sulfotransferases. Understanding the substrate specificities of the four human NDST isoforms has become central to uncovering the regulatory mechanism of HS biosynthesis.Methods
Highly-purified recombinant NDST-4 (rNDST-4) and a selective library of structurally-defined oligosaccharides were employed to determine the substrate specificity of rNDST-4.Results
Full-length rNDST-4 lacks obvious N-deacetylase activity, and displays only N-sulfotransferase activity. Unlike NDST-1, NDST-4 did not show directional N-sulfotransferase activity while the N-deacetylase domain was inactive.Conclusion and general significance
Individual NDST-4 could not effectively assume the key role in the distribution of N-S domains and N-Ac domains in HS biosynthesis in vivo. 相似文献10.
Eric A. Johnson Miranda M. Russo Dillon B. Nye Jamie L. Schlessman Juliette T.J. Lecomte 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(12):2660-2673
Background
The nuclear genome of Chlamydomonas reinhardtii encodes a dozen hemoglobins of the truncated lineage. Four of these, named THB1–4, contain a single ~130-residue globin unit. THB1, which is cytoplasmic and capable of nitric oxide dioxygenation activity, uses a histidine and a lysine as axial ligands to the heme iron. In the present report, we compared THB2, THB3, and THB4 to THB1 to gain structural and functional insights into algal globins.Methods
We inspected properties of the globin domains prepared by recombinant means through site-directed mutagenesis, electronic absorption, CD, and NMR spectroscopies, and X-ray crystallography.Results
Recombinant THB3, which lacks the proximal histidine but has a distal histidine, binds heme weakly. NMR data demonstrate that the recombinant domains of THB2 and THB4 coordinate the ferrous heme iron with the proximal histidine and a lysine from the distal helix. An X-ray structure of ferric THB4 confirms lysine coordination. THB1, THB2, and THB4 have reduction potentials between ?65 and ?100 mV, are capable of nitric oxide dioxygenation, are reduced at different rates by the diaphorase domain of C. reinhardtii nitrate reductase, and show different response to peroxide treatment.Conclusions
Three single-domain C. reinhardtii hemoglobins use lysine as a distal heme ligand in both Fe(III) and Fe(II) oxidation states. This common feature is likely related to enzymatic activity in the management of reactive oxygen species.General significance
Primary structure analysis of hemoglobins has limited power in the prediction of heme ligation. Experimental determination reveals variations in this essential property across the superfamily. 相似文献11.
Beata Gąsowska-Bajger Yuki Nishigaya Krystyna Hirsz-Wiktorzak Anna Rybczyńska Toshimasa Yamazaki Hubert Wojtasek 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(7):1626-1634
Background
A number of compounds, including ascorbic acid, catecholamines, flavonoids, p-diphenols and hydrazine derivatives have been reported to interfere with peroxidase-based medical diagnostic tests (Trinder reaction) but the mechanisms of these effects have not been fully elucidated.Methods
Reactions of bovine myeloperoxidase with o-dianisidine, bovine lactoperoxidase with ABTS and horseradish peroxidase with 4-aminoantipyrine/phenol in the presence of carbidopa, an anti-Parkinsonian drug, and other catechols, including l-dopa, were monitored spectrophotometrically and by measuring hydrogen peroxide consumption.Results
Chromophore formation in all three enzyme/substrate systems was blocked in the presence of carbidopa and other catechols. However, the rates of hydrogen peroxide consumption were not much affected. Irreversible enzyme inhibition was also insignificant.Conclusions
Tested compounds reduced the oxidation products or intermediates of model substrates thus preventing chromophore formation. This interference may affect interpretation of results of diagnostic tests in samples from patients with Parkinson's disease treated with carbidopa and l-dopa.General significance
This mechanism allows prediction of interference in peroxidase-based diagnostic tests for other compounds, including drugs and natural products. 相似文献12.
Yuta Murakami Koichi Takahashi Kyoka Hoshi Hiromi Ito Mayumi Kanno Kiyoshi Saito Kenneth Nollet Yoshiki Yamaguchi Masakazu Miyajima Hajime Arai Yasuhiro Hashimoto Tatsuo Mima 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(8):1835-1842
Background
Spontaneous intracranial hypotension (SIH) is caused by cerebrospinal fluid (CSF) leakage. Definitive diagnosis can be difficult by clinical examinations and imaging studies.Methods
SIH was diagnosed with the following criteria: (i) evidence of CSF leakage by cranial magnetic resonance imaging (MRI) findings of intracranial hypotension and/or low CSF opening pressure; (ii) no recent history of dural puncture. We quantified CSF proteins by ELISA or Western blotting.Results
Comparing with non-SIH patients, SIH patients showed significant increase of brain-derived CSF glycoproteins such as lipocalin-type prostaglandin D synthase (L-PGDS), soluble protein fragments generated from amyloid precursor protein (sAPP) and “brain-type” transferrin (Tf). Serum-derived proteins such as albumin, immunoglobulin G, and serum Tf were also increased. A combination of L-PGDS and brain-type Tf differentiated SIH from non-SIH with sensitivity 94.7% and specificity 72.6%.Conclusion
L-PGDS and brain-type Tf can be biomarkers for diagnosing SIH.General significance
L-PGDS and brain-type Tf biosynthesized in the brain appears to be markers for abnormal metabolism of CSF. 相似文献13.
Brunna Xavier Martins Raul Ferraz Arruda Gildeíde Aparecida Costa Hassan Jerdy Sávio Bastos de Souza Julianna Maria Santos William Rodrigues de Freitas Milton Masahiko Kanashiro Eulógio Carlos Queiroz de Carvalho Nadir Francisca Sant&#x;Anna Fernanda Antunes Raul Martinez-Zaguilan Sennoune Souad Anna Lvovna Okorokova-Fa?anha Arnoldo Rocha Fa?anha 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(1):1-12
Background
Metastatic tumor cells have acidic extracellular pH and differential electrochemical H+ gradients generated across their cell membranes by V-type H+-ATPases. This study shows that inhibition of the V-ATPases by the plant-derived monoterpene Myrtenal results in tumor cell death and decreased metastatic dissemination in mice.Methods
The Myrtenal anticancer toxicity was evaluated in vitro using murine (B16F0 and B16F10) and human (SkMel-5) melanoma cell lines, and in in vivo mouse metastatic dissemination model. Proton flux and extracellular acidification were directly evaluated at the surface of living cells using a non-invasive selective ion electrode approach.Results
The inhibition of V-ATPases by 100?μM Myrtenal disrupted the electrochemical H+ gradient across the cell membranes, strongly induced cell death (4–5 fold), and decreased tumor cells migration and invasion in vitro. Myrtenal (15?mg/kg) also significantly reduced metastasis induced by B16F10 in vivo, further reinforcing that V-ATPase is a molecular target to halt the progression of cancers.Conclusions
These data revealed the therapeutic potential of Myrtenal as inhibitor of melanoma progression proposing a mechanism of action by which once inhibited by this monoterpene the proton pumps fail to activate cancer-related differential electrochemical gradients and H+ fluxes across the tumor cell membranes, disrupting pH signatures inherent in tumor progression, resulting in reprogrammed cell death and metastasis inhibition.General significance
The work represents a new mechanistic strategy for contention of melanoma, the most aggressive and deadly form of cutaneous neoplasm, and highlights Myrtenal, other related monoterpenes and derivatives as promising proton pump inhibitors with high chemotherapeutic potential. 相似文献14.
Bita Zamiri Mila Mirceta Rashid Abu-Ghazalah Marc S. Wold Christopher E. Pearson Robert B. Macgregor 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(6):1482-1491
Background
Expansion of the C9orf72 hexanucleotide repeat (GGGGCC)n·(GGCCCC)n is the most common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Both strands of the C9orf72 repeat have been shown to form unusual DNA and RNA structures that are thought to be involved in mutagenesis and/or pathogenesis. We previously showed that the C-rich DNA strands from the C9orf72 repeat can form four-stranded quadruplexes at neutral pH. The cytosine residues become protonated under slightly acidic pH (pH?4.5–6.2), facilitating the formation of intercalated i-motif structures.Methods
Using CD spectroscopy, UV melting, and gel electrophoresis, we demonstrate a pH-induced structural transition of the C-rich DNA strand of the C9orf72 repeat at pHs reported to exist in living cells under stress, including during neurodegeneration and cancer.Results
We show that the repeats with lengths of 4, 6, and 8?units, form intercalated quadruplex i-motifs at low pH (pH?<?5) and monomolecular hairpins and monomolecular quadruplexes under neutral-basic conditions (pH?≥?8). Furthermore, we show that the human replication protein A (RPA) binds to the G-rich and C-rich DNA strands under acidic conditions, suggesting that it can bind to i-motif structures.Conclusions
In the proper sequence context, i-motif structures can form at pH values found in some cells in vivo.General significance
DNA conformational plasticity exists over broad range of solution conditions. 相似文献15.
Tae Sup Lee Young Kim Weiqi Zhang In Ho Song Ching-Hsuan Tung 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(5):1091-1100
Background
Exosomes are nano-sized vesicles derived from the fusion of multivesicular bodies with the surrounding plasma membrane. Exosomes have various diagnostic and therapeutic potentials in cancer and other diseases, thus tracking exosomes is an important issue.Methods
Here, we report a facile exosome labeling strategy using a natural metabolic incorporation of an azido-sugar into the glycan, and a strain-promoted azide-alkyne click reaction. In culture, tetra-acetylated N-azidoacetyl-D-mannosamine (Ac4ManNAz) was spontaneously incorporated into glycans within the cells and later redistributed onto their exosomes. These azido-containing exosomes were then labeled with azadibenzylcyclooctyne (ADIBO)-fluorescent dyes by a bioorthogonal click reaction.Results
Cellular uptake and the in vivo tracking of fluorescent labeled exosomes were evaluated in various cells and tumor bearing mice. Highly metastatic cancer-derived exosomes showed an increased self-homing in vitro and selective organ distribution in vivo.Conclusion
Our metabolic exosome labeling strategy could be a promising tool in studying the biology and distribution of exosomes, and optimizing exosome based therapeutic approaches.General significant
A facile and effective exosome labeling strategy was introduced by presenting azido moiety on the surface of exosome through metabolic glycan synthesis, and then conjugating a strain-promoted fluorescent dye. 相似文献16.
Stella A. Child Vanessa P. Rossi Stephen G. Bell 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(2):408-417
Background
Cyp147G1 is one of 47 cytochrome P450 encoding genes in Mycobacterium marinum M, a pathogenic bacterium with a high degree of sequence similarity to Mycobacterium tuberculosis and Mycobacterium ulcerans. Cyp147G1 is one of only two of these cyp genes which are closely associated with a complete electron transfer system.Methods
The substrate range of the enzyme was tested in vitro and the activity of CYP147G1 was reconstituted in vivo by co-producing the P450 with the ferredoxin and ferredoxin reductase.Results
Substrates of CYP147G1 include fatty acids ranging from octanoic to hexadecanoic acid. CYP147G1 catalysed the selective hydroxylation of linear and ω-2 methyl branched fatty acids at the ω-1 position (≥ 98%). Oxidation of ω-1 methyl branched fatty acids generated the ω and ω-1 hydroxylation products in almost equal proportions, indicating altered position of hydrogen abstraction.Conclusions
This selectivity of fatty acid hydroxylation inferred that linear species must bind in the active site of the enzyme with the terminal methyl group sequestered so that abstraction at the CH bonds of the ω-1 position is favoured. With branched substrates, one of the methyl groups must be close to the compound I oxygen atom and enable hydroxylation at the terminal methyl group to compete with the reaction at the ω-1CH bond.General significance
Hydroxy fatty acids are widely used for industrial, food and medical purposes. CYP147G1 demonstrates high regioselectivity for hydroxylation at a sub-terminal position on a broad range of linear fatty acids, not seen in other CYP enzymes. 相似文献17.
V. Guru KrishnaKumar Lokesh Baweja Krittika Ralhan Sharad Gupta 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(12):2590-2604
Background
Carbamylation is a non-enzymatic post-translational modification (PTM), which involves the covalent modification of N-terminus of protein or ε-amino group of Lys. The role of carbamylation in several age-related disorders is well documented, however, the relationship between carbamylation and neurodegenerative disorders including Alzheimer's disease remains uncharted.Methods
In the present study, using aggregation-prone tau-core hexapeptide fragments 306VQIVYK311 (PHF6) and 275VQIINK280 (PHF6*) as models, we have elucidated the effect of carbamylation on aggregation kinetics and the changes occurring in the 3-dimensional architecture of fibrils using biophysical assays and molecular dynamics simulations.Results
We found that carbamylation aids in amyloid formation and can convert the unstructured off-pathway aggregates into robust amyloids, which were toxic to cells. Electron microscopy images and molecular dynamics simulations of PHF6 fibrils showed that carbamylated peptides can form excess hydrogen bonds and modulate the pitch length and twist of peptides fibrils. We have also compared N-terminal carbamylation to acetylation and further extended our finding to full length tau that exhibits aggregation upon carbamylation even in the absence of any external inducer.Conclusion
Our in vitro and in silico results together suggest that carbamylation can modulate the aggregation pathway of the amyloidegenic sequences and cause structural changes in fibril assemblies.General significance
Carbamylation acts as a switch, which triggers the aggregation in short amyloidogenic peptide fragments and modulate the structural changes in resulting amyloid fibrils. 相似文献18.
Harleen Kaur 《Biochimica et Biophysica Acta (BBA)/General Subjects》2018,1862(10):2323-2329
19.
20.
Flavien Zannini Anna Moseler Raphaël Bchini Tiphaine Dhalleine Andreas J. Meyer Nicolas Rouhier Jérémy Couturier 《Biochimica et Biophysica Acta (BBA)/General Subjects》2019,1863(2):426-436