Endcaps for Stabilizing Short DNA Duplexes

Abstract

The syntheses of endcaps for covalently linking the 3′ and 5′ hydroxyl groups of blunt end double-stranded DNA are described. Endcap diols were converted into DMTr protected phosphoramidites and incorporated between nucleotides 4 and 5 of a self-complementary octamer. The stabilizing effect of the endcaps on duplex DNA was determined by T_m experiments on the self-complementary octamer.     

Effect of dangling ends on the stability of a DNA double helix.

The effect of 3' and 5' dangling ends has been studied on the stability of a self-complementary double-helix of d(ATGCGCAT) in 1 mol dm-3 NaCl-phosphate buffer. It was shown that the effect on the DNA was smaller than that on r(AUGCAU).     

Porphyrin substituted phosphoramidites: new building blocks for porphyrin-oligonucleotide syntheses

Thymidine phosphoramidites containing trispyridylphenyl and tetraphenylporphyrin chromophores attached via a short amide linker in the 3'-position have been synthesized and used as building blocks in solid-phase synthesis of self-complementary 8-mer oligonucleotides 3'-T-5'-GCGCGCA-3' and 5'-ACGCGCGT-3'. To our knowledge, these are the first porphyrin-oligonucleotide conjugates carrying the porphyrin chromophores in the 3'-position. Chain assembly was achieved by automated solid-phase synthesis and by inexpensive straightforward 'in flask' modification of commercially available solid supported oligonucleotides. This approach allows the synthesis of modified oligonucleotides without using costly instrumentation for automated DNA synthesis. Porphyrin-containing self-complementary oligonucleotides are expected to be a valuable model for drug binding studies and determination of conformational changes in DNA sequences using circular dichroism.     

Caesium fluoride-induced changes in the c.d. spectra of synthetic DNA fragments

Ten DNA fragments containing self-complementary alternating sequences of adenine and thymine differing in length and the starting nucleotide were studied by c.d. spectroscopy. It was found that d(TATATATA) but not d(ATATATAT), d(TATATA), d(CTATATAG) or (dT-dA)20 isomerized into the unusual X-DNA double helix at molar concentrations of CsF in solution. But in contrast to poly(dA-dT), the octamer (dT-dA)4, isomerized very slowly, at relatively low CsF concentrations and the isomerization was strongly dependent on the octamer concentration. A model is proposed to account for the observed properties of the B-to-X isomerization on the oligomer level.     

Conformational variations in d(TGACGTCA) and its reverse sequence d(ACTGCAGT): a joint circular dichroism and nuclear magnetic resonance study

Circular dichroism (CD) and nuclear magnetic resonance (NMR) techniques have been used to characterize the structural properties of the two self-complementary DNA octamers d(TGACGTCA) (I) and d(ACTGCAGT) (II). These display as distinctive features reverse sequences and central steps CpG and GpC, respectively. CD experiments lead to B-form DNA spectra characterized by larger magnitude signals in the case of octamer (I). NMR COSY spectra indicate that in the two octamers all the residues are predominantly south, S, (2'-endo) sugar conformation. NMR NOESY spectra show most of the glycosidic angles confined in the range predicted for B-form DNA although important heterogeneity is noticed along the chains, more pronounced in the case of octamer (I). Both the increase of north, N, (3'-endo) sugar conformation and P (pseudorotation phase angle) deviation from its standard B-form DNA value (162 degrees) express local sequence dependent structure distortions, remarkably visible in CpG step of octamer (I) and agreeing with NOESY cross-peaks intensities. Results interpreted according to Calladine's rules indicate higher cross-chain strains in octamer (I) than in octamer (II). All together, we find evidence to support for octamer (I) in solution local structures with A-DNA properties likely dictated by the central CpG step. Such structures could be involved in the DNA recognition by proteins and anticancerous drugs.     

H-NMR studies on d(GCTTAAGC)2 and its complex with berenil.

Two-dimensional (2D) 1H-NMR spectroscopy has been used to analyze the structure of d(GCTTAAGC)2 and its interaction with berenil in solution. Nuclear Overhauser enhancement connectivities enabled sequential assignments of nearly all proton resonances in the self-complementary octamer duplex and demonstrated that the oligonucleotide is primarily in a B-type conformation. No major conformational changes were observed by the addition of berenil, but proton resonances of the two adenosine nucleotides shifted substantially. Intermolecular nuclear Overhauser effects between berenil and the DNA duplex revealed that the drug binds via the minor groove of d(GCTTAAGC)2 in the A.T-base-pair region. At 18 degrees C the twofold symmetry of the duplex is preserved on berenil binding. However, strongly shifted proton resonances broadened significantly. A model is proposed for the berenil-d(GCTTAAGC)2 complex involving fast exchange of berenil between two equivalent symmetry-related binding sites, which span the 5'-TAA-3' region and are asymmetrically disposed with respect to the dyad axis of the duplex. These results are compared with previous studies on the berenil-d(GCAATTGC)2 complex.     

Hairpin and duplex formation of the DNA octamer d(m5C-G-m5C-G-T-G-m5C-G) in solution. An NMR study.

The partly self-complementary DNA octamer d(m5C-G-m5C-G-T-G-m5C-G) was investigated by NMR spectroscopy in solution. It is demonstrated that this peculiar DNA fragment, under suitable conditions of concentration, salt and temperature, exclusively prefers to adopt a monomeric hairpin form with a stem of three Watson-Crick type base pairs and a loop of two residues. At high single strand concentration (8 mM DNA) and low temperature (i.e. below 295 K) the hairpin occurs in slow equilibrium with a B-dimer structure. At high ionic strength (greater than or equal to 100 mM Na+) and/or in the presence of methanol a third species appears, which is assigned to a Z-like dimer. In the B form, as well as in the Z dimer, the two central base pairs form G.T wobble pairs with the bases as major tautomers.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

The crystal structure at 1.5 angstroms resolution of an RNA octamer duplex containing tandem G.U basepairs

The crystal structure of the RNA octamer, 5'-GGCGUGCC-3' has been determined from x-ray diffraction data to 1.5 angstroms resolution. In the crystal, this oligonucleotide forms five self-complementary double-helices in the asymmetric unit. Tandem 5'GU/3'UG basepairs comprise an internal loop in the middle of each duplex. The NMR structure of this octameric RNA sequence is also known, allowing comparison of the variation among the five crystallographic duplexes and the solution structure. The G.U pairs in the five duplexes of the crystal form two direct hydrogen bonds and are stabilized by water molecules that bridge between the base of guanine (N2) and the sugar (O2') of uracil. This contrasts with the NMR structure in which only one direct hydrogen bond is observed for the G.U pairs. The reduced stability of the r(CGUG)2 motif relative to the r(GGUC)2 motif may be explained by the lack of stacking of the uracil bases between the Watson-Crick and G.U pairs as observed in the crystal structure.     

Characteristics of the nascent and non-nascent small DNA molecules found in Escherichia coli

We have purified nascent DNA molecules from Escherichia coli pulse-labeled with 5-bromo[6-3H]deoxyuridine by repeated chromatography on nitrocellulose and isopycnic centrifugation in CsCl. The nascent molecules were labeled with 32P either at their 5' ends using polynucleotide kinase or at their 3' ends using terminal transferase. Compared to the non-nascent DNA of normal density, the nascent dense DNA contained a higher proportion of molecules terminated at their 5' ends with ribonucleotides. Exposure of the dense DNA to alkali generated 5' OH termini quantitatively equivalent to the number of molecules bearing 5' ribonucleotides. Experiments designed (1) to detect structures at the 5' ends of phosphatase-treated nascent DNA molecules that caused them to be resistant to hydrolysis by spleen exonuclease or (2) to detect polypeptides that were associated covalently with small DNA molecules and could be iodinated with the Bolton-Hunter reagent did not yield positive results. We conclude that many, if not all, of the intermediates in E. coli DNA replication are initiated with one or more ribonucleotides. The nascent molecules are outnumbered by small non-nascent DNA molecules in the cell, many of which appear to become slightly longer when cells are pulsed with thymidine. Many of the non-nascent DNA molecules behave as if they were self-complementary or crosslinked.     

Cooperative effects in long-range 1,4 DNA-DNA interstrand cross-links formed by polynuclear platinum complexes: an unexpected syn orientation of adenine bases outside the binding sites

The novel phase II anticancer drug BBR3464 ([[ trans-PtCl(NH(3))(2)](2)- micro -[ trans-Pt(NH(3))(2)(NH(2)(CH(2))(6)NH(2))(2)]](NO(3))(4)) forms a 1,4-interstrand cross-link adduct with the self-complementary DNA octamer 5'-d(ATG*TACAT)(2)-3', with the two platinum atoms coordinated in the major groove at the N7 positions of guanines that are four base pairs apart on opposite DNA strands. The "central" tetraamine linker [ trans-H(2)N(CH(2))(6)NH(2)Pt(NH(3))(2)NH(2)(CH(2))(6)NH(2)] was located in or close to the minor groove. The adduct was characterized and analyzed by MS, UV and NMR spectroscopy. NMR analysis of the adduct shows strong H8/H1' intraresidue crosspeaks observed for the A1 and A7 resonances, consistent with a syn conformation for these bases which is usually not observed for adenine residues and bases not directly involved in the cross-link in oligonucleotides. The strong intraresidue H8/H1' crosspeak is also observed for G3. Examination of the structure thus reveals unusual cooperative effects unique to this class of anticancer drugs and is the first demonstration of cooperative effects in solution for an anticancer drug. The significant characteristic of the structure is the lack of severe DNA distortion such as a kink, directed bend or significant unwinding of the helices which are characteristic for DNA adducts of mononuclear complexes. This may contribute to the lack of protein recognition of the cross-link by HMG-domain proteins, a biological consequence significantly different from that of mononuclear complexes such as cisplatin. Since DNA is the principal target in vivo for these Pt cross-linking agents, the unique structural perturbations induced by BBR3464 cross-links are likely related to its increased cytotoxicity and antitumor activity as compared to cisplatin ( cis-DDP).     

Formation, stability and core histone positioning of nucleosomes reassembled on bent and other nucleosome-derived DNA

DNA originating from chicken erythrocyte mononucleosomes was cloned and sequenced. The properties of nucleosome reconstruction were compared for two cloned inserts, selected on account of their interesting sequence organization, length and difference in DNA bending. Cloned fragment 223 (182 base-pairs) carries alternatively (A)3-4 and (T)4-5 runs approximately every ten base-pairs and is bent; cloned fragment 213 (182 base-pairs) contains a repeated C4-5ATAAGG consensus sequence and is apparently not bent. Our experiments indicate the preference of the bent DNA fragment 223 over fragment 213 to associate in vitro with an octamer of histones under stringent conditions. We provide evidence that the in vitro nucleosome formation is hampered in the case of fragment 213, whereas the reconstituted nucleosomes were equally stable once formed. For the correct determination of the positioning of the histone octamer with regard to the two nucleosome-derived cloned DNA sequences, the complementary use of micrococcal nuclease, exonuclease III and DNase I is a prerequisite. No unique, but rotationally related, positions of the histone octamer were found on these nucleosome-derived DNA fragments. The sequence-dependent anisotropic flexibility, as well as intrinsic bending of the DNA, resulting in a rotational setting of the DNA fragments on the histone core, seems to be a strong determinant for the allowed octamer positions, Exonuclease III digestion indicates a different histone-DNA association when oligo(d(C.G)n) stretches are involved. The apparent stagger near oligo(d(A.T)n) stretches generated by DNase I digestion on reconstituted nucleosome 223 was found to be inverted from the normal two-base 3' overhang to a two-base 5' overhang. Two possibilities of the oligo(d(A.T)n) minor groove location relative to the histone core are envisaged to explain this anomaly in stagger.     

Chromatin remodeling through directional DNA translocation from an internal nucleosomal site

The RSC chromatin remodeler contains Sth1, an ATP-dependent DNA translocase. On DNA substrates, RSC/Sth1 tracks along one strand of the duplex with a 3' --> 5' polarity and a tracking requirement of one base, properties that may enable directional DNA translocation on nucleosomes. The binding of RSC or Sth1 elicits a DNase I-hypersensitive site approximately two DNA turns from the nucleosomal dyad, and the binding of Sth1 requires intact DNA at this location. Results with various nucleosome substrates suggest that RSC/Sth1 remains at a fixed position on the histone octamer and that Sth1 conducts directional DNA translocation from a location about two turns from the nucleosomal dyad, drawing in DNA from one side of the nucleosome and pumping it toward the other. These studies suggest that nucleosome mobilization involves directional DNA translocation initiating from a fixed internal site on the nucleosome.     

Structure and conformation of the duplex consensus acceptor exon:intron junction d[(CpTpApCpApGpGpT). (ApCpCpTpGpTpApG)] deduced from high-field 1H-NMR of non-exchangeable and imino protons

The complementary consensus acceptor exon:intron junction d(ApCpCpTpGpTpApG) has been synthesized by a modified phosphotriester method. The non self-complementary octamer exists in the random coil form in aqueous buffer at 20 degrees C as evidenced by temperature variable 1H-NMR and NOE measurements. The non-exchangeable proton assignments were secured using a combination of techniques including two-dimensional COSY, NOESY and 1H-1H-INADEQUATE. The octamer was annealed with the primary consensus sequence d(CpTpApCpApGpGpT). Confirmation of complete duplex formation was confirmed by detection and assignment of imino protons in D2O:H2O mixtures. Assignment of the non-exchangeable proton signals in the duplex consensus junction was then secured by a combination of two-dimensional COSY correlations, NOESY and NOE experiments. Determination of individual vicinal coupling constants in the component deoxyribose moieties permitted deduction of the population of S conformations in this sequence. It is concluded that the consensus acceptor junction exists in solution in a conformation belonging to the B family, and that the bases are oriented anti. In addition the deoxyribose moieties in the 5' regions exist predominantly in the S form (2'endo-3'exo) whereas those residues on or adjacent to the junction on the primary strand show more N character (2'exo-3'endo). The contiguous bases A5-G6 (adjacent to the junction) and A15-G16 are stacked more closely than the other neighbor bases in this duplex sequence. These subtle structural and conformational differences in the exon:intron junction may serve as recognition signals for these critical sites in the genome.     

Conformational properties of Z-forming DNA oligomers bearing terminal unpaired bases.

Three sets of semi-self-complementary deoxyribonucleotide decamers with the sequence XX-(5meCG)4, (5meCG)4-XX, or Y-(5meCG)4-Y, where XX = AA, CC, GG, or TT and Y = A, C, G, or T, were synthesized along with the self-complementary octamer (5meCG)4. The 8-mer duplex readily undergoes a B-to-Z conformational conversion upon increasing the NaCl concentration with a transitional midpoint of approximately 1.1 M NaCl. The 10-mers should form 8-bp duplexes a with core sequence of [(5meCG)4]2 with 5'-XX overhangs, 3'-XX overhangs, or 5',3'-Y/Y mismatches. Circular dichroism was employed to determine the conformations of all oligomers. Salt titrations were performed to measure the effect of overhangs and terminal mismatches on the B-to-Z conversion. In general, the presence of 5'-XX overhangs results in a transition midpoint equal to or slightly higher than the control, whereas the presence of 3'-XX overhangs results in a transition midpoint slightly lower than the control. The 3'-CC and 5'-GG overhangs are exceptions, with transition midpoints much higher than the control. These oligomers apparently form duplexes with 5',3'-C/C or 5',3'-G/G mismatches abutting a [(G5meC)4]2 duplex core. The presence of terminal mismatches in the third set of oligomers results in transition midpoints higher than the control. Ultraviolet absorbance methods were used to evaluate the effect of the various stacking motifs of the 10-mers on the thermodynamics of melting relative to the 8-mer for both B and Z conformations. We found that in both the B and Z conformations, the presence of an overhang stabilizes the [(5meCG)4]2 duplex, with the 5' overhangs having a greater stabilizing effect relative to the 3' overhangs. The presence of 5',3'-Y/Y mismatches also imparts a stabilizing effect on the control 8-mer in both the B and Z conformations. These results are discussed in terms of stacking interactions of the terminal unpaired bases.