Polyelectrolyte complex micelles composed of c-raf antisense oligodeoxynucleotide-poly(ethylene glycol) conjugate and poly(ethylenimine): effect of systemic administration on tumor growth

An antisense oligodeoxynucleotide (ODN) delivery system based on polyelectrolyte complex (PEC) micelles composed of an ODN-poly(ethylene glycol) (PEG) conjugate and polyethylenimine (PEI) was demonstrated. The PEC micelles having a core/shell structure were spontaneously formed in an aqueous solution by ionic interactions between ODN part in the conjugate and PEI. The ODN/PEI polyelectrolyte complex formed an inner core while PEG chains surrounded it as a shell. The morphology of the micelles was visualized as a separate sphere by atomic force microscopy (AFM). When the micelles containing a c-raf antisense ODN were intravenously administered into tumor-bearing nude mice, significant antitumor activities against human lung cancer were observed. The intravenously injected micelles also showed significantly higher accumulation level in the solid tumor region compared to that of naked ODN.     

Peptide hydrogels for affinity-controlled release of therapeutic cargo: Current and potential strategies

The development of devices for the precise and controlled delivery of therapeutics has grown rapidly over the last few decades. Drug delivery materials must provide a depot with delivery profiles that satisfy pharmacodynamic and pharmacokinetic requirements resulting in clinical benefit. Therapeutic efficacy can be limited due to short half-life and poor stability. Thus, to compensate for this, frequent administration and high doses are often required to achieve therapeutic effect, which in turn increases potential side effects and systemic toxicity. This can potentially be mitigated by using materials that can deliver drugs at controlled rates, and material design principles that allow this are continuously evolving. Affinity-based release strategies incorporate a myriad of reversible interactions into a gel network, which have affinities for the therapeutic of interest. Reversible binding to the gel network impacts the release profile of the drug. Such affinity-based interactions can be modulated to control the release profile to meet pharmacokinetic benchmarks. Much work has been done developing affinity-based control in the context of polymer-based materials. However, this strategy has not been widely implemented in peptide-based hydrogels. Herein, we present recent advances in the use of affinity-controlled peptide gel release systems and their associated mechanisms for applications in drug delivery.     

Oligonucleotide structure influences the interactions between cationic polymers and oligonucleotides

We examined the effect of oligodeoxynucleotide (ODN) structure on the interactions between cationic polymers and ODNs. Unstructured and hairpin structured ODNs were used to form complexes with the model cationic polymer, poly-L-lysine (pLL), and the characteristics of these polymer-ODN interactions were subsequently examined. We found that hairpin structured ODNs formed complexes with pLL at slightly lower pLL:ODN charge ratios as compared to unstructured ODNs and that, at high charge ratios, greater fractions of the hairpin ODNs were complexed, as measured by dye exclusion. The dissociation of pLL-ODN interactions was tested further by challenge with heparin, which induced complex disruption. Both the kinetics and heparin dose response of ODN release were determined. The absolute amount and the kinetic rate of ODN release from the complexes of pLL and unstructured ODN were greater, as compared to hairpin ODNs. Our results therefore highlight the role of ODN structure on the association-dissociation behavior of polymer-ODN complexes. These findings have implications for the selection of ODN sequences and design of polymeric carriers used for cellular delivery of ODNs.     

Novel intracellular delivery system of antisense oligonucleotide by self-assembled hybrid micelles composed of DNA/PEG conjugate and cationic fusogenic peptide

An antisense oligonucleotide (ODN), c-myb, was covalently conjugated to poly(ethylene glycol) (PEG) via an acid-cleavable phosphoramidate linkage to form a diblock copolymer-like structure. The phosphoramidate linkage between ODN and PEG was completely cleaved within 5 h in an endosomal acidic condition (pH 4.7). When complexed with a cationic fusogenic peptide, KALA, the ODN/PEG conjugate self-associated to form polyelectrolyte complex micelles in an aqueous solution. The anionic ODN segments were ionically interacted with cationic KALA peptide to form an inner polyelectrolyte complex core, while the PEG segments constituted a surrounding corona. Effective hydrodynamic volume of the micelles was ca. 70 nm with a very narrow size distribution. The polyelectrolyte complex micelles, composed of c-myb ODN-PEG conjugate and KALA, were transported into cells far more efficiently than c-myb ODN itself. They also exhibited higher antiproliferative activity against smooth muscle cells. This study demonstrates that the DNA/PEG hybrid micelles system can be applied for the delivery of antisense oligonucleotide.     

Interaction of fusogenic peptides with an antisense oligonucleotide in solution and in the presence of micelles: conformational studies

The conformational effect of the interaction between various fusogenic peptides and an 18mer single stranded antisense oligonucleotide (ODN), targeted towards the green fluorescent protein mRNA, has been studied by circular dichroism spectroscopy in water and in the presence of anionic lysolipid micelles. The peptides used were the third helix of Antennapedia homeodomain pAntp-(43-58), the flock house virus FHV-gamma-(364-407) peptide, and its N-terminal gamma1-(364-384) and C-terminal gamma2-(390-407) fragments. The most significant conformational changes were observed in ODN-pAntp-(43-58) and ODN-FHV-gamma2 complexes. The pAntp-(43-58) forms a complex with ODN through electrostatic interaction resulting in profound changes in the conformation of both the peptide and the ODN. In the case of FHV-gamma2 peptide the complex formation takes place without altering the structure of ODN, and the decreased ratio of deltaepsilon208/deltaepsilon222 reflects the insertion of the complexed peptide into the micelle.     

Effect of Ala replacement with Aib in amphipathic cell-penetrating peptide on oligonucleotide delivery into cells

A number of cell-penetrating peptides (CPPs) have been characterized and their usefulness as delivery tools has been clarified. As one of the CPPs, model amphipathic peptide (MAP) was developed by integrating both hydrophobic and hydrophilic amino acids in its sequence. In our previous work, we designed MAP(Aib) by replacing five alanine (Ala) residues on the hydrophobic face of the helix in the MAP sequence with α-aminoisobutyric acid (Aib) residues, and the replacement resulted in higher helix propensity, stronger resistance to protease, and higher cell membrane permeability than MAP. As a next step, we examined the efficiency of oligonucleotide (ODN) delivery into cells by MAP(Aib) in comparison with that by MAP. The electrostatically formed MAP(Aib)/ODN complex was more easily taken up by cells than the MAP/ODN complex, and the ODN delivery by MAP(Aib) was via an endocytic pathway. We demonstrated that the incorporation of Aib residues into CPPs enhances the delivery of hydrophilic molecules, such as ODN, into cells.     

Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.     

Novel polymer-DNA hybrid polymeric micelles composed of hydrophobic poly(D,L-lactic-co-glycolic acid) and hydrophilic oligonucleotides.

Biodegradable poly(D,L-lactic-co-glycolic acid) (PLGA) was chemically conjugated to oligonucleotide (ODN) to form an amphiphatic structure which is similar to an A-B type block copolymer. A terminal end of PLGA was activated and reacted with primary amine-terminated ODN. The ODN/PLGA conjugates self-assembled in aqueous solution to form a micellar structure by serving PLGA segments as a hydrophobic core and ODN segments as a surrounding hydrophilic corona. Critical micelle concentration was determined by a spectroflurometric method. Atomic force microscopic observation revealed that the micelle size was around 80 nm. These micelles could release ODN in a sustained manner by controlled degradation of hydrophobic PLGA chains. Compared to unconjugated ODN, the ODN/PLGA micelles could be more efficiently transported within cells, presumably by endocytosis. This study proposes a potential delivery method of ODN into cells by forming hybrid ODN/PLGA micelles.     

Amphiphilic cholic-acid-modified dextran sulfate and its application for the controlled delivery of superoxide dismutase

A novel amphiphilic and biodegradable polyelectrolyte DS-CA is prepared by the esterification of DS with CA. DS-CA can self-assemble into stable nanoparticles in water. SOD can effectively associate with DS-CA at pH = 5.0 by virtue of electrostatic and hydrophobic interactions. SOD release from the complex nanoparticles is slow at pH = 1.2. The release at pH = 7.4 PBS shows an extended behavior and is tunable by changing the weight ratio of SOD to DS-CA as well as the CA substitution degree. Increasing the CA substitution degree of DS-CA can significantly enhance the cellular uptake of the loaded SOD. This study demonstrates that the amphiphilic DS-CA provides a promising strategy for oral delivery of protein/peptide drugs.     

Nanostructured biocomposite scaffolds based on collagen coelectrospun with nanohydroxyapatite

Nanofibrous biocomposite scaffolds of type I collagen and nanohydroxyapatite (nanoHA) of varying compositions (wt %) were prepared by electrostatic cospinning. The scaffolds were characterized for structure and morphology by Fourier transform infrared spectroscopy (FT-IR), scanning electron microscopy (SEM), atomic force microscopy (AFM) and X-ray diffraction (XRD) techniques. The scaffolds have a porous nanofibrous morphology with random fibers in the range of 500-700 nm diameters, depending on the composition. FT-IR and XRD showed the presence of nanoHA in the fibers. The surface roughness and diameter of the fibers increased with the presence of nanoHA in biocomposite fiber as evident from AFM images. Tensile testing and nanoindendation were used for the mechanical characterization. The pure collagen fibrous matrix (without nanoHA) showed a tensile strength of 1.68 +/- 0.10 MPa and a modulus of 6.21 +/- 0.8 MPa with a strain to failure value of 55 +/- 10%. As the nanoHA content in the randomly oriented collagen nanofibers increased to 10%, the ultimate strength increased to 5 +/- 0.5 MPa and the modulus increased to 230 +/- 30 MPa. The increase in tensile modulus may be attributed to an increase in rigidity over the pure polymer when the hydroxyapatite is added and/or the resulting strong adhesion between the two materials. The vapor phase chemical crosslinking of collagens using glutaraldehyde further increased the mechanical properties as evident from nanoindentation results. A combination of nanofibrous collagen and nanohydroxyapatite that mimics the nanoscale features of the extra cellular matrix could be promising for application as scaffolds for hard tissue regeneration, especially in low or nonload bearing areas.     

Adsorption of synthetic homo- and hetero-oligodeoxynucleotides onto highly oriented pyrolytic graphite: atomic force microscopy characterization

DNA adsorption on electrode surfaces is of fundamental interest for the development of DNA-based biosensors. The free adsorption of 10-mer synthetic oligodeoxynucleotides (ODNs) onto highly oriented pyrolytic graphite (HOPG) surfaces was studied using Magnetic AC mode atomic force microscopy (MAC Mode AFM). The mechanism of interaction of nucleic acids with carbon electrode surfaces was elucidated, using 10-mer synthetic homo- and hetero-ODNs sequences of known base sequences, because they allow clear interpretation of the experimental data. AFM images in air revealed different adsorption patterns and degree of HOPG surface coverage for the ODNs, and correlation with the individual structure and base sequence of each ODN molecule will be presented. The results demonstrated that the hydrophobic interactions with the HOPG hydrophobic surface explain the main adsorption mechanism, although other effects such as electrostatic and Van der Waals interactions may contribute to the free adsorption process. The ODNs interacted differently with the HOPG surface, according to the ODN sequence hydrophobic characteristics, being directly depending on the molecular mass, the hydrophobic character of the individual bases and on the secondary structure of the molecule. The importance of the type of base existent at the ODN chain extremities on the adsorption process was investigated and different adsorption patterns were obtained with ODN sequences composed by the same group of bases aligned in a different order.     

Characterization of interaction between cationic lipid-oligonucleotide complexes and cellular membrane lipids using confocal imaging and fluorescence correlation spectroscopy

Complexes formed by cationic liposomes and single-strand oligodeoxynucleotides (CL-ODN) are promising delivery systems for antisense therapy. ODN release from the complexes is an essential step for inhibiting activity of antisense drugs. We applied fluorescence correlation spectroscopy and confocal laser scanning microscopy to monitor CL-ODN complex interaction with membrane lipids leading to ODN release. To model cellular membranes we used giant unilamellar vesicles and investigated the transport of Cy-5-labeled ODNs across DiO-labeled membranes. For the first time, we directly observed that ODN molecules are transferred across the lipid bilayers and are kept inside the giant unilamellar vesicles after release from the carriers. ODN dissociation from the carrier was assessed by comparing diffusion constants of CL-ODN complexes and ODNs before complexation and after release. Freely diffusing Cy-5-labeled ODN (16-nt) has diffusion constant D(ODN) = 1.3 +/- 0.1 x 10(-6) cm2/s. Fluorescence correlation spectroscopy curves for CL-ODN complexes were fitted with two components, which both have significantly slower diffusion in the range of D(CL-ODN) = approximately 1.5 x 10(-8) cm2/s. Released ODN has the mean diffusion constant D = 1.1 +/- 0.2 x 10(-6) cm2/s, which signifies that ODN is dissociated from cationic lipids. In contrast to earlier studies, we report that phosphatidylethanolamine can trigger ODN release from the carrier in the full absence of anionic phosphatidylserine in the target membrane and that phosphatidylethanolamine-mediated release is as extensive as in the case of phosphatidylserine. The presented methodology provides an effective tool for probing a delivery potential of newly created lipid formulations of CL-ODN complexes for optimal design of carriers.     

A new peptide vector for efficient delivery of oligonucleotides into mammalian cells.

The development of antisense and gene therapy has focused mainly on improving methods for oligonucleotide and gene delivery into cells. In the present work, we describe a potent new strategy for oligonucleotide delivery based on the use of a short peptide vector, termed MPG (27 residues), which contains a hydrophobic domain derived from the fusion sequence of HIV gp41 and a hydrophilic domain derived from the nuclear localization sequence of SV40 T-antigen. The formation of peptide vector/oligonucleotide complexes was investigated by measuring changes in intrinsic tryptophan fluorescence of peptide and of mansyl-labelled oligonucleotides. MPG exhibits relatively high affinity for both single- and double-stranded DNA in a nanomolar range. Based on both intrinsic and extrinsic fluorescence titrations, it appears that the main binding between MPG and oligonucleotides occurs through electrostatic interactions, which involve the basic-residues of the peptide vector. Further peptide/peptide interactions also occur, leading to a higher MPG/oligonucleotide ratio (in the region of 20/1), which suggests that oligonucleotides are most likely coated with several molecules of MPG. Premixed complexes of peptide vector with single or double stranded oligonucleotides are delivered into cultured mammalian cells in less than 1 h with relatively high efficiency (90%). This new strategy of oligonucleotide delivery into cultured cells based on a peptide vector offers several advantages compared to other commonly used approaches of delivery including efficiency, stability and absence of cytotoxicity. The interaction with MPG strongly increases both the stability of the oligonucleotide to nuclease and crossing of the plasma membrane. The mechanism of cell delivery of oligonucleotides by MPG does not follow the endosomal pathway, which explains the rapid and efficient delivery of oligonucleotides in the nucleus. As such, we propose this peptide vector as a powerful tool for potential development in gene and antisense therapy.     

Highly efficient cellular uptake of c-myb antisense oligonucleotides through specifically designed polymeric nanospheres.

c-myb antisense oligonucleotides (AS ODNs) were reversibly immobilized to a novel polymeric core shell nanosphere and their cellular uptake and inhibitory effect on HL60 leukemia cell proliferation studied. The nanosphere surface was so designed as to directly bind ODNs via ionic interactions and reversibly release them inside the cells. Compared with the cellular uptake of free oligonucleotide, the use of AS ODN (immobilized to the nanospheres) produced a 50-fold increase in the intracellular concentration. Specifically, a single dose of 320 nM of AS ODN immobilized to the nanospheres was capable of inhibiting HL60 cell proliferation with the same degree of efficiency obtained using a 50-fold higher dose of free AS ODN. Flow cytometric experiments with fluoresceinated ODNs showed a temperature-dependent uptake, which was detectable as early as 2 h after the beginning of treatment. The inhibitory effect on cell proliferation was maintained for up to 8 days of culture. Moreover, the level of c-Myb protein decreased by 24% after 2 days and by 60% after 4 days of treatment, thus indicating a continuous and sustained release of non-degraded AS ODN from the nanospheres inside the cells.     

Microencapsulation of nanoparticulate complexes of DNA with cationic lipids and polymers in pectin beads for targeted gene delivery

Nanoparticulate complexes of plasmid DNA (pDNA) with cationic liposomes/polymer, of approx 200 nm diameter, were encapsulated with a high degree of efficiency within calcium pectinate gel beads. Electron microscopy showed the DNA nanocomplexes to be evenly distributed throughout the gel matrix. Controlled release of pDNA-lipid nanocomplexes was achieved by the action of pectinase enzymes, whereas release of naked and polymer-complexed DNA was found to be more greatly influenced by the swelling behavior of the polysaccharide matrices in buffer alone. Physical degradation of pDNA within pectin beads was found to be accelerated during bead drying, most probably as a result of shear forces generated within the gel matrices by the evaporation of water. Plasmid complexation with cationic liposomes provided a greater degree of protection for the DNA during bead drying than complexation with cationic polymer, and was shown to successfully transfect cultured cells after release from the beads, via the action of pectinase. Observations concerning the physical stability of nanocomplexed pDNA, and its encapsulation within and release from pectin gel beads, are discussed with reference to the electrostatic interactions existing between the various components.     

Self-assembled pH-responsive hydrogels composed of the RATEA16 peptide

Peptide RATEA16 spontaneously self-assembled into higher-order nanofiber hydrogels with extremely high water content (>99.5% (wt/vol)) under physiological condition. The hydrogels could undergo pH-reversible transitions from viscous solution to elastic hydrogel and to precipitate. The supramolecular self-assembly and the three phase transitions are driven by hydrophobic interactions, intermolecular hydrogen bonds, and a combination of attractive or repulsive electrostatic interactions. These hydrogels are rich in beta-sheet nanofibers, as demonstrated by CD and FTIR data. Rheological measurements reveal that the viscoelasticity of the material can be tuned by environmental pH and peptide concentration. The storage modulus of the hydrogels increases with increasing peptide concentration, and the self-assembled hydrogels are able to recover from mechanical breakdowns. AFM images show that the elasticity is attributed to a network nanostructure consisting of fibrous self-assemblies. The hydrogels are promising for a variety of possible biomedical applications, including drug delivery.     

Cellular uptake of ODNs in HIV-1 human-infected cells: a role for viral particles in DNA delivery?

We have previously described how a 16 nucleotides ODN (termed 93del) is capable of inhibiting the activity of recombinant integrase in a cell-free system as well as HIV-1 replication in human-infected cells with IC(50) in the low nanomolar range. Intracellular HIV-1 replication was inhibited when the ODN was added at the onset of infection. These results raise several questions. Is a naked ODN able to enter the cell? Does the virus play a role in ODN entry? The uptake of several ODNs (93del, 60del(sc), TBA, T30923) was evaluated and then tracked by labeling the ODN with a fluorescent dye and assessing its intracellular localization by confocal microscopy. A significant level of cellular uptake of free ODN was observed in several cell lines: HeLa epithelial cells, Huh7 hepatic cells, and H9 lymphocytes, and was detected for all ODNs tested except for TBA. Striking differences were observed when naked ODNs were added to cell in the presence or absence of the virus. When HIV-1 virions were present a sharp increase in cellular fluorescence was observed. These results strongly suggest a role for HIV-1 virions in the uptake of certain ODNs.     

Self-assembled DNA-based giant thrombin nanoparticles for controlled release

Protein-aptamer interactions have been used in a wide range of fields, including medical diagnosis and protein delivery. Herein, we report a method for thrombin delivery with thrombin-binding aptamer (TBA), which is one of the well-known aptamers for thrombin, by generating giant thrombin nanoparticles (GTNPs). GTNPs can be synthesized by crosslinking thrombin with DNA nanostructures that possess several TBA molecules. To generate GTNPs, two different DNA nanostructures were used. Y-shaped DNA with TBA and X-shaped DNA with TBA were used for 250 and 650 nm GTNPs, respectively. Controlled release of thrombin from GTNPs was performed by adding complementary DNA (cDNA) to TBA. To investigate thrombin release from GTNPs, the sizes of the GTNPs were measured using dynamic light scattering, atomic force microscopy (AFM), and scanning electron microscopy (SEM). We confirmed a decrease in the size of GTNPs with various concentrations of cDNA, suggesting the release of thrombin. Based on these results, we expect that our method can be used to control the amount of thrombin released effectively. Our method is also widely applicable for effective protein delivery.