Nuclear magnetic resonance structural studies of intramolecular purine.purine.pyrimidine DNA triplexes in solution. Base triple pairing alignments and strand direction

Recently, P.A. Beal and P.B. Dervan, expanding on earlier observations by others, have established the formation of purine.purine.pyrimidine triple helices stabilized by G.GC, A.AT and T.AT base triples where the purine-rich third strand was positioned in the major groove of the Watson-Crick duplex and anti-parallel to its purine strand. The present nuclear magnetic resonance (n.m.r.) study characterizes the base triple pairing alignments and strand direction in a 31-mer deoxyoligonucleotide that intramolecularly folds to generate a 7-mer (R/Y-)n.(R+)n(Y-)n triplex with the strands linked by two T5 loops and stabilized by potential T.AT and G.GC base triples. (R and Y stand for purine and pyrimidine, respectively, while the signs establish the strand direction.) This intramolecular triplex gives well-resolved exchangeable and non-exchangeable proton spectra with Li+ as counterion in aqueous solution. These studies establish that the T1 to C7 pyrimidine and the G8 to A14 purine strands are anti-parallel to each other and align through Watson-Crick A.T and G.C pair formation. The T15 to G21 purine-rich third strand is positioned in the major groove of this duplex and pairs through Hoogsteen alignment with the purine strand to generate T.AT and G.GC triples. Several lines of evidence establish that the thymidine and guanosine bases in the T15 to G21 purine-rich third strand adopt anti glycosidic torsion angles under conditions where this strand is aligned anti-parallel to the G8 to A14 purine strand. We have also recorded imino proton n.m.r. spectra for an (R-)n.(R+)n(Y-)n triplex stabilized by G.GC and A.AT triples through intramolecular folding of a related 31-mer deoxyoligonucleotide with Li+ as counterion. The intramolecular purine.purine.pyrimidine triplexes containing unprotonated G.GC, A.AT and T.AT triples are stable at basic pH in contrast to pyrimidine.purine.pyrimidine triplexes containing protonated C+.GC and T.AT triples, which are only stable at acidic pH.     

Single-Stranded DNA and RNA Targeted Triplex-Formation: UV,CD and Molecular Modeling Studies of Foldback Triplexes Containing Different RNA, 2′-OMe-RNA and DNA Strand Combinations

Abstract

We studied the influence of different 2′-OMe-RNA and DNA strand combinations on single strand targeted foldback triplex formation in the Py.Pu:Py motif using ultraviolet (UV) and circular dichroism (CD) spectroscopy, and molecular modeling. The study of eight combinations of triplexes (D D:D, R* D:D, D D:R*, R* D:R*, D R:D, R* R:D, DR:R*, and R*-R:R*; where the first, middle, and last letters stand for the Hoogsteen Pyrimidine, Watson-Crick [WC] purine and WC pyrimidine strands, respectively, and D, R and R* stand for DNA, RNA and 2′-OMe-RNA strands, respectively) indicate more stable foldback triplex formation with a DNA purine strand than with an RNA purine strand. Of the four possible WC duplexes with RNA/DNA combinations, the duplex with a DNA purine strand and a 2′-O-Me-RNA pyrimidine strand forms the most thermally stable triplex, although its thermal stability is the lowest of all four duplexes. Irrespective of the duplex combination, a 2′-OMe-RNA Hoogsteen pyrimidine strand forms a stable foldback triplex over a DNA Hoogsteen pyrimidine strand confirming the earlier reports with conventional and circular triplexes. The CD studies suggest a B-type conformation for an all DNA homo-foldback triplex (D.D.D), while hetero-foldback triplex spectra suggest intermediate conformation to both Atype and B-type structures. A novel molecular modeling study has been carried out to understand the stereochemical feasibility of all the combinations of foldback triplexes using a geometric approach. The new approach allows use of different combinations of chain geometries depending on the nature of the chain (RNA vs. DNA).     

Stabilization of PyPuPu triplexes with bivalent cations.

We studied the formation of stable PyPuPu intermolecular triplexes under neutral pH in the presence of bivalent cations (Mg, Ca, Mn, Co, Ni, Cu, Zn, Cd, and Ba) with the help of the photo- and DMS footprinting assays. The cations which stabilize d(C)n.d(G)n.d(G)n and d(TC)n.d(GA)n.d(AG)n triplexes were determined. Among them, Zn++ ions stabilized both triplexes, whereas Mg++ ions stabilize CGG triplexes, but do not stabilize TC.GA.AG triplexes. We have shown that an arbitrary purine sequence forms the PyPuPu triplex in the presence of Zn++ ions, and that the purine third strand is antiparallel with respect to the purine strand within the duplex.     

Oligonucleotide-directed triple helix formation at adjacent oligopurine and oligopyrimidine DNA tracts by alternate strand recognition.

A significant limitation to the practical application of triplex DNA is its requirement for oligopurine tracts in target DNA sequences. The repertoire of triplex-forming sequences can potentially be expanded to adjacent blocks of purines and pyrimidines by allowing the third strand to pair with purines on alternate strands, while maintaining the required strand polarities by combining the two major classes of base triplets, Py.PuPy and Pu.PuPy. The formation of triplex DNA in this fashion requires no unusual bases or backbone linkages on the third strand. This approach has previously been demonstrated for target sequences of the type 5'-(Pu)n(Py)n-3' in intramolecular complexes. Using affinity cleaving and DNase I footprinting, we show here that intermolecular triplexes can also be formed at both 5'-(Pu)n(Py)n-3' and 5'-(Py)n(Pu)n-3' target sequences. However, triplex formation at a 5'-(Py)n(Pu)n-3' sequence occurs with lower yield. Triplex formation is disfavored, even at acid pH, when a number of contiguous C+.GC base triplets are required. These results suggest that triplex formation via alternate strand recognition at sequences made up of blocks of purines and pyrimidines may be generally feasible.     

Investigation of the formation and intracellular stability of purine.(purine/pyrimidine) triplexes.

In a previous work we showed that a short triple helix-forming oligonucleotide (TFO) targeted to the murine c-pim-1 proto-oncogene promoter gives a very stable triple helix under physiological conditions in vitro . Moreover, this triplex was stable inside cells when preformed in vitro . However, we failed to detect triplex formation for this sequence inside cells in DMS footprinting studies. In the present work, in order to determine whether our previous in vivo results are limited to this particular short triplex or can be generalized to other purine.(purine/pyrimidine) triplexes, we have tested three other DNA targets already described in the literature. All these purine.(purine/pyrimidine) triplexes are specific and stable at high temperature in vitro . In vivo studies have shown that the preformed triplexes are stable inside cells for at least 3 days. This clearly demonstrates that intracellular conditions are favourable for the existence of purine. (purine/pyrimidine) triplexes. The triplexes can also be formed in nuclei. However, for all the sequences tested, we were unable to detect any triple helix formation in vivo in intact cells by DMS footprinting. Our results show that neither (i) chromatinization of the DNA target, (ii) intracellular K+concentration nor (iii) cytoplasmic versus nuclear separation of the TFO and DNA target are responsible for the intracellular arrest of triplex formation. We suggest the existence of a cellular mechanism, based on a compartmentalization of TFOs and/or TFO trapping, which separates oligonucleotides from the DNA target. Further work is needed to find oligonucleotide derivatives and means for their delivery to overcome the problem of triplex formation inside cells.     

Effect of strand orientation on the interaction of berenil with DNA triple helices

Using circular dichroism spectroscopy the ability of berenil, a minor groove binding drug, to induce triple helix formation was investigated with two oligonucleotides designed to form two intramolecular triplexes containing T*A:T and G*G:C triplets, which differ only by the orientation of their third strand: 5'-d(G4A4G4-[T4]-C4T4C4-[T4]-G4T4G4), and 5'-d(G4T4G4-[T4]-G4A4G4-[T4]-C4T4C4), where [T4] represents a stretch of four thymine residues. We demonstrate that when added to the duplex form of these oligonucleotides, berenil induces triplex structure formation only if the orientation of third strand is anti-parallel to the purine strand.     

Energetics of strand-displacement reactions in triple helices: a spectroscopic study.

DNA triple helices offer exciting new perspectives toward oligonucleotide-directed inhibition of gene expression. Purine and GT triplexes appear to be the most promising motifs for stable binding under physiological conditions compared to the pyrimidine motif, which forms at relatively low pH. There are, however, very little data available for comparison of the relative stabilities of the different classes of triplexes under identical conditions. We, therefore, designed a model system which allowed us to set up a competition between the oligonucleotides of the purine and pyrimidine motifs targeting the same Watson-Crick duplex. Several conclusions may be drawn: (i) a weak hypochromism at 260 nm is associated with purine triplex formation; (ii) delta H degree of GA, GT and TC triplex formation (at pH 7.0) was calculated as -0.1, -2.5 and -6.1 kcal/mol per base triplet, respectively. This unexpectedly low delta H degree for the purine triple helix formation implies that its delta G degree is nearly temperature-independent and it explains why these triplexes may still be observed at high temperatures. In contrast, the pyrimidine triplex is strongly favoured at lower temperatures; (iii) as a consequence, in a system where two third-strands compete for triplex formation, displacement of the GA or GT strand by a pyrimidine strand may be observed at neutral pH upon lowering the temperature. This original purine-to-pyrimidine triplex conversion shows a significant hypochromism at 260 nm and a hyperchromism at 295 nm which is similar to the duplex-to-triplex conversion in the pyrimidine motif. Further evidence for this triplex-to-triplex conversion is provided by mung bean-nuclease foot-printing assay.     

Extension of the range of DNA sequences available for triple helix formation: stabilization of mismatched triplexes by acridine-containing oligonucleotides.

Triple helix formation usually requires an oligopyrimidine*oligopurine sequence in the target DNA. A triple helix is destabilized when the oligopyrimidine*oligopurine target contains one (or two) purine*pyrimidine base pair inversion(s). Such an imperfect target sequence can be recognized by a third strand oligonucleotide containing an internally incorporated acridine intercalator facing the inverted purine*pyrimidine base pair(s). The loss of triplex stability due to the mismatch is partially overcome. The stability of triplexes formed at perfect and imperfect target sequences was investigated by UV thermal denaturation experiments. The stabilization provided by an internally incorporated acridine third strand oligonucleotide depends on the sequences flanking the inverted base pair. For triplexes containing a single mismatch the highest stabilization is observed for an acridine or a propanediol tethered to an acridine on its 3'-side facing an inverted A*T base pair and for a cytosine with an acridine incorporated to its 3'-side or a guanine with an acridine at its 5'-side facing an inverted G*C base pair. Fluorescence studies provided evidence that the acridine was intercalated into the triplex. The target sequences containing a double base pair inversion which form very unstable triplexes can still be recognized by oligonucleotides provided they contain an appropriately incorporated acridine facing the double mismatch sites. Selectivity for an A*T base pair inversion was observed with an oligonucleotide containing an acridine incorporated at the mismatched site when this site is flanked by two T*A*T base triplets. These results show that the range of DNA base sequences available for triplex formation can be extended by using oligonucleotide intercalator conjugates.     

Hydrated Water Molecules of Pyrimidine/Purine/Pyrimidine DNA Triple Helices as Revealed by FT-IR Spectroscopy: A Role of Cytosine Methylation

Abstract

Hydrated water molecules of pyrimidine/purine/pyrimidine DNA hairpin triplex was studied by a comparison of triplex (CC·AG6) formed by a host oligodeoxypyrimidine of 5′- d(TC)₃T₄(CT)₃ (CC) with a target hexadeoxypurine 5′-d(AG)₃ (AG6) strand and by triplexes (MM·AG6, MC·AG6, and CM·AG6) formed by oligonucleotides with the exact sequences as above except 5-methylcytosine replaced all (MM), 5′ end half (MC), and 3′ end half (CM) cytosine bases in CC via FT-IR spectroscopy in hydrated film. Results revealed that: (i) all these triplexes have a similar hydration pattern, in which water molecules probably bound in the N₇ sites of adenines and guanines in the Crick-Hoogsteen groove, and to the methyl group of thymidines in the Watson-Hoogsteen groove. There are also some bound water molecules found at the O₂ sites of thymines in both Watson-Crick and Crick-Hoogsteen grooves, (ii) In the CC·AG6 triplex the S-type sugars are always dominant in all hydrated states, whereas in MM·AG6 triplex the relative population of the N-type sugars is very close to that of the S-type between 86% and 66% of humidity. Furthermore, the sugar conformation in two partially modified triplexes (CM·AG6, and MC·AG6) are dominant by the N-type at lower humidity. This phenomenon might reflect that the degree of bound water varies among the binding sites of bases, (iii) The effect of introducing a methyl group on cytosine is to generates spine of hydrophobic region in MM (MC and MC). The enlarging hydrophobic area not only increase the stability in solution, and also the stability in sodium hydrated films of the pyrimidine/purine/pyrimidine hairpin triplexes.     

Intramolecular triple-helix formation at (PunPyn).(PunPyn) tracts: recognition of alternate strands via Pu.PuPy and Py.PuPy base triplets.

Triple-helical DNA shows increasing potential for applications in the control of gene expression (including therapeutics) and the development of sequence-specific DNA-cleaving agents. The major limitation in this technology has been the requirement of homopurine sequences for triplex formation. We describe a simple approach that relaxes this requirement, by utilizing both Pu.PuPy and Py.PuPy base triplets to form a continuous DNA triple helix at tandem oligopurine and oligopyrimidine tracts. [Triplex formation at such a sequence has been previously demonstrated only with the use of a special 3'-3' linkage in the third strand [Horne, D. A., & Dervan, P. B. (1990) J. Am. Chem. Soc. 112, 2435-2437].] Supporting evidence is from chemical probing experiments performed on several oligonucleotides designed to form 3-stranded fold-back structures. The third strand, consisting of both purine and pyrimidine blocks, pairs with purines in the Watson-Crick duplex, switching strands at the junction between the oligopurine and oligopyrimidine blocks but maintaining the required strand polarity without any special linkage. Although Mg2+ ions are not required for the formation of Pu.PuPy base triplets, they show enhanced stability in the presence of Mg2+. In the sequences observed. A.AT triplets appear to be more stable than G.GC triplets. As expected, triplex formation is largely independent of pH unless C+.GC base triplets are required.     

Triplex DNA in plasmids and chromosomes

Circular plasmids containing pyrimidine purine tracts can form both inter-and intramolecular triplexes. Addition of poly(dTC) to plasmid pTC45, which contains a (TC)45.(GA)45 insert, results in intermolecular triplex formation. Agarose-gel electrophoresis gives rise to many well-resolved bands, which correspond to 1, 2, 3, 4... plasmid molecules attached to the added pyrimidine strand. In the electron microscope these complexes appear as a rosette of petals. The mobility of these triplex-containing complexes can be retarded by the addition of a triplex-specific monoclonal antibody, Jel318. Intramolecular triplex formation can be demonstrated at pH 5 in pTC45 and also in pT463-I, a plasmid containing a segment of a crab satellite DNA with both (G)n.(C)n and (TCC)n.(GGA)n inserts. However, although the intermolecular triplex remains stable for some time at pH 8, intramolecular triplex formation only occurs at low pH. Triplexes can also be detected by an immunoblotting procedure with Jel318. This unfamiliar structure is readily demonstrated in eukaryotic extracts, but not in cell extracts from Escherichia coli. Triplexes may thus be an inherent feature of eukaryotic chromosome structure.     

Exclusion of RNA strands from a purine motif triple helix.

Research concerning oligonucleotide-directed triple helix formation has mainly focused on the binding of DNA oligonucleotides to duplex DNA. The participation of RNA strands in triple helices is also of interest. For the pyrimidine motif (pyrimidine.purine.pyrimidine triplets), systematic substitution of RNA for DNA in one, two, or all three triplex strands has previously been reported. For the purine motif (purine.purine.pyrimidine triplets), studies have shown only that RNA cannot bind to duplex DNA. To extend this result, we created a DNA triple helix in the purine motif and systematically replaced one, two, or all three strands with RNA. In dramatic contrast to the general accommodation of RNA strands in the pyrimidine triple helix motif, a stable triplex forms in the purine motif only when all three of the substituent strands are DNA. The lack of triplex formation among any of the other seven possible strand combinations involving RNA suggests that: (i) duplex structures containing RNA cannot be targeted by DNA oligonucleotides in the purine motif; (ii) RNA strands cannot be employed to recognize duplex DNA in the purine motif; and (iii) RNA tertiary structures are likely to contain only isolated base triplets in the purine motif.     

Effect of a 5'-phosphate on the stability of triple helix.

An effect of 5'-phosphorylation on the stability of triple helical DNA containing pyrimidine:purine:pyrimidine strands has been demonstrated by both gel electrophoresis and UV melting. A 5'-phosphate on the purine-rich middle strand of a triple helix lowers the stability of triple helix formation by approximately 1 kcal/mol at 25 degrees C. The middle strand is involved in both Watson-Crick and Hoogsteen base pairing. In contrast, a 5'-phosphate on the pyrimidine-rich strands, which are involved in either Watson-Crick or Hoogsteen base pairing, has a smaller effect on the stability of triple helix. The order of stability is: no phosphate on either strand > phosphate on both pyrimidine strands > phosphate on purine strand > phosphate on all three strands. Differential stability of triple helix species is postulated to stem from an increase in rigidity due to steric hindrance from the 5'-phosphate. This result indicates that labelling with 32P affect equilibrium in triplex formation.     

Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.     

Protection of DNA sequences by triplex-bridge formation.

We have demonstrated that the DNA sequence between two triplex-forming polypurine.polypyrimidine (Pu.Py) tracts was protected from DNA modifying enzymes upon formation of triplex DNA structures with an oligodeoxyribonucleotide in which two triplex-forming Pu or Py tracts were placed at the termini (triplex-bridge formation). In model experiments, when two triplex structures were formed between double-stranded DNA with the sequence (AG)17-(N)18-(T)34, and an oligodeoxyribonucleotide, (T)34-(N)18-(GA)17, not only the Pu.Py tracts but also the 18 bp non-Pu.Py sequence in the duplex DNA between the tracts was protected from restriction enzymes, HpaII methylase and DNase I. This protection occurred only when both of the Pu.Py tracts were involved as triplexes. The length of the tracts could be as short as 21 bp, while the difference in length between the non-Pu.Py sequences on the duplex and the oligodeoxyribonucleotide should be within 10 nucleotides. The efficiency of protection was enhanced in the presence of a cationic detergent, cetyltrimethylammonium bromide, during triplex formation. Protection was also observed with another type of the triplex bridge formed between (G)34 and (T)34 tracts with an oligodeoxyribonucleotide, (T)34-(N)20-(G)34. These findings suggest that the protection of specific DNA sequences from enzymes by triplex-bridge formation can be applied to any DNA sequence by placing it between two triplex-forming sequences.     

"Paper-clip" type triple helix formation by 5'-d-(TC)3Ta(CT)3Cb(AG)3 (a and b = 0-4) as a function of loop size with and without the pseudoisocytosine base in the Hoogsteen strand

The formation of a DNA "paper-clip" type triple helix (triplex) with a common sequence 5'-d-(TC)(3)T(a)()(CT)(3)C(b)()(AG)(3) (a and b = 0-4) was studied by UV thermal melting experiments and CD spectra. These DNA oligomers form triplexes and duplexes under slightly acidic and neutral conditions, respectively. The stability of the formed triplexes (at pH 4.5) or duplexes (at pH 7.0 or 8.0) does not vary significantly with the size of the loops (a and b = 1-4). At pH 6.0, the triplex stability is, however, a function of a and b. It is also interesting to note that the oligomer 5'-d-(TC)(3)(CT)(3)(AG)(3) (a and b = 0) forms a stable triplex at pH 4.5 with a slightly lower T(m) value, due to dissociation of a base triad at one end and a distorted base triad at the other, observed by (1)H NMR. Thus, we have here a model system, 5'-d-(TC)(3)T(a)(CT)(3)C(b)(AG)(3), that could form a triplex effectively with (a and b = 1-4) and without (a and b = 0) loops under acidic conditions. In addition, the triplex formation of oligomers with replacement of one, two, or three 2'-deoxycytidine in the Hoogsteen strand by either 2'-deoxypseudoisocytidine (D) or 2'-O-methylpseudoisocytidine (M) was also studied in the sequence 5'-d-(TX)(3)T(2)(CT)(3)C(2)(AG)(3) (where X is C, D, or M). Both CD spectra and UV melting results showed that only D3 [(TX)(3) = (TD)(3)] and M3 [(TX)(3) = (TM)(3)] were able to form the paper-clip structure under both neutral and acidic conditions. This is because the N(3)H of a pseudoisocytosine base can serve as a proton donor without protonation. We hereby proved that the 2'-deoxypseudoisocytidine, similar to 2'-O-methylpseudoisocytidine, could replace 2'-deoxycytidine in the Hoogsteen strand to provide triplex formation at neutral pH.     

Chemical modification of the third strand: differential effects on purine and pyrimidine triple helix formation.

DNA triple helices offer exciting perspectives toward oligonucleotide-directed control of gene expression. Oligonucleotide analogues are routinely used with modifications in either the backbone or the bases to form more stable triple-helical structures or to prevent their degradation in cells. In this article, different chemical modifications are tested in a model system, which sets up a competition between the purine and pyrimidine motifs. For most modifications, the DeltaH degrees of purine triplex formation is close to zero, implying a nearly temperature-independent affinity constant. In contrast, the pyrimidine triplex is strongly favored at lower temperatures. The stabilization induced by modifications previously known to be favorable to the pyrimidine motif was quantified. Interestingly, modifications favorable to the GT motif (propynyl-U and dU replacing T) were also discovered. In a system where two third strands compete for triplex formation, replacement of the GA or GT strand by a pyrimidine strand may be observed at neutral pH upon lowering the temperature. This purine-to-pyrimidine triplex conversion depends on the chemical nature of the triplex-forming strands and the stability of the corresponding triplexes.     

Evidence from CD spectra and melting temperatures for stable Hoogsteen-paired oligomer duplexes derived from DNA and hybrid triplexes.

The pyr*pur.pyr type of nucleic acid triplex has a purine strand that is Hoogsteen-paired with a parallel pyrimidine strand (pyr*pur pair) and that is Watson-Crick-paired with an antiparallel pyrimidine strand (pur.pyr pair). In most cases, the Watson-Crick pair is more stable than the Hoogsteen pair, although stable formation of DNA Hoogsteen-paired duplexes has been reported. Using oligomer triplexes of repeating d(AG)12 and d(CT)12 or r(CU)12 sequences that were 24 nt long, we found that hybrid RNA*DNA as well as DNA*DNA Hoogsteen-paired strands of triplexes can be more stable than the Watson-Crick-paired strands at low pH. The structures and relative stabilities of these duplexes and triplexes were evaluated by circular dichroism (CD) spectroscopy and UV absorption melting studies of triplexes as a function of pH. The CD contributions of Hoogsteen-paired RNA*DNA and DNA*DNA duplexes were found to dominate the CD spectra of the corresponding pyr*pur.pyr triplexes.     

Structure, stability, and thermodynamics of a short intermolecular purine-purine-pyrimidine triple helix

We have investigated the structure and physical chemistry of the d(C3T4C3).2[d(G3A4G3)] triple helix by polyacrylamide gel electrophoresis (PAGE), 1H NMR, and ultraviolet (UV) absorption spectroscopy. The triplex was stabilized with MgCl2 at neutral pH. PAGE studies verify the stoichiometry of the strands comprising the triplex and indicate that the orientation of the third strand in purine-purine-pyrimidine (pur-pur-pyr) triplexes is antiparallel with respect to the purine strand of the underlying duplex. Imino proton NMR spectra provide evidence for the existence of new purine-purine (pur.pur) hydrogen bonds, in addition to those of the Watson-Crick (W-C) base pairs, in the triplex structure. These new hydrogen bonds are likely to correspond to the interaction between third-strand guanine NH1 imino protons and the N7 atoms of guanine residues on the purine strand of the underlying duplex. Thermal denaturation of the triplex proceeds to single strands in one step, under the conditions used in this study. Binding of the third strand appears to enhance the thermal stability of the duplex by 1-3 degrees C, depending on the DNA concentration. The free energy of triplex formation (-26.0 +/- 0.5 kcal/mol) is approximately twice that of duplex formation (-12.6 +/- 0.7 kcal/mol), suggesting that the overall stability of the pur.pur base pairs is similar to that of the W-C base pairs.(ABSTRACT TRUNCATED AT 250 WORDS)